|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 24 December 2003
doi: 10.1242/dev.00951
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Program in Developmental Biology, Baylor College of Medicine, Houston, TX
77030, USA
2 Department of Molecular Genetics, University of Texas M. D. Anderson Cancer
Center, Houston, TX 77030, USA
3 Department of Genetics, Cell Biology, and Development, University of
Minnesota, Minneapolis, MN 55455, USA
4 Howard Hughes Medical Institute, Department of Biochemistry and Molecular
Biophysics, Center for Neurobiology and Behavior, Columbia University, New
York, NY 10032, USA
* Author for correspondence (e-mail: rrb{at}mdanderson.org)
Accepted 14 October 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Müllerian duct, Uterus, Chimera, Lim1 (Lhx1), MIS (AMH), Wnt4, Mouse
| Introduction |
|---|
|
|
|---|
During vertebrate embryogenesis, the urogenital system derives from the
intermediate mesoderm of the gastrula. The female reproductive tract system
develops primarily from the Müllerian (paramesonephric) duct and the male
reproductive tract forms from the Wolffian (mesonephric) duct. In the mouse,
the Wolffian duct is first formed from the intermediate mesoderm by embryonic
day 9 (E9). Subsequently, the Müllerian duct starts to form by
invagination of the surface epithelium of the anterior mesonephros around
E11.5 in the developing urogenital ridge. This epithelial invagination extends
caudally along the Wolffian duct laterally and then medially towards the
cloaca to form the primordium of the female reproductive tract
(Gruenwald, 1941
;
Kaufman and Bard, 1999
). Thus,
embryos have both male and female reproductive tract primordia regardless of
their genetic sex before sexual differentiation occurs. The Müllerian
duct can differentiate into the oviduct, uterus, cervix and upper part of the
vagina of the female reproductive tract. The Wolffian duct can differentiate
into the epididymis, vas deferens and seminal vesicle of the male reproductive
tract.
Mammalian sex determination depends on the genetic sex in the gonad
(Swain and Lovell-Badge, 1999
;
Capel, 2001). XY embryos usually become males and XX embryos usually become
females. It is also known that, XX
XY chimeric mice mostly develop into
males (Tarkowski, 1998
) and
Sertoli cells of the testis from these chimeric animals are predominantly XY
(Burgoyne et al., 1988
;
Palmer and Burgoyne, 1991
;
Patek et al., 1991
). This
indicates that the testis-determining gene acts cell-autonomously in this cell
lineage and that high contribution of XY cells in this cell lineage in the
gonads of XX
XY chimeric mice can result in the male phenotype. The
testis-determining gene on the Y chromosome, Sry, is both essential
and sufficient for triggering testis differentiation to cause male
differentiation (Gubbay et al.,
1990
; Koopman et al.,
1991
). Sry is expressed transiently and dynamically in
the bipotential gonad of XY males
(Bullejos and Koopman, 2001
).
It has been suggested that Sry is expressed in precursor cells of
Sertoli cells (Albrecht and Eicher,
2001
). In XX females, the absence of the Y chromosome permits the
bipotential gonad to differentiate into an ovary leading to the female
phenotype. Although the loss of Y chromosome is known to cause Turner's
syndrome in humans, XO mice are phenotypically normal females except for a
transient developmental delay until early mid-gestation stage and early loss
of oocytes after birth (Morris,
1968
; Lyon and Hawker,
1973
; Burgoyne and Baker,
1981
; Burgoyne et al.,
1983
).
After gonadal sex is determined, the differentiating gonads secrete sexual
hormones to promote sexual differentiation of the body. In males, the fetal
testis secretes hormones including Müllerian inhibiting substance (MIS;
AMH Mouse Genome Informatics), testosterone and insulin-like 3 (Insl3)
(Nef and Parada, 2000
). MIS
causes the elimination of the Müllerian duct and testosterone promotes
the differentiation of the Wolffian duct. In the mouse, regression of the
Müllerian duct system is observed cytologically from E13.5
(Dyche, 1979
). All three
hormones are involved in testicular descent. In humans and mice, males
deficient for MIS or its type II receptor (MISRII; AMHR2 Mouse Genome
Informatics) are normally virilized and possess a male reproductive tract but
fail to regress the Müllerian duct and retain ectopic female reproductive
tract organs (Behringer et al.,
1994
; Mishina et al.,
1996
; Belville et al.,
1999
). In female fetuses, the differentiating ovaries do not
produce MIS, testosterone or Isl3, which allows the Müllerian duct to
differentiate into the female reproductive tract, the Wolffian duct to
degenerate and the ovaries to remain in an intra-abdominal position
(Kobayashi and Behringer,
2003
).
Lim1 (also known as Lhx1) encodes a transcription factor
with a DNA-binding homeodomain and two cysteine-rich LIM domains that are
thought to be involved in protein-protein interactions
(Dawid et al., 1998
;
Bach, 2000
;
Hobert and Westphal, 2000
).
During mouse urogenital system development, Lim1 is expressed in the
intermediate mesoderm at E7.5 and this expression is subsequently restricted
to the nephric duct that differentiates into the Wolffian duct
(Barnes et al., 1994
;
Tsang et al., 2000
).
Lim1 is also expressed in the developing mesonephros in embryos and
in the definitive kidney (metanephros) in both embryos and adults
(Barnes et al., 1994
;
Fujii et al., 1994
;
Karavanov et al., 1996
;
Karavanov et al., 1998
).
Lim1 expression is also detected in the fetal gonad
(Nagamine and Carlisle, 1996
;
Nagamine et al., 1999
;
Birk et al., 2000
;
Bouchard et al., 2002
). These
expression data indicate that Lim1 may play important roles in
multiple processes of urogenital system development, including the
reproductive organs. The Lim1 gene was previously mutated in the
mouse and was found to be required for head and kidney formation
(Shawlot and Behringer, 1995
).
However, except for very rare neonates, most Lim1-null mutants die
around E10 probably owing to the failure of chorio-allantoic fusion to form
the placenta. Therefore, the roles of Lim1 at later stages of
development have remained unclear.
In this study, we show that Lim1 is also expressed in the developing Müllerian duct during female reproductive tract development. This expression for the first time allows for the visualization of Müllerian duct formation and regression in embryos. In the absence of Lim1 function, the female reproductive tract is absent in female neonates. We also show, using a novel female mouse chimera assay, that Lim1 activity is required cell-autonomously in the epithelium of the developing Müllerian duct. These data establish a new and essential role for Lim1 in female reproductive tract development.
| Materials and methods |
|---|
|
|
|---|
PCR genotyping
Mice were genotyped by PCR using the following primers (5' to
3'). For Lim1tlz/+ mice: mLim1-Fw8,
GGCTACCTAAGCAACAACTACA; mLim1-Rv9, AGGAGTGAAGGTCACCGTGA; lacZ-A,
GCATCGAGCTGGGTAATAAGGGTTGGCAAT; and lacZ-B, GACACCAGACCAACTGGTAATGGTAGCGAC.
The wild-type and lacZ bands are 305 bp and 822 bp, respectively. For
Lim1+/ mice: mLim1-Fw8, GGCTACCTAAGCAACAACTACA;
mLim1-Rv9, AGGAGTGAAGGTCACCGTGAG; and PGK-FX3, AGACTGCCTTGGGAAAAGCGC. The
wild-type and mutant bands are 405 bp and
230 bp, respectively. For
Mis mice: mMIS-oIMR501, GGAACACAAGCAGAGCTTCC; mMIS-oIMR502,
GAGACAGAGTCCATCACGTACC; and mMIS-oIMR029, TCGTGCTTTACGGTATCGC. The wild-type
and mutant bands are 243 bp and
520 bp, respectively. For Misr2
mice: mMISR2-FW1, CCTCATACTTTCCTTAGAATGA; mMISR2-Rv2, TATGACCCGTTAGTCTATGACA;
PGK-FX3, AGACTGCCTTGGGAAAAGCGC. The wild-type and mutant bands are 394 bp and
170 bp, respectively. For MT-hMIStg/+ mice: hMIS-Fw1,
CCCTAGTGCTGTCTGCCCT; hMIS-Rv2, GGAGCTGCTGCCATTGCTG; Rap-A,
AGGACTGGGTGGCTTCCAACTCCCAGACAC; and Rap-B, AGCTTCTCATTGCTGCGCGCCAGGTTCAGG. The
transgene and control bands are 176 bp and 590 bp, respectively. For sex
genotyping by Sry: mSry-Fw6, TGACTGGGATGCAGTAGTTC; mSry-Rv6,
TGTGCTAGAGAGAAACCCTG; and Rap-A and RapB primers described above. The
Sry and control bands are
230 bp and 590 bp, respectively. For
Pax2 mice: mPax2-Fw1, CCCACCGTCCCTTCCTTTTCTCCTCA; mPax2-Rv2,
GAAAGGCCAGTGTGGCCTCTAGGGTG; PGK-FX3, AGACTGCCTTGGGAAAAGCGC. The wild-type and
mutant bands are 245 bp and
150 bp, respectively. For Wnt7a
mice: mWnt7a-#553, TCACGTCCTGCACGACGCGAGCTG; mWnt7a-#1143,
CTCTTCGGTGGTAGCTCTGG; mWnt7a-#1144, CCTTCCCGAAGACAGTACGC. The wild-type and
mutant bands are 208 bp and
330 bp, respectively. All PCR protocols were
performed using a DNA Thermal Cycler 480 (Perkin-Elmer, Wellesley, MA) with 35
cycles at 94°C for 30 seconds, 65°C for 30 seconds, 72°C for 45
seconds (except for Mis and Misr2 mice; 35 cycles at
94°C for 30 seconds, 56°C for 30 seconds, 72°C for 45 seconds). A
PCR genotyping method for Wnt4 mice was described previously
(Stark et al., 1994
).
Generation of XO ES cell lines and female chimeras
To generate XO ES cell lines, Lim1/ and
Lim1+/+ Rosa26tg/+ XY ES cell lines
(Shawlot et al., 1999
) were
plated at clonal density on culture dishes coated with feeder cells. Colonies
were recovered and prescreened by dot blot hybridization and subsequently by
Southern hybridization after EcoRI digestion using a Y
chromosome-specific repeat probe Y353/B
(Bishop and Hatat, 1987
).
After expansion of the XO ES cells, their genotypes were reconfirmed by
Southern blot hybridization with Y353/B and a 5' Lim1 probe
(Shawlot and Behringer, 1995
).
The loss of the Y chromosome in the ES cell lines was confirmed by karyotype
analysis (Nagy et al., 2003
).
Chimeras were generated by injection of ES cells into blastocysts derived from
X-linked GFP males bred with Swiss Webster female mice
(Bradley, 1987
). Yolk sacs of
chimeric embryos were collected for sex genotyping using the Sry
gene.
X-gal staining of embryos
X-gal staining for ß-gal activity was performed as described
(Nagy et al., 2003
). After
overnight post-fixation with 4% paraformaldehyde in PBS, photographs were
taken. For histological analysis, paraffin wax-embedded tissues were sectioned
at 7 µm and counterstained with 0.33% eosin-Y.
Whole-mount in situ hybridization
Whole-mount in situ hybridization was performed as described
(Shawlot and Behringer,
1995
)
| Results |
|---|
|
|
|---|
|
To determine which tissues specifically express Lim1 in the urogenital tract, we performed a histological analysis. We found that Lim1tlz is specifically expressed in the epithelium of the Müllerian and Wolffian ducts and the mesonephric tubules (Fig. 1D), but not in the surrounding mesenchyme of these tissues. At this stage (E12.5), the mesonephric tubules begin to regress. Histological analysis of serial sections along the longitudinal axis of the urogenital ridge revealed that no epithelial structure of the Müllerian duct was detected posteriorly to the distal tip of Lim1tlz expression in the Müllerian duct (data not shown). These data indicate that Lim1 expression is coincident with Müllerian duct formation and suggests a role in female reproductive organ formation.
Although Lim1 expression has been detected in the fetal gonads by
RT-PCR and in situ hybridization (Fig.
1G,H) (Nagamine and Carlisle,
1996
; Nagamine et al.,
1999
; Birk et al.,
2000
; Bouchard et al.,
2002
) (A.K. and R.R.B., unpublished), no ß-gal staining was
observed in the gonads of Lim1tlz heterozygous knock-in
embryos (Fig. 1A-F).
Sexual dimorphic expression of Lim1 in the developing reproductive tract
We further examined Lim1 expression at later stages of urogenital
development using the Lim1tlz reporter. Sexual dimorphic
patterns of Lim1tlz expression were observed in the
reproductive tract beginning at E14.5. In females, strong
Lim1tlz expression was observed in the Müllerian duct
at E14.5 (Fig. 2A) and this
strong expression persists until E15.5
(Fig. 2C,E).
Lim1tlz expression becomes weaker throughout the
Müllerian duct at E16.5 (Fig.
2G). By E17.5, Lim1tlz expression in the
Müllerian duct becomes restricted anteriorly, to the prospective oviduct.
Lim1tlz expression in the posterior presumptive uterus
region is downregulated and becomes undetectable
(Fig. 2I).
Lim1tlz expression in the Müllerian duct was not
observed at later stages (data not shown). In the Wolffian duct of females,
Lim1tlz expression is lost from the anterior gonadal
region around E15.25 and becomes undetectable at later stages
(Fig. 2E,G,I, data not
shown).
|
Visualization of Müllerian duct regression by Lim1tlz expression
MIS signaling is both essential and sufficient for Müllerian duct
regression. MIS ligand is expressed by Sertoli cells in the testis from E11.5
(Hacker et al., 1995
;
Swain and Lovell-Badge, 1999
)
and the MIS type II receptor, Misr2, is expressed in the mesenchyme
of the Müllerian duct from E13.0 in an anterior to posterior manner (A.K.
and R.B., unpublished) in the mouse. We observed sexual dimorphic expression
patterns of Lim1tlz expression in the Müllerian duct
from E14.5 (Fig. 2), 1 day
after Misr2 is expressed in the mesenchyme along the entire length of
the Müllerian duct. The timing of this differential expression pattern
suggests that the fragmentation of Lim1tlz expression
reflects MIS-induced Müllerian duct regression in males during
embryogenesis. Therefore, we examined Lim1tlz expression
in MIS signaling mutant male mice. Lim1tlz mice were bred
with mice with mutations in Mis, Misr2 or Wnt7a. We found
that the fragmentation of Lim1tlz expression (i.e. loss of
Müllerian duct epithelium) is completely inhibited and
Lim1tlz is expressed continuously along the persistent
Müllerian duct in Mis, Misr2 and Wnt7a mutant males
(Fig. 3A-D).
Lim1tlz expression in the Wolffian duct and kidney was not
affected in these mutant males. These data indicate that the fragmentation of
Lim1tlz expression in the Müllerian duct depends on
MIS signaling.
|
Absence of the female reproductive tract in female Lim1-null mice
The dynamic expression pattern of Lim1 in the developing
Müllerian duct indicates that Lim1 may have an important
function during female reproductive tract organogenesis. Unfortunately, most
Lim1 mutants die at around E10 probably because of a failure of
chorion-allantois fusion before the formation of the Müllerian duct that
is initiated around E11.5. Previously, we found that rare Lim1
mutants escaped this embryonic lethality and survived to the birth. These
Lim1-null escapers lacked anterior head and kidney formation.
However, only four escapers had been obtained out of more than 1000 (<0.4%)
pups born (Shawlot and Behringer,
1995
).
One explanation for Lim1-null mutant survival to birth is that the embryonic lethality is affected by genetic modifiers. Therefore, we modified the genetic background of the Lim1 mutation to increase phenotypic variety by outcrossing Lim1 heterozygous mice (maintained in C57BL/6Jx129/SvEv mixed background) with Swiss Webster (Taconic) outbred mice. Subsequently, we intercrossed the resulting Lim1 heterozygous offspring from different pedigrees to screen for Lim1-null escapers. We found one breeding pair that produced two Lim1-null escapers out of 76 (2.6%) pups. These escapers were genotyped and one escaper was an XX female and the other an XY male. We also intercrossed Lim1 heterozygous offspring from the mating pair that produced the two escapers and obtained two additional XX Lim1-null escaper neonates.
We analyzed the three XX Lim1-null neonates and one of the original four escapers that was also XX for female reproductive organ development. All of four Lim1-null female neonates had the identical phenotype. There was no anterior head formation (Fig. 4A,B). Examination of the internal reproductive organs of these female Lim1-null neonates showed that they had ovaries that were morphologically normal (Fig. 4D,F). The male Lim1-null escaper had testes that were indistinguishable from the testes of wild-type animals (data not shown). Although the female Lim1-null neonates had ovaries, they completely lacked derivatives of the Müllerian duct, including oviducts, uterus, cervix and the upper region of the vagina (Fig. 4C-H). Although Lim1 is expressed only within the epithelium of the Müllerian duct (Fig. 1D), both the epithelium and the mesenchyme of the female reproductive tract were completely absent in the female Lim1-null neonates (Fig. 4G-H). These data suggest that Lim1 is essential for Müllerian duct development during embryogenesis and that lack of Lim1 activity results in Müllerian agenesis in females.
|
|
1-2% frequency (A. Bradley, personal communication). Therefore, we
exploited this phenomenon and generated
Lim1/ and Lim1+/+
Rosa26-marked XO female ES cell lines. To establish XO ES cell lines,
we plated Lim1/ and
Lim1+/+ Rosa26-marked XY ES cells
(Shawlot et al., 1999
To generate female chimeras, Lim1/ and
Lim1+/+ XO ES cells were injected into wild-type XX
blastocysts (Fig. 5A). XX
blastocysts were distinguished from XY blastocysts using X-linked GFP
transgenic male mice (Hadjantonakis et
al., 1998
) for matings with wild-type females. In this strategy,
only chimeric embryos derived from XX blastocysts are GFP positive. Chimeric
embryos were harvested and stained with X-gal to distinguish ES cell-derived
cells from blastocyst-derived cells. The sex genotype of the recipient
blastocysts was further confirmed by PCR genotyping for Sry using the
yolk sac of the chimeras.
Cell-autonomous requirement of Lim1 for Müllerian duct epithelium formation
We generated 27 female chimeras and analyzed the distribution of ES-derived
cells (Fig. 6A,B). Identical
results were obtained for all five Lim1/ XO
ES cell lines and for all three Lim1+/+ XO ES cell lines
examined. High contribution of XO Lim1/
cells in chimeric animals caused craniofacial abnormalities. These included
loss of the lower jaw (data not shown) and, in more severe cases, head
truncation (Fig. 6B). However,
the Lim1-null urogenital defects were completely rescued in all
chimeric animals composed of Lim1-null and wild-type cells that were
recovered. Histological analysis was performed to understand the tissue
distribution of Lim1/ cells in chimeric
female mice. In control experiments, XO wild-type cells could contribute to
both the epithelium and mesenchyme of the uterus and oviduct in chimeric
females at E18.5 (Fig. 6C,E). We also examined other organs and did not observe any bias of distribution in
these chimeras. This indicates that XO cells can extensively contribute to the
somatic tissues of chimeric mice when XO cells are mixed with XX cells. By
contrast, when XO Lim1/ cells were used to
generate female chimeric mice, we found that these
Lim1/ cells did not contribute to the
epithelium of the uterus at E18.5, although these
Lim1/ cells could contribute extensively to
the uterus mesenchyme (Fig.
6D). We also found that Lim1/
cells were not present in the epithelium of the oviduct at the same stage
(Fig. 6F). These data suggest
that Lim1 function is required cell-autonomously for epithelium
development of the uterus and oviduct.
|
Lim1 expression in Müllerian duct precursor cells is independent of Wnt4 function
To understand interactions with other genes that are required for
Müllerian duct development, we examined Lim1tlz
expression in Pax2, Wnt4 and Wnt7a mutants
(Fig. 7). Wnt7a is
expressed in the Müllerian duct epithelium from E11.5
(Vainio et al., 1999
). In
Wnt7a mutant females, the Müllerian duct is formed but tissues
of the oviduct and uterus fail to form proper cytoarchitectures
(Miller and Sassoon, 1998
),
indicating a requirement of Wnt7a for Müllerian duct
differentiation. In Wnt7a mutants, Lim1tlz
expression in the urogenital system, including the Müllerian duct, was
identical to wild-type at E12.5 (Fig.
7A,D). In Pax2 mutants, the Wolffian duct is formed only
anteriorly at E11.5 but starts to degenerate at E12.5
(Torres et al., 1995
).
Pax2 mutants also lack mesonephric tubule formation and metanephros
induction. Pax2 is also expressed in the epithelium of the developing
Müllerian duct by E13.5 and Pax2 mutants form only the anterior
region of the Müllerian duct by E13.0 but it degenerates subsequently by
E16.5 (Torres et al., 1995
),
indicating a Pax2 requirement for maintenance of the Müllerian
duct. Lim1tlz expression in the Wolffian duct, mesonephros
and metanephros was not observed in Pax2 mutants at E12.5
(Fig. 7C). However, the
shortened Müllerian duct of Pax2 mutants still expressed
Lim1tlz at the same stage
(Fig. 7C). Taken together,
these data suggest that Lim1 expression in the Müllerian duct
does not require Wnt7a or Pax2 function.
|
| Discussion |
|---|
|
|
|---|
During male sexual development, the Müllerian ducts are eliminated by
the actions of the MIS signaling pathway
(Josso et al., 1993
).
Regression of the Müllerian duct system visualized by the
Lim1tlz reporter was first observed at E14.5 in male
fetuses as a thinning of the Müllerian duct in comparison with females.
This thinning correlates with the reduction in the diameter of the
Müllerian duct as the adjacent mesenchymal cells condense during the
regression process. Over the next 2 days of embryonic development, the
Müllerian duct system in the male fetus is eliminated. In males that lack
MIS, its type II receptor or Wnt7a, the Lim1tlz reporter
documented the persistence of the Müllerian duct in the absence of MIS
signaling. Thus, the Lim1tlz reporter provides the first
opportunity to visualize Müllerian duct regression or persistence from
the perspective of the ductal epithelium. In the mouse, MIS expression is
first detected around E11.5 at the time of testis determination
(Hacker et al., 1995
;
Swain and Lovell-Badge, 1999
).
MIS signaling requires the MIS type II receptor expressed in the mesenchyme
cells adjacent to the Müllerian duct epithelium
(Baarends et al., 1994
;
Mishina et al., 1996
). This
MIS type II receptor expression requires the function of Wnt7a, which is
expressed in the Müllerian duct epithelium
(Parr and McMahon, 1998
).
Using a Misr2-lacZ knock-in allele in mice, we have detected
ß-gal activity throughout the Müllerian duct mesenchyme by E13.5 (N.
A. Arango, A.K. and R.R.B., unpublished). Overexpression of human MIS in
female transgenic mice causes the elimination of Müllerian ducts and
therefore they do not have a uterus or oviducts
(Behringer et al., 1990
).
Interestingly, the female Mis transgenic fetuses had an altered
spatial pattern of Müllerian duct regression in comparison with normal
males. Whereas fragmentation of the Lim1tlz ß-gal
pattern (i.e. loss of the Müllerian duct epithelium) in males followed an
anterior to posterior pattern, in females, fragmentation was throughout the
anterior-posterior limits of the Müllerian ducts. These observations
indicate that at E15.5 the posterior Müllerian duct is competent for
regression, consistent with the establishment of Misr2 expression in
the adjacent mesenchyme along the entire Müllerian duct at this stage. We
also found that the regression of the Müllerian duct epithelium of male
Mis transgenic fetuses was enhanced, suggesting that MIS is not at
saturating levels for its signal transduction in vivo as shown previously
using reconstruction from serial sections
(Allard et al., 2000
).
Role of Lim1 in female reproductive tract development
Most Lim1 mutants die at mid-gestation because of defects in
allantois differentiation and the subsequent failure of chorioallantoic fusion
to establish the maternal-fetal connection
(Shawlot and Behringer, 1995
).
Lim1 is expressed in the primitive streak during gastrulation. Thus,
these defects in allantoic development are likely to be the consequence of
alterations in the posterior primitive streak directly or indirectly caused by
the lack of Lim1. The frequency of Lim1 mutants surviving to
birth appeared to be increased when the mutation was moved onto a more
diverse, outbred genetic background. The phenotypes of the Lim1-null
neonates were consistent between animals, suggesting that there are genetic
modifiers that specifically influence the expressivity of the mutation during
gastrulation to affect placentation.
Analysis of four Lim1-null female neonates showed a complete
absence of the derivatives of the Müllerian ducts, the oviducts and
uterus, establishing an essential role for Lim1 in the formation of
the female reproductive tract. The uterus and oviducts derive from the
Müllerian duct epithelium but also from the surrounding mesenchyme. Thus,
the complete absence of the uterus in the Lim1-null female neonates
demonstrates that the Müllerian duct epithelium has an essential role in
instructing the mesenchyme to participate in uterine organogenesis. In
addition, the one Lim1-null male neonate that was obtained did not
have Wolffian duct derivatives, identifying a role for Lim1 in male
reproductive tract development. Whereas the Müllerian and Wolffian duct
derivatives were absent in the Lim1-null neonates, there were gonads
that were morphologically and histologically normal. It was previously
reported that Lim1-null neonates lacked anterior head structures,
kidneys and gonads (Shawlot and Behringer,
1995
). However, it is now clear that Lim1-null mice can
form gonads and that Lim1 is dispensible for gonad formation. Several
groups have reported Lim1 expression in the developing gonad
(Nagamine and Carlisle, 1996
;
Nagamine et al., 1999
;
Birk et al., 2000
;
Bouchard et al., 2002
). Thus,
it is still possible that Lim1 has a role in gonad development but
such a role would be compensated by other factors in its absence.
Phenotypic analysis of the female Lim1-null neonates established a
requirement for Lim1 in female reproductive tract development but did
not provide information about when, how and in which tissues Lim1
acted. To address these questions a chimera study was performed
(Tam and Rossant, 2003
).
However, because there is an inherent bias towards male development when male
and female cells are mixed, we devised a novel female chimera assay,
exploiting the fact that genetically XO mice develop as females
(Morris, 1968
). Using this
assay, we showed that Lim1 activity is required cell autonomously in
the epithelium of the Müllerian duct for female reproductive tract
development. This was true at E18.5 and at E12.5 when the Müllerian duct
is just forming. Our data indicate that Lim1 function is required for
the formation or very early steps of the differentiation of the Müllerian
duct epithelium. However, because Müllerian duct formation initiates at
E11.5, we cannot formally conclude that Lim1 is essential for the
initial formation of the Müllerian duct epithelium. Because
Lim1-null cells to do not contribute to the Müllerian duct
epithelium of female chimeras, we could not assess the role of Lim1
at later stages of Müllerian duct differentiation where it might act to
maintain this tissue or regulate oviductal morphogenesis. Conditional genetic
strategies may be required to address this issue
(Kwan and Behringer,
2002
).
The role of Lim1 has previously been investigated using mouse
chimeras to understand its function in motoneuron axon trajectories in the
developing limb (Kania et al.,
2000
). These studies identified a cell-autonomous requirement for
Lim1 in selecting a dorsal trajectory in the limb. These results and
those presented in the current study that support a cell-autonomous action of
Lim1 stand in contrast to another chimera analysis of Lim1
during gastrulation and head formation
(Shawlot et al., 1999
). In
those studies, we showed that Lim1 expression in primitive
streak-derived tissues and the visceral endoderm acted in a cell
non-autonomous manner to regulate anterior head formation. However, recent
studies in frogs and mice suggest that the abnormalities in head formation may
be secondary to a cell autonomous defect in cell adhesion that alters mesoderm
migration (Hukriede et al.,
2003
). Thus, it is possible that Lim1 may regulate a
common set of downstream targets in different tissues.
Relationship of Lim1 with other genes that influence Müllerian duct development
We examined Lim1 expression in mutants with abnormalities of
Müllerian duct development to understand the relationship of
Lim1 with other genes in the genetic cascade of Müllerian duct
development (Kobayashi and Behringer,
2003
). Our chimera analysis indicated that Lim1 is
required for Müllerian duct formation. This is consistent with our
observations that Lim1 expression in the forming Müllerian duct
does not require Pax2 or Wnt7a, which are essential for
later events of maintenance or differentiation of the Müllerian duct
system, respectively (Torres et al.,
1995
; Miller and Sassoon,
1998
). Pax8 is also expressed in the Müllerian duct
epithelium (Vainio et al.,
1999
) but mice lacking Pax8 do not have defects in female
reproductive tract development (Mansouri
et al., 1998
). It is known that Pax2 and Pax8 are functionally
redundant (Carroll and Vize,
1999
; Bouchard et al.,
2002
). In Xenopus, Lim1 and Pax8 synergistically
induce pronephric tissues in kidney development
(Carroll and Vize, 1999
).
Although the anterior region of the Müllerian duct is initially formed in
Pax2 mutants, it is possible that Lim1 and Pax2/8 also cooperate to
regulate Müllerian duct formation in mice. Currently, it is not clear if
Lim1 expression in the Wolffian duct requires Pax2 function
(Fig. 7C) because the Wolffian
duct starts to regress at this stage
(Torres et al., 1995
).
Wnt4 is one of relatively few molecules that have been shown to be
required for the initial steps of Müllerian duct formation. It was
reported that there is no Müllerian duct in Wnt4 mutants by
molecular expression analysis of the Müllerian duct epithelium markers,
Wnt7a and Pax8 (Vainio
et al., 1999
). Interestingly, we showed that Lim1 is
expressed in Müllerian duct precursor cells of Wnt4 mutants and
that these precursor cells do not invaginate to form the Müllerian duct.
This suggests that Lim1 expression in Müllerian duct precursor
cells does not require Wnt4 function. It is possible that
Lim1 may be required for specifying these Müllerian duct
precursor cells acting genetically upstream of Wnt4.
It is noteworthy that Lim1, Pax2, Emx2 and Wnt4 are
involved in Müllerian duct formation and are also required for the
initial steps of kidney (metanephros) development
(Stark et al., 1994
; Shawlot
et al., 1995; Torres et al.,
1995
; Miyamoto et al.,
1997
; Tsang et al.,
2000
). This infers that similar mechanisms may be functioning in
Müllerian duct formation and kidney development.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Albrecht, K. H. and Eicher, E. M. (2001). Evidence that Sry is expressed in pre-Sertoli cells and Sertoli and granulosa cells have a common precursor. Dev. Biol. 240,92 -107.[CrossRef][Medline]
Allard, S., Adin, P., Gouedard, L., di Clemente, N., Josso, N., Orgebin-Crist, M. C., Picard, J. Y. and Xavier, F. (2000). Molecular mechanisms of hormone-mediated Müllerian duct regression: involvement of betacatenin. Development 127,3349 -3360.[Abstract]
Baarends, W. M., van Helmond, M. J., Post, M., van der Schoot, P. J., Hoogerbrugge, J. W., de Winter, J. P., Uilenbroek, J. T., Karels, B., Wilming, L. G., Meijers, J. H. et al. (1994). A novel member of the transmembrane serine/threonine kinase receptor family is specifically expressed in the gonads and in mesenchymal cells adjacent to the Müllerian duct. Development 120,189 -197.[Abstract]
Bach, I. (2000). The LIM domain: regulation by association. Mech. Dev. 91, 5-17.[CrossRef][Medline]
Barnes, J. D., Crosby, J. L., Jones, C. M., Wright, C. V. and Hogan, B. L. (1994). Embryonic expression of Lim-1, the mouse homolog of Xenopus Xlim-1, suggests a role in lateral mesoderm differentiation and neurogenesis. Dev. Biol. 161,168 -178.[CrossRef][Medline]
Behringer, R. R., Cate, R. L., Froelick, G. J., Palmiter, R. D. and Brinster, R. L. (1990). Abnormal sexual development in transgenic mice chronically expressing Müllerian inhibiting substance. Nature 345,167 -170.[CrossRef][Medline]
Behringer, R. R., Finegold, M. J. and Cate, R. L. (1994). Müllerian-inhibiting substance function during mammalian sexual development. Cell 79,415 -425.[CrossRef][Medline]
Belville, C., Josso, N. and Picard, J. Y. (1999). Persistence of Müllerian derivatives in males. Am. J. Med. Genet. 89,218 -223.[CrossRef][Medline]
Benson, G. V., Lim, H., Paria, B. C., Satokata, I., Dey, S. K. and Maas, R. L. (1996). Mechanisms of reduced fertility in Hoxa-10 mutant mice: uterine homeosis and loss of maternal Hoxa-10 expression. Development 122,2687 -2696.[Abstract]
Birk, O. S., Casiano, D. E., Wassif, C. A., Cogliati, T., Zhao, L., Zhao, Y., Grinberg, A., Huang, S., Kreidberg, J. A., Parker, K. L., Porter, F. D., and Westphal, H. (2000). The LIM homeobox gene Lhx9 is essential for mouse gonad formation. Nature 403,909 -913.[CrossRef][Medline]
Bishop, C. E. and Hatat, D. (1987). Molecular
cloning and sequence analysis of a mouse Y chromosome RNA transcript expressed
in the testis. Nucleic Acids Res.
15,2959
-2969.
Bouchard, M., Souabni, A., Mandler, M., Neubuser, A. and
Busslinger, M. (2002). Nephric lineage specification by Pax2
and Pax8. Genes Dev. 16,2958
-2970.
Bradley, A. (1987). Production and analysis of chimaeric mice. In Teratocarcinomas and Embryonic Stem Cells. A Practical Approach (ed. E. J. Roberston). pp113 -152. Oxford: IRL Press.
Bullejos, M. and Koopman, P. (2001). Spatially dynamic expression of Sry in mouse genital ridges. Dev. Dyn. 221,201 -205.[CrossRef][Medline]
Burgoyne, P. S. and Baker, T. G. (1981). Oocyte depletion in XO mice and their XX sibs from 12 to 200 days post partum. J. Reprod. Fertil. 61,207 -212.[Abstract]
Burgoyne, P. S., Tam, P. P. and Evans, E. P. (1983). Retarded development of XO conceptuses during early pregnancy in the mouse. J. Reprod. Fertil. 68,387 -393.[Abstract]
Burgoyne, P. S., Buehr, M., Koopman, P., Rossant, J. and
McLaren, A. (1988). Cell-autonomous action of the
testis-determining gene: Sertoli cells are exclusively XY in XX
XY
chimaeric mouse testes. Development
102,443
-450.[Abstract]
Capel, B. (2000). The battle of the sexes. Mech. Dev. 92,89 -103.[CrossRef][Medline]
Carroll, T. J. and Vize, P. D. (1999). Synergism between Pax-8and lim-1 in embryonic kidney development. Dev. Biol. 214,46 -59.[CrossRef][Medline]
Chi, N. and Epstein, J. A. (2002). Getting your Pax straight: Pax proteins in development and disease. Trends Genet. 18,41 -47.[CrossRef][Medline]
Dawid, I. B., Breen, J. J. and Toyama, R. (1998). LIM domains: multiple roles as adapters and functional modifiers in protein interactions. Trends Genet. 14,156 -162.[CrossRef][Medline]
Dyche, W.J. (1979). A comparative study of the differentiation and involution of the Mullerian duct and Wolffian duct in the male and female fetal mouse. J. Morphol. 162,175 -209.[CrossRef][Medline]
Fujii, T., Pichel, J. G., Taira, M., Toyama, R., Dawid, I. B. and Westphal, H. (1994). Expression patterns of the murine LIM class homeobox gene lim1 in the developing brain and excretory system. Dev. Dyn. 199,73 -83.[Medline]
Gidwani, G. and Falcone, T. (1999). Congenital Malformations of the Female Genital Tract. Diagnosis and Management. Philadelphia: Lippincott Williams and Wilkins.
Gubbay, J., Collignon, J., Koopman, P., Capel, B., Economou, A., Munsterberg, A., Vivian, N., Goodfellow, P. and Lovell-Badge, R. (1990). A gene mapping to the sex-determining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature 346,245 -250.[CrossRef][Medline]
Gruenwald, P. (1941) The relation of the growing Mullerian duct to the Wolffian duct and its importance for the genesis of malformations. Anat. Rec. 81, 1-19.[CrossRef]
Hacker, A., Capel, B., Goodfellow, P. and Lovell-Badge, R. (1995). Expression of Sry, the mouse sex determining gene. Development 121,1603 -1614.[Abstract]
Hadjantonakis, A. K., Gertsenstein, M., Ikawa, M., Okabe, M. and Nagy, A. (1998). Non-invasive sexing of preimplantation stage mammalian embryos. Nat. Genet. 19,220 -222.[CrossRef][Medline]
Hobert, O. and Westphal, H. (2000). Functions of LIM-homeobox genes. Trends Genet. 16, 75-83.[CrossRef][Medline]
Hukriede, N. A., Tsang, T. E., Habas, R., Khoo, P. L., Steiner, K., Weeks, D. L., Tam, P. P. and Dawid, I. B. (2003). Conserved Requirement of Lim1 Function for Cell Movements during Gastrulation. Dev. Cell 4,83 -94.[CrossRef][Medline]
Josso, N., Cate, R. L., Picard, J. Y., Vigier, B., di Clemente, N., Wilson, C., Imbeaud, S., Pepinsky, R. B., Guerrier, D., Boussin, L. et al. (1993). Anti-Müllerian hormone: the Jost factor. Recent Prog. Horm. Res. 48, 1-59.
Kania, A., Johnson, R. L. and Jessell, T. M. (2000). Coordinate roles for LIM homeobox genes in directing the dorsoventral trajectory of motor axons in the vertebrate limb. Cell 102,161 -173.[CrossRef][Medline]
Karavanov, A. A., Saint-Jeannet, J. P., Karavanova, I., Taira, M. and Dawid, I. B. (1996). The LIM homeodomain protein Lim-1 is widely expressed in neural, neural crest and mesoderm derivatives in vertebrate development. Int. J. Dev. Biol. 40,453 -461.[Medline]
Karavanov, A. A., Karavanova, I., Perantoni, A. and Dawid, I. B. (1998). Expression pattern of the rat Lim-1 homeobox gene suggests a dual role during kidney development. Int. J. Dev. Biol. 42,61 -66.[Medline]
Kaufman, M. H. and Bard, J. B. L. (1999). The Anatomical Basis of Mouse Development. San Diego, CA: Academic Press.
Kim, H. H. and Laufer, M. R. (1994). Developmental abnormalities of the female reproductive tract. Curr. Opin. Obstet. Gynecol. 6,518 -525.[Medline]
Kobayashi, A. and Behringer, R. R. (2003). Developmental genetics of the female reproductive tract in mammals. Nat. Rev. Genet. 4,969 -980.[CrossRef][Medline]
Koopman, P., Gubbay, J., Vivian, N., Goodfellow, P. and Lovell-Badge, R. (1991). Male development of chromosomally female mice transgenic for Sry. Nature 351,117 -121.[CrossRef][Medline]
Kwan, K. M. and Behringer, R. R. (2002). Conditional inactivation of Lim1 function. Genesis 32,118 -120.