|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 7 January 2004
doi: 10.1242/dev.00971
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Cellular Growth Mechanisms Section, Regulation of Cell Growth Laboratory,
NCI-Frederick, Frederick, MD 21702, USA
2 Developmental Signal Transduction Section, Regulation of Cell Growth
Laboratory, NCI-Frederick, Frederick, MD 21702, USA
3 Department of Anatomy and Cell Biology, The George Washington University
Medical Center, 2300 I Street, NW, Washington, DC 20037, USA
* Author for correspondence (e-mail: monicasmurakami{at}yahoo.com)
Accepted 21 October 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Wee1, Cell cycle, Gastrulation
| Introduction |
|---|
|
|
|---|
In Xenopus, the regulation of M-phase entry by the Cyclin B/Cdc2
complex appears to be a major control point in the generation of these
developmental transitions, as each transition is marked by an increase in the
level of inactive tyrosine-phosphorylated Cdc2
(Ferrell et al., 1991
). The
Wee1 tyrosine kinase and the Myt1 dual-specificity kinase mediate the
inhibitory phosphorylation of the Cdc2 subunit on Tyr 15 (Wee1) or Thr14/Tyr15
(Myt1). Dephosphorylation of these sites by the Cdc25 phosphatase family is
required for activation of the complex. The balance between the inhibitory
kinase activities and the activating phosphatase activities, in addition to
the synthesis and degradation of the Cyclin B subunit, regulates CyclinB/Cdc2
activity and, consequently, M-phase entry
(Dunphy, 1994
;
O'Farrell, 2001
).
The expression pattern of various cell cycle regulators provides some
insight into Cdc2 regulation during early Xenopus embryogenesis. In
particular, members of the Cdc25 phosphatase and Wee-like kinase families
display prominent changes in expression that coincide with the timing of the
developmental cell cycle transitions. For example, even though the level of
Cdc25C remains relatively constant throughout embryogenesis, maternal Cdc25A
is not translated until cell cycle 2 and is then degraded at the MBT
(Kim et al., 1999
;
Izumi and Maller, 1995
;
Hartley et al., 1996
). Of the
Wee-like kinases, Myt1 is expressed throughout embryogenesis
(Leise and Mueller, 2002
),
whereas the maternal Wee1 protein is translated at meiosis II and is degraded
at mid-late gastrulation (Murakami and
Vande Woude, 1998
). A zygotic isoform of Wee1 (Wee1B/Wee2) is then
expressed in late gastrula embryos at approximately the same time as the
maternal Wee1 protein is degraded (Leise
and Mueller, 2002
; Okamoto et
al., 2002
).
In addition to the developmentally regulated pattern of synthesis and
degradation, a further level of Wee1 regulation occurs through phosphorylation
events. Both the MAPK and Chk1 kinases have been shown to positively regulate
Wee1 (Walter et al., 2000
;
Lee et al., 2001
). The
identity of the MAPK phosphorylation site(s) are unknown; however, the
Chk1-mediated phosphorylation of Wee1 occurs on S549 and confers binding to
14-3-3 proteins (Lee et al.,
2001
). Wee1 activity is also positively regulated by tyrosine
autophosphorylation (Murakami et al.,
1999
). Tyrosine-phosphorylated Wee1 is observed in the first cell
cycle, but not in the rapid cell cycles that follow (cycles 2-12).
Consequently, in the first mitotic cell cycle, Cdc2 is maintained in an
inactive tyrosine-phosphorylated state because of the increased biological
activity of Wee1. Cdc2 is then dephosphorylated when Cdc25A is translated in
cell cycle 2, triggering the transition to the rapid cleavage cell cycles
(Murakami and Vande Woude,
1998
; Kim et al.,
1999
; Murakami et al.,
1999
; Walter et al.,
2000
).
Previous studies have established that maternal Wee1 is an important cell cycle regulator during the first mitotic cell cycle; however, the fact that the protein persists until mid-gastrulation suggests that Wee1 may have additional roles at later times in development. In this report, we use a combination of biochemical and in vivo developmental approaches to examine the function of maternal Wee1 in later Xenopus embryogenesis. By using antisense morpholino oligonucleotides to deplete maternal Wee1 protein levels, we find that Wee1 is a crucial regulator of M-phase entry and is an essential component of vertebrate morphogenesis.
| Materials and methods |
|---|
|
|
|---|
Antibodies
The Wee1 antibody is described elsewhere
(Murakami and Vande Woude,
1998
). Cdc25 antibodies were generous gifts from W. Dunphy, A.
Kumagai (CalTech, Cdc25C) and J. Maller (University of Colorado, Cdc25A).
Anti-Flag was purchased from Sigma, anti-phospho-Cdc2 from Cell Signaling
Technology, anti-Cdc2 and anti-His antibody from Santa Cruz Biotechnology, and
anti-phospho-histone H3 from Upstate.
Antisense morpholino, RNA preparation and embryo injection
Antisense morpholino oligonucleotides (MO; Gene Tools LLC) were generated
based on the Xenopus Wee1 genes isolated previously
[GCCGTCCTCATTGCCGACACCTGGG (Mueller et
al., 1995
) and GCCATTCTCATTGTCACCACCTTGG
(Murakami and Vande Woude,
1998
)]. A 3:1 mixture of Mueller and Murakami MOs gave optimal
Wee1 depletion and was used for all experiments. Control MO was obtained from
Gene Tools, LLC. The MOs were resuspended at a concentration of 6.25 ng/nl and
2x20 ng were injected into two-cell embryos. For MO+RNA rescue
experiments, 2 ng of in vitro transcribed RNA encoding the Wee1 isoform
isolated by Murakami was co-injected with the MO-Wee1 mixture. For the
Cdc25C+Wee1 rescue experiments, the indicated amounts of in vitro transcribed
Wee1 RNA were co-injected with 4 ng Cdc25C RNA. WT, KD and YYY-FFF Wee1 have
been previously described (Murakami et
al., 1999
); however, the versions used here contain the FLAG
epitope tag at the C terminus. The Stop-Wee1 and Shift-Wee1 constructs encode
either a stop codon or a frame shift mutation at amino acid positions 4 or 22,
respectively. The His-tagged Cdc25C construct was a gift from T. Stukenberg
(University of Virginia). In vitro transcribed RNA was prepared using the
mMessage Machine kit (Ambion). For morphological analysis, 5-6 ng (1 ng/nl) of
RNA was injected into the equatorial region of the dorsal blastomeres at the
four-cell stage. Some injections also included 100 pg ß-gal RNA. For
biochemical analysis, animal cap assays and PH3 staining, both cells of
two-cell embryos were injected with MO and/or RNA. For fate mapping analysis,
both cells of two-cell embryos containing a clearly discernable dorsal/ventral
pattern were injected with MO. At the 32-cell stage, 1 ng of ß-gal RNA
was injected into the B1 blastomeres. When the embryos reached stage 11-12,
they were stained for ß-gal activity using Red-Gal® substrate
(Research Organics) and were bleached for clear visualization of stained cells
(Sive et al., 2000
).
Animal cap assay
Embryos were injected with MO at the two-cell stage and animal caps were
isolated at stage 8.5-9. The caps were placed in 0.5xMBS (±50
ng/ml activin) and fixed in formaldehyde or MEMPA buffer at stage 22-23.
Analysis of zygotic transcription
Animal cap explants or whole embryos were harvested at stage 10.5. RNA was
isolated using Trizol Reagent (Invitrogen) and cDNAs were synthesized with
Superscript (Invitrogen). PCR reactions were performed using primers and
conditions described at
www.xenbase.org.
In situ hybridization and immunohistochemistry
In situ-hybridization for Xenopus brachyury, chordin and sox2
expression was performed as previously described
(Sive et al., 2000
) using
embryos fixed in MEMPA buffer (0.1 M MOPS (pH 7.4), 2 mM EGTA, 1 mM
MgSO4, 3.7% paraformaldehyde). ß-Galactosidase activity was
visualized using the Red-Gal® substrate
(Sive et al., 2000
).
Anti-phospho-histone H3 staining was performed as described elsewhere
(Christen and Slack, 1999
)
using embryos fixed in Dent's fixative (80% methanol, 20% DMSO) and 1:500
dilution of the anti-phospho-histone H3 antibody.
| Results |
|---|
|
|
|---|
|
Wee1 regulates mitotic entry in intact embryos
Tyrosine phosphorylation inhibits the activity of the CyclinB/Cdc2 complex
and thereby prevents entry into mitosis. Because Wee1 depletion reduces the
level of Cdc2 tyrosine phosphorylation, Wee1-depleted embryos might be
expected to contain an increased number of mitotic cells. To determine if this
is the case, mitotic nuclei were visualized by immunostaining with an antibody
recognizing a mitosis-specific antigen, phospho-histone H3. All nuclei were
then visualized with DAPI and a mitotic index was determined. As depicted in
Fig. 1D, a marked increase in
the number of mitotic nuclei was detected in embryos injected with MO-Wee1,
but not in MO-control embryos. This increase could be reversed by co-injection
of exogenous WT-Wee1 RNA, suggesting that Wee1 regulates entry into mitosis in
intact embryos.
Wee1 is required for Xenopus gastrulation
Strikingly, in the course of these studies, we found that Wee1 depletion
severely altered the external morphology of gastrulating embryos. Gastrulation
is the complex process whereby a hollow ball of cells (blastula) is
transformed into a multi-layered embryo (gastrula). Involution begins on the
dorsal side of the embryo at the blastopore lip. As gastrulation proceeds, the
area of involuting cells spreads laterally and ventrally, resulting in the
appearance of a circular `yolk plug' in the vegetal region of the embryo.
Because previous work had established that inhibiting cell division has little
effect on Xenopus gastrulation
(Cooke, 1973b
;
Cooke, 1973a
;
Gurdon and Fairman, 1986
;
Symes and Smith, 1987
;
Grainger and Gurdon, 1989
), it
seemed plausible that enhanced cell division would have no effect, or would
simply advance the onset of gastrulation. Instead, we found that gastrulation
was profoundly disrupted when M-phase entry was promoted by Wee1 depletion. At
stages 10.5 and 11, when control embryos had a clearly defined blastoporal
pigment line and blastoporal groove, MO-Wee1-injected embryos had minimal or
no blastopore (Fig. 2). The
gastrulation defects induced by Wee1-depletion could be reversed by
coinjection of exogenous WT-Wee1 RNA (Fig.
2), indicating that these defects were due to the lack of Wee1
protein.
|
|
Wee1-depletion disrupts morphogenetic movements in the intact embryo
Convergent-extension is one of several different types of tissue movement
involved in gastrulation. To further assess the effect of Wee1-depletion on
cell movement and morphogenesis in vivo, we took advantage of the fate-mapping
studies performed by Bauer et al. (Bauer et
al., 1994
). For these experiments, we followed the fate of the B1
dorsal blastomere [for nomenclature see elsewhere
(Dale and Slack, 1987
;
Bauer et al., 1994
)] because
the progeny of this cell undergo extensive movement during gastrulation.
Embryos were injected with MO-Wee1, MO-Wee1 + WT RNA or MO-Control at the
two-cell stage. ß-Galactosidase RNA was then injected into both B1
blastomeres at the 32-cell stage, and the migration pattern of the B1 progeny
was determined at stage 11.5-12 by visualization of the ß-gal-positive
cells. At stage 11.5, the B1 clone normally forms a narrow column on the
dorsal side of the embryo, extending from the edge of the blastopore into the
animal hemisphere. As shown in Fig.
3C, this localization pattern was observed in uninjected and
control MO-injected embryos. In marked contrast, B1-derived cells were spread
broadly across the dorsal equator in Wee1-depleted embryos
(Fig. 3C), consistent with the
pre-gastrula fate map prior to any cell movements. These cell migration
defects were significantly reverted by co-injection of exogenous WT-Wee1 RNA
(Fig. 3C).
Next, we assessed the internal morphology of the embryos by bisecting the
area of ß-gal staining. In control embryos, involution was clearly
observed and was greater on the dorsal side. The ß-gal positive cells
from the B1 clone were dorsally located, extending from the blastopore lip
into the animal hemisphere (Fig.
3D). By contrast, no involution was observed in Wee1-depleted
embryos (Fig. 3D), consistent
with the external morphology (Fig.
2). We also found that epiboly was somewhat impaired. Epiboly is a
process that involves the radial intercalation of cells in the blastocoel roof
and results in the vegetal migration of cells from the equator
(Gerhart and Keller, 1986
;
Keller and Winklbauer, 1992
).
As shown in Fig. 3D, the
ß-gal positive cells in Wee1-depleted embryos did not migrate vegetally,
as was observed in the control embryos. However, some interior yolky vegetal
cells on the dorsal side of the embryo did migrate upward along the inner
surface of the blastocoel roof (arrowheads,
Fig. 3D). Taken together, these
findings show that Wee1 depletion severely impairs several of the major
morphogenetic movements involved in gastrulation.
Wee1-depletion does not prevent zygotic gene expression in vivo
To further verify that the morphological defects were due to impaired
tissue movement and not to inhibition of zygotic gene expression, we examined
the expression of brachyury, chordin and goosecoid in whole embryos collected
at stage 10.5. By RT-PCR analysis, all three zygotic genes were transcribed in
the MO-Wee1-injected embryos, consistent with the results observed in the
animal cap assays (Fig. 3B).
When the expression pattern of brachyury and chordin was examined by in situ
hybridization, we found that although both genes were expressed, their
expression domain was more diffuse in Wee1-depleted embryos, consistent with a
reduction in morphogenetic movements that would normally compress the mesoderm
to the rim of the blastopore lip (Fig.
3E). Sox2 expression in the presumptive neural plate was similarly
affected (data not shown). Thus, although the transcription of these zygotic
genes is induced at the appropriate time, the spatial pattern of expression is
somewhat altered.
Wee1 tyrosine phosphorylation in post MBT and gastrula embryos
The above findings indicate that Wee1 suppresses entry into mitosis by
inhibiting Cdc2 and that this function is crucial for the elaborate tissue
movements involved in vertebrate gastrulation. The depletion experiments,
however, do not define the time at which Wee1 function is required. Therefore,
to gain insight into the timing and mechanism of Wee1 function, we examined
the level and phosphorylation state of Wee1 and several other cell cycle
components during Xenopus embryogenesis
(Fig. 4). Consistent with
previous reports (Kim et al.,
1999
), Cdc25A was detected in rapidly dividing embryos (stage 7
and 8) but was not observed in post-MBT embryos. Cdc25C levels remained
constant from meiosis I (oocyte) through gastrulation (stage 11.5), as did the
total levels of Cdc2. However, inactive tyrosine-phosphorylated Cdc2 was
significantly greater in stage VI oocytes, in the first mitotic cell cycle
(egg 30') and post-MBT embryos (stages 9,10 and 11.5). As previously
reported (Murakami and Vande Woude,
1998
), the Wee1 protein was present from meiosis II (egg) until
early-gastrulation (stage 10). Tyrosine-phosphorylated Wee1 was detected in
the first mitotic cell cycle and strikingly, was also observed after the MBT
and during early gastrulation (stage 9 and 10), coincident with the appearance
of increased levels of tyrosine-phosphorylated Cdc2.
|
|
The KD- and YYY/FFF-Wee1 mutants act as dominant inhibitors of Wee1 function in early gastrula embryos
For various protein kinases, inactive mutants or those that cannot be
activated have been found to function in a dominant inhibitory manner,
presumably interfering with the ability of their endogenous counterparts to
interact with upstream activators and/or downstream substrates. Therefore, we
next examined whether KD- or YYY/FFF-Wee1 would act as dominant inhibitors.
For these experiments, two additional Wee1 constructs were generated, one that
encodes a stop codon at amino acid 4 (Stop-Wee1) and one that contains a
frame-shift mutation resulting in truncation of the protein at amino acid 22
(Shift-Wee1). RNAs encoding the Wee1 constructs were injected into the two
dorsal blastomeres of a four-cell embryo, and embryos were subsequently
examined at stage 11.5-12. As depicted in
Fig. 6, ectopic expression of
either KD- or YYY/FFF-Wee1 produced gastrulation defects
(Fig. 6A,B). However, in
contrast to the MO-Wee1-injected embryos
(Fig. 2), only part of the
blastopore was disrupted. By co-injecting ß-gal RNA to delineate the
region of the embryos expressing the exogenous RNA-encoded proteins, we found
that the incomplete disruption of the blastopore was due to limited diffusion
of the injected RNAs (Fig. 6A).
Injection of control RNAs, Stop-Wee1, Shift-Wee1 or ß-gal alone had no
effect on gastrulation (Fig.
6A), indicating that the defects observed were not simply due to
RNA injection. Thus, both KD- and YYY/FFF-Wee1 act in a dominant inhibitory
manner to suppress normal gastrulation, further supporting the model that
intrinsic kinase activity and tyrosine phosphorylation are required for Wee1
function in the early gastrula embryos.
|
|
| Discussion |
|---|
|
|
|---|
Wee1 is required for normal gastrulation
In Xenopus, gastrulation is a complex morphogenetic process
whereby a simple blastula is transformed into an embryo with three germ layers
and a distinct dorsoventral body plan
(Gerhart and Keller, 1986
;
Keller and Winklbauer, 1992
).
Early studies examining the role of cell division in Xenopus
gastrulation indicated that cell proliferation was not required for
gastrulation. Specifically, these studies showed that inhibiting cell division
with pharmacological inhibitors had no effect on gastrulation as determined by
the morphology of the embryo, the transcription of a late mesodermal marker
(cardiac actin), and the loss of `competence' to respond to mesoderm-inducing
factors (Cooke, 1973b
;
Cooke, 1973a
;
Gurdon and Fairman, 1986
;
Symes and Smith, 1987
;
Grainger and Gurdon, 1989
). In
addition, a more recent study has shown that MO depletion of Cyclin E slows
cell division and delays embryogenesis, but results in embryos that are
morphologically normal (Audic et al.,
2001
). However, careful spatial analysis of cell division in
Xenopus embryos has revealed that involuted dorsal mesodermal cells
do not divide during gastrulation (Saka
and Smith, 2001
), suggesting that inhibition of cell proliferation
might in fact be required for normal gastrulation. If this were the case, then
enhanced cell proliferation should be detrimental to the gastrulation process.
Our findings directly support this model. Here, we show that Wee1-depletion,
which promotes M-phase entry and cell cycle progression, severely disrupts
gastrulation. The role of cell cycle regulation was further substantiated by
our findings that inappropriately promoting cell division by overexpressing
the Cdc25C phosphatase also disrupted gastrulation and that the Cdc25C-induced
defects could be counteracted by increased expression of the Wee1 kinase.
Thus, cell cycle progression appears to be incompatible with the processes
involved in normal gastrulation.
Wee1 does not contribute to the onset of zygotic transcription
Interestingly, we found that Wee1 is not needed for the induction of
zygotic transcription. Between the MBT and gastrulation, the cell cycle is
gradually transformed from a minimal 30-minute cycle to a 4 hour cell cycle
(Howe et al., 1995
). The
functional relationship between cell cycle length and the induction of zygotic
transcription is derived from experiments where the artificial expansion of
the cell cycle prior to the MBT resulted in premature zygotic transcription
(Kimelman et al., 1987
). Based
upon these studies, the acceleration of the cell cycle during/after the MBT
might be expected to block or inhibit zygotic transcription. In this report,
we find that even though Wee1-depletion does promote M-phase entry, it is not
sufficient to prevent the onset of zygotic transcription. Although this
finding is somewhat unexpected, it is likely that the expansion of the cell
cycle after the MBT is a complex process that involves the programmed
degradation of Cyclin E1, Chk1-mediated degradation of Cdc25A, as well as the
positive regulation of Wee1 (Howe and
Newport, 1996
; Kim et al.,
1999
; Shimuta et al.,
2002
) (this report). In addition, the programmed degradation of
Cyclin A1, and possibly some post-translational regulation of Cdc25C, may also
contribute to the further expansion of the cell cycle during gastrulation
(Howe et al., 1995
;
Rempel et al., 1995
;
Hartley et al., 1996
). Thus,
several events may work together as a molecular rheostat to slow the cell
cycle from 30 minutes to 4 hours. As a result, blocking only one of these
events may not be sufficient to interfere with the onset of zygotic
transcription.
Embryonic cell cycle regulation and gastrulation in frogs and flies
Modulation of the cell cycle appears to play an important role in both
Xenopus and Drosophila embryogenesis. Prior to gastrulation,
both organisms undergo a burst of rapid cell divisions followed by a gradual
expansion of the cell cycle (Newport and
Kirschner, 1982
; Edgar et al.,
1986
). Zygotic cell cycle components are synthesized after the MBT
and previous studies have indicated that zygotic proteins do play a role in
regulating Cdc2 activity during gastrulation
(Edgar and O'Farrell, 1989
).
In Drosophila, cell cycle inhibition is observed at the ventral
furrow (Foe, 1989
), a region
somewhat analogous to the Xenopus blastopore, and this inhibition is
achieved by the removal of a zygotic activator of Cdc2. Specifically, the
spatially restricted expression of the Tribbles protein results in the
degradation of the String/Cdc25C phosphatase in cells surrounding the ventral
furrow (Großhans and Wieschaus,
2000
; Mata et al.,
2000
; Seher and Leptin,
2000
). In Xenopus, the zone of non-mitotic cells in the
mid-late gastrula is identical to area of zygotic Wee1B/Wee2 RNA expression
(Saka and Smith, 2001
;
Leise and Mueller, 2002
),
suggesting that zygotic expression of a Cdc2 inhibitor, Wee1B/Wee2, might play
an analogous role in frog embryogenesis. Interestingly, the expansion of the
cell cycle after the MBT (and during gastrulation) is regulated by zygotic
components in Drosophila, but is regulated by maternally derived
components in Xenopus (Newport
and Dasso, 1989
; Edgar and
Datar, 1996
). In Xenopus, the maternally regulated
program of cell cycle expansion has been implicated in the onset of zygotic
transcription, cytoplasmic blebbing and pseudopod formation (at the MBT)
(Newport and Kirschner, 1982
),
but has not been previously implicated in the coordinated tissue morphogenesis
that takes place during gastrulation. We demonstrate that the maternal Wee1
protein contributes to the cell cycle downregulation that occurs during
Xenopus gastrulation. Our findings also indicate that the maternally
directed program of cell cycle control, rather than simply facilitating the
transcription of zygotic components, plays a direct role in morphogenesis.
The requirement of cell cycle regulation for the coordinated cell movements
of gastrulation is another shared feature of Drosophila and
Xenopus embryogenesis. In flies, the Tribbles-mediated degradation of
Cdc25C permits the invagination of mesodermal cells at the ventral furrow, one
of the earliest events of gastrulation
(Großhans and Wieschaus,
2000
; Mata et al.,
2000
; Seher and Leptin,
2000
). Similarly, in this study, we found that cell cycle
inhibition mediated by Wee1 is important for epiboly, involution and
convergent-extension, all of which are major morphogenetic processes that
contribute to normal Xenopus gastrulation. Thus, although flies and
frogs may use different molecular components to regulate the embryonic cell
cycle, it appears that in both organisms the inhibition of cell division is
essential for the complex morphogenetic movements required for
gastrulation.
Wee1 regulation
In this study, we find that Wee1 is upregulated by tyrosine
autophosphorylation following the MBT and at gastrulation. This upregulation
appears to be required for Wee1 function in early gastrula embryos given that
neither kinase-inactive Wee1 or a Wee1 protein containing mutations in the
tyrosine phosphorylation sites were able to rescue the defects produced by
MO-Wee1-depletion. These findings are consistent with previous observations
that upregulation of Wee1 activity by tyrosine autophosphorylation is critical
for Wee1 function in the first mitotic cell cycle
(Murakami et al., 1999
). Taken
together, these studies indicate that the maternal Wee1 protein functions at
distinct developmental points to coordinate cell cycle progression with events
that control the organization of the embryonic body plan. Moreover, we believe
this work contributes to a growing body of evidence that cell cycle regulation
is likely to be crucial for a wide variety of morphogenetic processes. Wee1 is
a primary cell cycle target of the budding morphogenesis checkpoint in S.
cerevisiae (Sia et al.,
1998
; Lew, 2000
),
and in mammalian cells, there is evidence that inhibition of cell
proliferation is necessary for cell migration
(Nagahara et al., 1998
).
Collectively, these studies suggest that `morphogenesis' checkpoints, which
coordinate cell shape changes and movement with cell proliferation, will be
crucial for normal development and organogenesis, and may also play an
important role in the balance between deregulated cell proliferation and
metastasis.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Audic, Y., Boyle, B., Slevin, M. and Hartley, R. S. (2001). Cyclin E morpholino delays embryogenesis in Xenopus.Genesis 30,107 -109.[CrossRef][Medline]
Ayad, N. G., Rankin, S., Murakami, M., Jebanathirajah, J., Gygi, S. and Kirschner, M. W. (2003). Tome-1, a trigger of mitotic entry, is degraded during G1 via the APC. Cell 113,101 -113.[CrossRef][Medline]
Bauer, D. V., Huang, S. and Moody, S. A. (1994). The cleavage stage origin of Spemann's organizer: analysis of the movements of blastomere clones before and during gastrulation in Xenopus. Development 120,1179 -1189.[Abstract]
Christen, B. and Slack, J. M. W. (1999). Spatial response to fibroblast growth factor signaling in Xenopus embryos. Development 126,119 -125.[Abstract]
Cooke, J. (1973a). Morphogenesis and regulation in spite of continued mitotic inhibition in Xenopus embryos. Nature 242,55 -57.[CrossRef][Medline]
Cooke, J. (1973b). Properties of the primary organization field in the embryo of Xenopus laevis. IV. Pattern formation and regulation following early inhibition of mitosis. J. Embryol. Exp. Morphol. 30,49 -62.[Medline]
Dale, L. and Slack, J. M. W. (1987). Fate map
for the 32-cell stage of Xenopus laevis.
Development 99,527
-551.
Dunphy, W. G. (1994). The decision to enter mitosis. Trends Cell Biol. 4, 202-207.[CrossRef][Medline]
Edgar, B. A. and Datar, S. A. (1996). Zygotic
degradation of two maternal Cdc25 mRNAs terminates Drosophila's early
cell cycle program. Genes Dev.
10,1966
-1977.
Edgar, B. A., Kiehle, C. P. and Schubiger, G. (1986). Cell cycle control by the nucleo-cytoplasmic ratio in early Drosophila development. Cell 44,365 -372.[CrossRef][Medline]
Edgar, B. A. and O'Farrell, P. H. (1989). Genetic control of cell division patterns in the Drosophila embryo. Cell 57,177 -187.[CrossRef][Medline]
Ferrell, J. E., Jr, Wu, M., Gerhart, J. C. and Martin, G. S.
(1991). Cell cycle tyrosine phosphorylation of p34 Cdc2 and a
microtubule-associated protein kinase homologue in Xenopus oocytes
and eggs. Mol. Cell. Biol.
11,1965
-1971.
Foe, V. E. (1989). Mitotic domains reveal early commitment of cells in Drosophila embryos. Development 107,1 -22.[Abstract]
Gerhart, J. C. and Keller, R. (1986). Region-specific cell activities in amphibian gastrulation. Ann. Rev. Cell Biol. 2,201 -229.[CrossRef]
Grainger, R. M. and Gurdon, J. B. (1989). Loss
of competence in amphibian induction can take place in single non-dividing
cells. Proc. Natl. Acad. Sci. USA
86,1900
-1904.
Großhans, J. and Wieschaus, E. (2000). A genetic link between morphogenesis and cell division during formation of the ventral furrow in Drosophila. Cell 101,523 -531.[CrossRef][Medline]
Gurdon, J. B. and Fairman, S. (1986). Muscle gene activation by induction and the non-requirement for cell division. J. Embryol. Exp. Morphol. Suppl.75 -84.
Hartley, R. S., Rempel, R. E. and Maller, J. L. (1996). In vivo regulation of the early embryonic cell cycle in Xenopus. Dev. Biol. 173,408 -419.[CrossRef][Medline]
Heasman, J. (2002). Morpholino oligos: making sense of antisense? Dev. Biol. 243,209 -214.[CrossRef][Medline]
Howe, J. A. and Newport, J. W. (1996). A
developmental timer regulates degradation of Cyclin E1 at the mid-blastula
transition during Xenopus embryogenesis. Proc. Natl. Acad.
Sci. USA 93,2060
-2064.
Howe, J. A., Howell, M., Hunt, T. and Newport, J. W.
(1995). Identification of a developmental timer regulating the
stability of embryonic Cyclin A and a new somatic A-type Cyclin at
gastrulation. Genes Dev.
9,1164
-1176.
Izumi, T. and Maller, J. L. (1995). Phosphorylation and activation of the Xenopus Cdc25 phosphatase in the absence of Cdc2 and Cdk2 kinase activity. Mol. Biol. Cell 6,215 -226.[Abstract]
Keller, R. and Danilchik, M. (1988). Regional expression, pattern and timing of convergence and extension during gastrulation of Xenopus laevis. Development 103,193 -209.[Abstract]
Keller, R. and Winklbauer, R. (1992). Cellular basis of amphibian gastrulation. Curr. Top. Dev. Biol. 27, 39-89.[Medline]
Kim, S. H., Li, C. and Maller, J. L. (1999). A maternal form of the phosphatase Cdc25A regulates early embryonic cell cycles in Xenopus laevis. Dev. Biol. 212,381 -391.[CrossRef][Medline]
Kimelman, D., Kirschner, M. W. and Scherson, T. (1987). The events of the Mid-blastula transition in Xenopus are regulated by changes in the cell cycle. Cell 48,399 -407.[CrossRef][Medline]
Kirschner, M. W., Butner, K. A., Newport, J. W., Black, S. D., Scharf, S. R. and Gerhart, J. C. (1981). Spatial and temporal changes in early amphibian development. Netherlands J. Zool. 31,50 -77.
Lee, J., Kumagai, A. and Dunphy, W. G. (2001).
Positive regulation of Wee1 by Chk1 and 14-3-3 proteins. Mol. Biol.
Cell 12,551
-563.
Leise, W. F. and Mueller, P. R. (2002). Multiple Cdk1 inhibitory kinases regulate the cell cycle during development. Dev. Biol. 249,156 -173.[CrossRef][Medline]
Lew, D. J. (2000). Cell-cycle checkpoints that ensure coordination between nuclear and cytoplasmic events in Saccharomyces cerevisiae. Curr. Opin. Genet. Dev. 10, 47-53.[CrossRef][Medline]
Maller, J. L., Gross, S. D., Schwab, M. S., Finkielstein, C. V., Taieb, F. E. and Qian, Y. W. (2001). Cell cycle transitions in early Xenopus development. Novartis Found. Symp. 237,58 -73.[Medline]
Mata, J., Curado, S., Ephrussi, A. and Rørth, P. (2000). Tribbles coordinates mitosis and morphogenesis in Drosophila by regulating String/Cdc25 proteolysis. Cell 101,511 -522.[CrossRef][Medline]
Michael, W. M. and Newport, J. (1998). Coupling
of mitosis to the completion of S phase through Cdc34-mediated degradation of
Wee1. Science 282,1886
-1889.
Mueller, P. R., Coleman, T. R. and Dunphy, W. G. (1995). Cell cycle regulation of a Xenopus Wee1-like kinase. Mol. Biol. Cell 6, 119-134.[Abstract]
Murakami, M. S. and Vande Woude, G. F. (1998). Analysis of the early embryonic cell cycles of Xenopus; regulation of cell cycle length by Xe-wee1 and Mos. Development 125,237 -248.[Abstract]
Murakami, M. S., Copeland, T. D. and Vande Woude, G. F.
(1999). Mos positively regulates Xe-Wee1 to lengthen the first
mitotic cell cycle of Xenopus. Genes Dev.
13,620
-631.
Nagahara, H., Vocero-Akbani, A. M., Snyder, E. L., Ho, A., Latham, D. G., Lissy, N. A., Becker-Hapak, M., Ezhevsky, S. A. and Dowdy, S. F. (1998). Transduction of full-length TAT fusion proteins into mammalian cells: TAT-p27Kip1 induces cell migration. Nat. Med. 4,1449 -1452.[CrossRef][Medline]
Newport, J. and Dasso, M. (1989). On the coupling between DNA replication and mitosis. J. Cell Sci. Suppl., 149-160.
Newport, J. W. and Kirschner, M. W. (1982). A major developmental transition in early Xenopus embryos: I. Characterization and timing of cellular changes at the mid-blastula stage. Cell 30,675 -686.[CrossRef][Medline]
Nieuwkoop, P. D. and Faber, J. (1994).Normal Table of Xenopus Laevis . New York: Garland.
O'Farrell, P. H. (2001). Triggering the all-or-nothing switch into mitosis. Trends Cell Biol. 11,512 -519.[CrossRef][Medline]
Okamoto, K., Nakajo, N. and Sagata, N. (2002). The existence of two distinct Wee1 isoforms in Xenopus; implications for the developmental regulation of the cell cycle. EMBO J. 21,2472 -2484.[CrossRef][Medline]
Rempel, R. E., Sleight, S. B. and Maller, J. L.
(1995). Maternal Xenopus Cdk2-cyclin E complexes
function during meiotic and early embryonic cell cycles that lack a G1 phase.
J. Biol. Chem. 270,6843
-6855.
Saka, Y. and Smith, J. C. (2001). Spatial and Temporal patterns of cell division during early Xenopus embryogenesis. Dev. Biol. 229,307 -318.[CrossRef][Medline]
Seher, T. C. and Leptin, M. (2000). Tribbles, a cell-cycle brake that coordinates proliferation and morphogenesis during Drosophila gastrulation. Curr. Biol. 10,623 -629.[CrossRef][Medline]
Shimuta, K., Nakajo, N., Uto, K., Hayano, Y., Okazaki, K. and Sagata, N. (2002). Chk1 is activated transiently and targets Cdc25A for degradation at the Xenopus mid-blastula transition. EMBO J. 21,3694 -3703.[CrossRef][Medline]
Sia, R. A. L., Bardes, E. S. G. and Lew, D. J. (1998). Control of Swe1p degradation by the morphogenesis checkpoint. EMBO J. 17,6678 -6688.[CrossRef][Medline]
Sive, H. L., Grainger, R. M. and Harland, R. M. (2000). Early Development of Xenopus Laevis: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Smith, J. C. (1987). A mesoderm-inducing factor
is produced by a Xenopus cell line.
Development 99,3
-14.
Symes, K. and Smith, J. C. (1987). Gastrulation movements provide an early marker of mesoderm induction in Xenopus laevis. Development 101,339 -349.[Abstract]
Vincent, J. P., Oster, G. F. and Gerhart, J. C. (1986). Kinematics of gray crescent formation in Xenopus eggs: the displacement of subcortical cytoplasm relative to the egg surface. Dev. Biol. 113,484 -500.[CrossRef][Medline]
Walter, S. A., Guadagno, S. N. and Ferrell, J. E., Jr
(2000). Activation of Wee1 by p42 MAPK in vitro and in cycling
Xenopus egg extracts. Mol. Biol. Cell
11,887
-896.
This article has been cited by other articles:
![]() |
Z. Jin, E. Homola, S. Tiong, and S. D. Campbell Drosophila Myt1 Is the Major Cdk1 Inhibitory Kinase for Wing Imaginal Disc Development Genetics, December 1, 2008; 180(4): 2123 - 2133. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Budirahardja and P. Gonczy PLK-1 asymmetry contributes to asynchronous cell division of C. elegans embryos Development, April 1, 2008; 135(7): 1303 - 1313. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Arai, K. Miyake, R. Voit, S. Nemoto, E. K. Wakeland, I. Grummt, and T. Miyazaki Death-effector domain-containing protein DEDD is an inhibitor of mitotic Cdk1/cyclin B1 PNAS, February 13, 2007; 104(7): 2289 - 2294. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Heasman Patterning the early Xenopus embryo. Development, April 1, 2006; 133(7): 1205 - 1217. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Y. Kim, E. J. Song, K.-J. Lee, and J. E. Ferrell Jr. Multisite M-Phase Phosphorylation of Xenopus Wee1A Mol. Cell. Biol., December 1, 2005; 25(23): 10580 - 10590. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Jin, E. M. Homola, P. Goldbach, Y. Choi, J. A. Brill, and S. D. Campbell Drosophila Myt1 is a Cdk1 inhibitory kinase that regulates multiple aspects of cell cycle behavior during gametogenesis Development, September 15, 2005; 132(18): 4075 - 4085. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Ewald, S. M. Peyrot, J. M. Tyszka, S. E. Fraser, and J. B. Wallingford Regional requirements for Dishevelled signaling during Xenopus gastrulation: separable effects on blastopore closure, mesendoderm internalization and archenteron formation Development, December 15, 2004; 131(24): 6195 - 6209. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Martin and S. M. Parkhurst Parallels between tissue repair and embryo morphogenesis Development, July 1, 2004; 131(13): 3021 - 3034. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||