|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 7 January 2004
doi: 10.1242/dev.00947
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1 Department of Cell and Developmental Biology, Cornell University Medical
College, 1300 York Avenue, New York, NY 10021, USA
2 Department of Cell Biology and Anatomy, Medical University of South Carolina,
Charleston, SC 29425, USA
3 Department of Pediatrics, Children's Hospital of Pittsburgh, Pittsburgh, PA
15213, USA
Author for correspondence (e-mail:
tmikaw{at}med.cornell.edu)
Accepted 27 October 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Cardiac conduction system, Optical mapping, Hemodynamics, Mechanosensor, Conotruncal banding, Gadolinium, Connexin 40, Chick embryo
| Introduction |
|---|
|
|
|---|
The impulse conduction pathway of the heart is established during
embryogenesis through a complex and dynamic process. Electrode and optical
mapping studies of embryonic chick hearts have demonstrated that when the
primitive heart tube forms, all epithelioid myocytes are electrically active,
but pacemaking impulses are evoked predominantly by myocytes in the posterior
inflow tract (Kamino et al.,
1981
; Kamino,
1991
; de Jong et al.,
1992
). These impulses spread to the anterior end of the heart,
towards the outflow tract, via gap junctions between the epithelioid myocytes
without any local changes in velocity. Therefore, except for the pacemaker
cells, no other subcomponents of the conduction system are detected at this
stage. Soon after the heart tube loops, a change of the impulse propagation
pattern along the myocardium becomes detectable. Impulse velocity becomes
significantly slowed at the atrioventricular junction and is much faster
through the ventricle (Lieberman and Paes
de Carvalho, 1967
; de Jong et
al., 1992
), suggesting that both slow and fast conduction
components have begun to differentiate
(Moorman et al., 1998
). This
unidirectional activation sequence across the ventricle from the AV junction
towards the outflow tract remains during heart looping. As the
atrioventricular bundle, bundle branches and Purkinje fibers fully develop and
are linked as an entire ventricular conduction network, the activation
sequence of the ventricle undergoes a dramatic topological shift from an
immature, unidirectional pattern to the mature, apex-to-base pattern
(Chuck et al., 1997
;
Reckova et al., 2003
).
Although little is known about how these distinct conducting elements are
induced, patterned and integrated into an entire conduction system network,
significant progress has been made in the last few years in our understanding
of cellular and molecular mechanisms that regulate the differentiation of
Purkinje fibers (reviewed by Mikawa and
Fischman, 1996
; Mikawa,
1999a
; Mikawa,
1999b
; Gourdie et al.,
1999
; Pennisi et al.,
2002
). In the chicken, the Purkinje fiber network develops
subendocardially and penetrates intramyocardially along branching coronary
arteries (Pattern and Kramer, 1933;
Vassal-Adams, 1982
;
Gourdie et al., 1995
;
Cheng et al., 1999
;
Takebayashi-Suzuki et al.,
2000
). Purkinje fibers can be identified by their unique gene and
protein expression patterns (reviewed by
Schiaffino, 1997
;
Moorman et al., 1998
;
Welikson and Mikawa, 2001
).
Our retroviral cell lineage studies have further shown that cells of
individual conducting elements locally differentiate from working myocytes,
not by outgrowth from a prespecified common progenitor
(Gourdie et al., 1995
;
Cheng et al., 1999
).
Importantly Purkinje fiber recruitment takes place exclusively along the
developing endocardium and coronary arterial branches, but not veins or
capillaries. Thus, Purkinje fiber differentiation in the embryonic heart is
tightly regulated both temporally and spatially
(Mikawa, 1999a
;
Mikawa, 1999b
;
Gourdie et al., 1999
;
Pennisi et al., 2002
). This
phenotype conversion is induced by vessel-derived paracrine signals
(Hyer et al., 1999
), including
the stretch/pressure-induced factor, endothelin (ET)
(Gourdie et al., 1998
;
Takebayashi-Suzuki et al.,
2000
; Takebayashi-Suzuki et
al., 2001
). These findings raised the question of how the sites
and timing of Purkinje fiber differentiation are precisely defined in
developing hearts using ET as an inductive signal.
Active ET (Yanagisawa et al.,
1988
) is secreted after proteolytic processing from its precursor
by ET-converting enzyme 1 (ECE1) (Xu et
al., 1994
) and signals by binding to its receptors
(Arai et al., 1990
;
Sakurai et al., 1990
). In the
embryonic chick heart, two ET receptors, ETA and ETB
(Nataf et al., 1996
;
Nataf et al., 1998
;
Lecoin et al., 1998
), are
ubiquitously expressed by cardiomyocytes
(Kanzawa et al., 2002
). By
contrast, ECE1 is expressed in a subset of endocardial endothelia and all
arterial endothelial cells, but not by veins or capillaries
(Takebayashi-Suzuki et al.,
2000
). Thus, the expression of endogenous ECE1 is restricted to
the sites where adjacent myocytes are induced to differentiate into Purkinje
fibers. Furthermore, co-expression of exogenous ECE1 with ET precursor
(preproET), but not ET precursor expression alone, in the embryonic heart is
sufficient to ectopically convert myocytes to Purkinje fibers
(Takebayashi-Suzuki et al.,
2000
). Therefore, spatial restriction of ECE1 expression is key
for patterning the differentiation of the cardiac Purkinje fiber network. It
is unknown, however, how the expression of endogenous ECE1 is regulated in the
embryonic heart.
Many studies have shown that hemodynamic forces, such as shear stress
and/or stretch, can regulate the expression of preproET and production of
mature ET in cultured endothelial cells
(Yoshizumi et al., 1989
;
Malek and Izumo, 1992
;
Wang et al., 1993
;
Macarthur et al., 1994
;
Zhu et al., 1997
;
Morawietz et al., 2000
;
Garcia-Cardena et al., 2001
).
It has recently been shown that blood pressure changes in chick embryonic
hearts can influence conduction system development
(Reckova et al., 2003
).
Furthermore, the expression of ECE1 in the embryonic ventricle is restricted
to endocardial and arterial endothelial cells
(Takebayashi-Suzuki et al.,
2000
), areas that are exposed to higher shear-stress/stretch than
veins and capillaries. Taken together, we hypothesized that ECE1 expression
and its ultimate induction of Purkinje fibers are regulated by biomechanical
forces such as shear-stress/stretch. Biomechanical force-dependent response is
mediated by several mechanosensors (reviewed by
Traub and Berk, 1998
),
including intracellular Ca2+ ions
(Dull and Davies, 1991
), a
barium-inhibited inward-rectifying shear-sensitive K+ channel
IKS (Olensen et al.,
1988
; Jacobs et al.,
1995
), a gadolinium-inhibited stretch-activated cation channel
ISA (Lansman et al.,
1987
; Yang and Sachs,
1989
; Naruse et al.,
1998
; Suchyna et al.,
2000
), tyrosine phosphorylation
(Takahashi and Berk, 1996
) and
integrin-mediated signaling (Chen et al.,
2001
). However, it is still controversial whether biomechanical
forces can regulate ECE1 expression in cultured endothelial cells
(Harrison et al., 1998
;
Masatsugu et al., 1998
;
Morawietz et al., 2000
).
Furthermore, the role of hemodynamics and biomechanical forces in regulating
the timing and location of ECE1 expression in cardiac endothelial cells has
not been studied in the embryonic heart in vivo.
In the present study, we show that ECE1 expression in the endocardium and Cx40 (also known as Cx42 or alpha 5) expression in the presumptive Purkinje fibers of the embryonic chick heart are both diminished by gadolinium, an antagonist of ISA-channels, and are enhanced by increasing pressure load with conotruncal banding. Associated with this, a shift of activation sequences from the immature, unidirectional pattern to the mature, apex-to-base pattern is delayed in gadolinium-treated hearts and precociously induced in pressure-overloaded hearts. These results provide for the first time in vivo evidence for the inductive role of hemodynamic(s) on the expression of ECE1 in the embryonic chick heart. Associated changes in Cx40 expression and activation sequence development further suggest that biophysical forces that are generated by the cardiovascular system itself play a crucial role in Purkinje fiber differentiation and patterning.
| Materials and methods |
|---|
|
|
|---|
In situ hybridization
Expression patterns of ECE1 and Cx40 in the embryonic hearts were examined
by in situ hybridization analysis as described previously
(Takebayashi-Suzuki et al.,
2000
; Takebayashi-Suzuki et
al., 2001
; Kanzawa et al.,
2002
) with slight modifications as follows. In short,
formaldehyde-methanol fixed embryonic hearts were treated with10 µg/ml
proteinase K for 10-30 minutes at room temperature, depending on stage or age.
After terminating proteinase K reaction with glycine (0.1 g/50 ml PBT) and
post-fixation with 4% formaldehyde and 0.1% glutaraldehyde, samples were
rinsed twice with PBS, pre-incubated with the hybridization mixture for 1 hour
at 65°C, and reacted overnight at 65-70°C with DIG-labeled RNA probes
(3.5 µg/ml of ECE1 and 1 µg/ml of Cx40). After 65°C washes and
blocking steps, the samples were incubated overnight at 4°C with alkaline
phosphatase-conjugated anti-DIG antibody (1:2000 dilution, Roche). After
washing, samples were stained with the NBT/BCIP mixture at room temperature
for color development. Hearts stained in whole-mount were further processed
for paraffin sectioning as described previously
(Takebayashi-Suzuki et al.,
2000
).
Optical mapping
Activation sequences of the embryonic heart ventricle were analyzed by
optical mapping techniques as described previously
(Kamino, 1991
;
Litchenberg et al., 2000
;
Rentschler et al., 2001
;
Reckova et al., 2003
). The
basic setup of the detection system is illustrated in
Fig. 1A. In brief, hearts were
stained with a voltage-sensitive dye [di-4-ANEPPS (Molecular Probes), 0.1
µg/ml] for 5 minutes at room temperature and superfused at 37°C with
Tyrode's solution (pH 7.4) saturated in a small oxygen chamber mounted on a
Leica DML-FS fluorescent microscope. The spread of excitation across the
myocardium was monitored by changes in fluorescence signals of di-4-ANEPPS,
using a fast (up to 1300 frames per second at 12 bit resolution) CCD camera
(Olympus Neurocam) with an 80x80 pixel array. Excitation light
(520±40 nm) was provided by a 100 W mercury vapor light source and a
green filter. Cytochalasin D (75 µM) was used to minimize motion artifact
(Biermann et al., 1998
;
Jalife et al., 1998
;
Reckova et al., 2003
). Data
were acquired using Ultra-View software (Perkin-Elmer Lifesciences, version
3.0), and analyzed with the Universal Mapping program written by Dr Martin
Biermann in the IDL5.4 (RSI, Boulder CO) programming language. Isochronal maps
of the activation sequences were generated by marking activation times at the
dv/dtmax of the action potential upstrokes in a 40x40 matrix
and plotting those times. Isochronal maps and Quick-Time movies were used to
determine the activation sequence of each heart.
|
Conotruncal banding (CTB)
Eggs were incubated as described above for 3.5 days until around HH stage
21. After making a hole of 5-10 mm diameter in the shell, the inner shell
membrane was removed from above the embryo. CTB was performed according to
Clark et al. (Clark et al.,
1989
), using 10-0 nylon suture
(Sedmera et al., 1999
;
Tobita et al., 2002
). The
suture was tied around the conotruncus, but with no constriction of blood flow
at the time of operation. Sham-operated embryos underwent the same procedure
but had the suture removed immediately. The eggs were sealed with Parafilm and
reincubated for additional 3 days until HH stages 27-29.
RT-PCR analysis
Total RNA from the ventricles was extracted as described previously
(Takebayashi-Suzuki et al.,
2001
; Kanzawa et al.,
2002
), using TRIzol reagent (Invitrogen), and treated with
RNase-free DNaseI (Roche). RNA (200 ng) was converted into cDNAs using AMV
Reverse Transcriptase (Roche), Random Hexamers (Roche) and amplified by the
Polymerase Chain Reaction (PCR). Primers and PCR conditions were follows:
GAPDH, 5'CAGCCTTCACTACCCTCTTG3' (forward) and
5'ACGCCATCACTATCTTCCAG3' (reverse); ECE1,
5'ACCGCATCTCACCCTTCTTC3' (forward) and
5'AGGATAGAAGACCGTGGAGA3' (reverse); Cx40,
5'GTCCGCCCCACAGGTAGAAA3' (forward) and
5'GTCCCACGGGCTGAGAACTT3' (reverse); and VEGF,
5'CAGGCCATCCTGTGTGCCTCT3' (forward) and
5'TTCCGCTGCTCACCGTCTCGG3' (reverse). GAPDH cDNA was amplified by
29 cycles with a 55°C annealing temperature, while VEGF cDNA was by 37
cycles with a 60°C annealing temperature. ECE1 and Cx40 cDNAs were
amplified together in a duplex reaction for 37 cycles with a 50°C
annealing temperature. PCR products (12 µl) were electrophoresed on a 1%
agarose gel and visualized using ethidium bromide. The band intensities were
digitally captured by Fluor-S MultiImager and analyzed using Multi-Analyst
software (BioRad). The level of GAPDH cDNA was used to normalize the intensity
of signal. Intensity data were then subjected to statistical analyses using
Microsoft Excel software (Microsoft).
Data documentation
All images of hearts and sections were captured by either a Digital Photo
Camera (DKC-5000, Sony) or a Spot RT Slider (Diagnostic Instruments) using
Adobe Photoshop (Adobe Systems) or Spot software. Images were adjusted for
color levels, brightness and contrast using Adobe Photoshop software.
| Results |
|---|
|
|
|---|
Using a standard optical mapping setup (Fig. 1A), the propagation pathway of action potentials across the ventricular wall was analyzed at various stages of development. Embryonic hearts were stained with a voltage sensitive dye di-4-ANEPPS (Fig. 1B,C) as a read-out for changes in the membrane potential. The intensity of fluorescent signals across the ventricular surface was recorded. Action potentials were detected as a rapid decrease of di-4-ANEPPS fluorescent signal (Fig. 1D). The optical records from individual pixels were then inverted and the first derivative of changes in the fluorescence intensity was calculated. The time of activation at individual pixels was determined as the peak of the first derivative, or the maximum upstroke velocity (Fig. 1E). The activation data from all pixels covering the entire ventricular surface (Fig. 1F) were used for generating isochronal maps (Fig. 2A-C) to evaluate the impulse propagation pattern.
|
Although optical mapping analysis of activation sequences across the
ventricular surface was powerful enough to determine the
developmental/functional status of the entire conduction system, it did not
provide the resolution to specifically identify the developing Purkinje fiber
network. Therefore, the localization of differentiating Purkinje fibers in
embryonic ventricles during conduction pathway development was determined by
examining the expression of a specific Purkinje fiber maker, Cx40, a gap
junctional protein thought to be essential for fast conduction of action
potentials (Gourdie et al.,
1993
; Takebayashi-Suzuki et
al., 2000
; Tamaddon et al.,
2000
). Coinciding with the initiation of fast conduction in the
developing ventricle (Fig. 2A),
Cx40 signals were detectable in the ventricle at heart looping stages
(Fig. 2E). Importantly, a
higher level of hybridization signal was seen in the outer curvature of the
ventricle, where action potentials propagated faster than in other regions at
this developmental stage (Fig.
2A,E).
By E5-7, Cx40 expression expanded in the ventricle, exhibiting a fine network of hybridization signals along the developing trabeculae (Fig. 2F). However, no specific path of Cx40 staining signals linking the base and apex of the ventricle was observed (Fig. 2F), consistent with the immature lateral activation pattern across the ventricle at this developmental stage (Fig. 2B). During and after the topological shift of activation sequence from the immature pattern to the mature apex-to-base (Fig. 2C), Cx40 expression became more robust and exhibited arrays along the longitudinal axis of the ventricle (Fig. 2G). This staining pattern is typical of the subendocardial Purkinje fiber network through which the pacemaking action potentials propagate toward the ventricular apex and are transmitted to myocytes in the mature hearts. Histological sections of these stained hearts revealed that subendocardial Purkinje fiber differentiation was restricted to these rides of trabeculae closest to the ventricular lumen (i.e. the tips of sectioned trabeculae, Fig. 2H,I) but not those embedded in the compact myocardium.
The endocardial expression of ECE1, a key molecular component for defining
an induction site of ET-dependent Purkinje fiber differentiation
(Takebayashi-Suzuki et al.,
2000
), was detectable in the outer curvature of the presumptive
ventricle (Fig. 2J) where
action potentials propagated faster (Fig.
2A) and higher levels of Cx40 expression were detected
(Fig. 2E). The outer curvature
of the presumptive ventricle has also been thought to be exposed to a higher
shear stress and/or stretch than the inner curvature
(Thompson et al., 1995
;
Hogers et al., 1995
;
Moorman et al., 1998
). Thus,
the observed ECE1 expression pattern at heart looping stages is consistent
with the idea of a hemodynamic and/or biomechanical force-dependent regulation
of ECE1 expression.
By E5-7, the endocardial expression of ECE1 was detected along developing
trabeculae (Fig. 2K), as seen
in the Cx40 expression pattern (Fig.
2F). Higher levels of hybridization signals were detected in
developing valve leaflets, as previously reported
(Takebayashi-Suzuki et al.,
2000
). Strong signals were also seen at the crest of the
interventricular septum, a prospective site of bundle branch differentiation
(Moorman et al., 1998
;
Cheng et al., 1999
). However,
again there was no continuous staining for ECE1 from the base to the apex of
the ventricle at this stage, which agrees with the optical mapping data that
showed the immature lateral activation sequence at this developmental stage.
As the activation sequence shifted from the immature pattern to the mature
apex-to-base pattern (Fig. 2C),
the endocardial ECE1 expression became more distinct along the longitudinal
axis of the ventricle (Fig.
2L), resembling the Cx40 expression pattern.
In histological sections of these stained hearts, higher levels of ECE1 signals were detected in endocardial cells covering the crests of trabecular ridges (Fig. 2M,N) in close proximity to sites of the differentiation of Cx40-expressing Purkinje fibers were identified (Fig. 2G-I). By contrast, the hybridization signals were significantly weaker in endocardial cells invaginating deeply into the myocardium. The spatially regulated progression of the ECE1 expression pattern is consistent with its function in defining the sites of Purkinje fiber differentiation in the embryonic heart (Takebasyashi-Suzuki et al., 2000). The data are also consistent with the idea that ECE1 expression in the embryonic heart may be regulated by blood flow-induced shear-stress and/or a pressure-dependent stretch.
Downregulation of ECE1 and delayed conduction patterning by gadolinium
If these biomechanical forces serve as a regulatory component of the
endocardial expression of ECE1 in the embryonic heart, the suppression of
mechanosensors, such as a gadolinium-inhibited stretch-activated cation
channel ISA (Lansman et al.,
1987
; Yang and Sachs,
1989
; Naruse et al.,
1998
), should result in the downregulation of endocardial ECE1
expression. In addition, changes in the expression of this essential enzyme
for active ET production should lead to an alteration of ET-dependent
induction of Purkinje fiber differentiation. To test these possibilities in
ovo, gadolinium ions were introduced directly into the circulating blood flow
at various stages during Purkinje fiber development
(Fig. 3A,B). The levels of ECE1
and Cx40 transcripts in the ventricle of the resulting hearts were then
examined using RT-PCR analysis (Fig.
3C-F).
|
Quantification of the RT-PCR data revealed that gadolinium ions downregulated ECE1 expression in a dose-dependent manner (Fig. 3D). The gadolinium-induced downregulation of ECE1 expression was detectable within 2 hours of injection and the decreased expression levels were sustained for several hours (Fig. 3E). Importantly, however, ventricular ECE1 expression in gadolinium-injected hearts returned to the same level as control hearts 24 hours after injection, indicating that the inhibitory effect of gadolinium on ECE1 expression was reversible. The response of Cx40 expression to gadolinium ions followed the same time course and same levels of downregulation as that of ECE1 (Fig. 3E).
We have previously shown that the Purkinje fiber marker Cx40 is the
earliest known responsive gene in ET-induced conversion from myocytes into
Purkinje fibers, both in vivo
(Takebayashi-Suzuki et al.,
2000
; Takebayashi-Suzuki et
al., 2001
; Kanzawa et al.,
2002
) and in vitro (Gourdie et
al., 1998
). Therefore, the expression levels of Cx40 were compared
with those of ECE1, the enzyme essential for production of active ET-peptides,
in individual hearts (Fig. 3F).
Consistent with the known dependency of Cx40 on ET signals in the heart, a
two-dimensional plot of the expression levels of Cx40 and ECE1 in eight
control hearts and eight gadolinium-injected hearts revealed that the
expression level of Cx40 in the ventricle was positively correlated with those
of the ECE1, both in control and gadolinium injected groups.
The above RT-PCR analysis clearly demonstrated a gadolinium-induced downregulation of both ECE1 and Cx40 expression in the ventricles. However, the data did not provide any spatial information about the specific sites, if any, affected by gadolinium within the ventricle. To address this issue, in situ hybridization analysis was used to visualize the expression patterns of ECE1 and Cx40 in the heart (Fig. 4). In control hearts, ECE1 signals were readily detected in endocardial cells overlaying trabeculae (Fig. 4A-C) that differentiated into Cx40-positive Purkinje fibers (Fig. 4D-F) at the inner most ventricular myocardium. Although gadolinium-injected hearts showed no detectable alteration in heart morphogenesis, such as the chamber size and interventricular septum development (Fig. 4G-L), they displayed lower hybridization signals of ECE1 in the endocardium (Fig. 4G-I) consistent with RT-PCR data. These data demonstrate that endocardial cells are a target site of the gadolinium-induced inhibition of ECE1 expression in the ventricle. Concomitant with a decrease in ECE1 expression in the endocardium, Cx40 signals were diminished in the underlying trabeculae, particularly at the apical regions (Fig. 4J-L). The data suggest that gadolinium injection also induced a significant disruption and/or delay of Purkinje fiber differentiation and patterning.
|
|
|
Whole-mount in situ hybridization analysis was then performed to examine
whether the CTB-induced increase in expression levels detected by RT-PCR
reflected changes in endocardial ECE1 expression and subendocardial Purkinje
fiber differentiation (Fig. 7).
In control hearts, weak ECE1 signals were detected in endocardial cells
overlaying trabeculae (Fig.
7A-C) that differentiated into Cx40-positive putative
subendocardial Purkinje fibers (Fig.
7D-F). By contrast, CTB hearts displayed higher hybridization
signals of endocardial ECE1 (Fig.
7G-I). Although not quantified, a significant expansion of
ECE1-positive endocardial cells within the ventricle was apparent visually.
The data demonstrate that endocardial cells are a target site of the
CTB-induced upregulation of ECE1 expression in the ventricle. Associated with
the upregulated expression of endocardial ECE1, significantly higher levels of
Cx40 signals were readily detected in developing subendocardial Purkinje
fibers (Fig. 7J-L).
Furthermore, it was evident that many Cx40-positive Purkinje fibers ran more
along the longitudinal axis than the horizontal axis of the ventricle of
CTB-hearts (Fig. 7J). This
pattern was not seen in control hearts
(Fig. 7D) at this developmental
stage. These data show that pressure overload by CTB induced more endocardial
cells to express ECE1 at higher levels, as well as a higher density and more
anisotropic patterning of putative subendocardial Purkinje fiber
differentiation. The experimentally induced changes in Cx40 expression also
suggested that a precocious patterning of the Purkinje fiber network may be
involved in the recently reported precocious induction of a mature ventricular
activation sequence in CTB hearts (Reckova
et al., 2003
).
|
|
| Discussion |
|---|
|
|
|---|
Although our in vivo studies have demonstrated that endocardial ECE1
expression in the embryonic heart can be upregulated by pressure overload, it
has been shown in culture that laminar flow-induced shear stress induces
vascular endothelial cells to slightly downregulate ECE1 expression, as well
as the expression of preproET and production of mature ET
(Harrison et al., 1998
;
Masatsugu et al., 1998
;
Morawietz et al., 2000
). The
reason for this contradictory response of endothelial cells seen between in
vivo and in vitro experiments is currently uncertain. One possibility is that
cardiac endothelial cells have a distinct responsiveness to hemodynamic loads
from other vascular endothelial cells. Alternatively, there might be a
mechanism by which endothelial cells distinguish different types of
hemodynamic loads. Indeed, it has been shown that preproET expression and
production in cultured endothelial cells can be regulated differently by shear
stress and stretch (Yoshizumi et al.,
1989
; Malek and Izumo,
1992
; Wang et al.,
1993
; Macarthur et al.,
1994
; Zhu et al.,
1997
; Morawietz et al.,
2000
; Garcia-Cardena et al.,
2001
; Chen et al.,
2001
). In fact, ET secretion by endothelial cells is increased by
a combination of oscillatory shear stress and increased blood pressure
(Ziegler et al., 1998
;
Markos et al., 2002
), which
are similar to hemodynamic loads induced by CTB in the present study. The data
are consistent with the normal expression pattern of ECE1 that occurs in
endothelial cells of higher tension endocardium and coronary arteries but not
in lower tension veins and capillaries
(Takebayashi-Suzuki et al.,
2000
).
Our RT-PCR data have shown that levels of ventricular ECE1 expression are
downregulated by gadolinium and upregulated by CTB. In situ hybridization
analysis of these hearts has detected endocardial endothelial cells as the
main cell type responsible for the induced changes of ECE1 expression levels
in the ventricle. However, it is unlikely that only endocardial cells are
affected by the ISA channel antagonist or pressure overload.
Indeed, the same antagonist has been shown to block ISA channels of
chick heart muscle (Hu and Sachs,
1996
). Furthermore, mechanical stimuli have long been known to
alter both the physiological characteristics
(Bainbridge, 1915
;
Rajala et al., 1976
;
Rajala et al., 1977
;
Lab, 1980
;
Ruknudin et al., 1993
) and
gene expression patterns (reviewed by
Brutsaert, 2003
) of the heart
muscle in both whole hearts and isolated tissue. In addition, shear stress
responsive elements (SSRE) have been identified within promoter regions of the
ECE1 gene (Orzechowski et al.,
1997
). Nevertheless, no significant alteration of ECE1 expression
was detected in myocytes in hearts that are exposed to the ISA
channel inhibitor or CTB-induced pressure overload. Although the reason for
this cell type-specific response is currently unknown, the data obtained in
this study provide the first in vivo evidence for a higher responsiveness of
ECE1 expression to biomechanical inputs in endocardial endothelial cells than
myocytes of the embryonic heart.
Our data have shown that Cx40, a Purkinje fiber marker gene, is expressed
in trabecular myocytes that are adjacent to the ECE1 positive endocardial
endothelial cells. The data have also demonstrated that the gadolinium- and
CTB-induced changes in expression levels and patterns of Cx40 occur
concurrently with those of ECE1. The data suggest a tight link between the
trabecular Cx40 expression with the endocardial ECE1 expression. However,
expression of other components in the ET signaling cascade, such as preproET
and ET receptors, may also change in these hearts and may contribute to
hemodynamic-dependent patterning of Purkinje fibers. Furthermore, our survey
of the database has identified several putative SSRE promoter elements in the
Cx40 genes (data accession numbers: rat Cx40, AF025767.1; mouse Cx40,
AF023131.1; and human Cx40, AF246295). Therefore, there is the possibility
that Cx40 expression is directly regulated by biomechanical forces,
independently from ECE1 expression in adjacent endocardial cells. Although
this possibility cannot be ruled out, this potential mechanism does not
explain the absence of any detectable biomechanical force-dependent response
of Cx40 expression in other myocardial regions where myocytes continue a
contraction-relaxation cycle. Indeed, the expression of Cx40 by intramural
Purkinje fibers adjacent coronary arteries
(Gourdie et al., 1993
;
Gourdie et al., 1995
), but not
in adjacent working myocytes presents a similar problem, as these cells are
likely to be subject to similar levels of wall stress. At the time of their
differentiation, periarterial Purkinje fibers are nonetheless juxtaposed to
coronary vascular tissues expressing high levels of ECE1
(Takebayashi-Suzuki et al.,
2000
). In addition, we have previously demonstrated that viral
co-expression of ECE1 with the preproET in the embryonic myocardium gives rise
to an ectopic conversion of myocytes into Purkinje fibers (Takebayashi-Suzukie
et al., 2000). Furthermore, Cx40 is an earliest known responsive gene in this
ET-induced Purkinje fiber differentiation
(Gourdie et al., 1998
;
Takebayashi-Suzuki et al.,
2000
; Takebayashi-Suzuki et
al., 2001
; Kanzawa et al.,
2002
). Taken together, it is equally possible that the gadolinium-
and CTB-induced changes of Cx40 expression result from an altered production
of inductive ET-signals by endocardial ECE1.
To date, ET is the only paracrine signal that has been experimentally
demonstrated to induce myocytes to differentiate into Purkinje fibers in the
embryonic chick heart (reviewed by Pennisi
et al., 2002
). In the embryonic mouse heart, however, a potential
involvement of other paracrine interactions, such as neuregulin and its
receptors, Erbb2 and Erbb4, between endocardial cells and myocytes has also
been suggested (Moorman et al.,
1998
; Rentschler et al.,
2002
). Neuregulin is secreted by the endocardium, while Erbb2 and
Erbb4 are expressed in the myocardium. Conduction disturbances in mice mutant
for these genes have been suggested to be a result of insufficient contractile
capacity (Moorman et al.,
1998
). Like ET, neuregulin can induce murine myocytes to
upregulate some conduction cell markers, including atrial natriuretic factor
and skeletal muscle protein (Zhao et al.,
1998
). However, is not known whether Purkinje fiber specific-gene
programs observed in the avian embryo, such as the upregulation of Cx40 and
downregulation of MyBP-C
(Takebayashi-Suzuki et al.,
2000
; Takebayashi-Suzuki et
al., 2001
), are regulated by this signal in the mouse. It is also
unknown whether neuregulin expression is regulated in a biomechanical
input-dependent manner. Interestingly, neuregulin expression is a known
downstream component of ET-signaling (Zhao
et al., 1998
). The interactions between these signaling cascades
and the molecular mechanisms underlying induction, differentiation and
maturation of Purkinje fibers remain to be determined.
Induced changes in the expression patterns of Cx40 in gadolinium-injected
and CTB operated hearts demonstrate that there is significant plasticity in
patterning of the Purkinje fiber network. The diminished and enhanced
differentiation of the Purkinje fiber network suggested a delay and
acceleration of conversion of the ventricular activation sequence from an
immature lateral pattern to a mature apex-to-base pattern, respectively. Our
optical mapping data are consistent with this idea. However, an alteration of
Purkinje fiber differentiation, the most distal component of the ventricular
fast conduction system, may not be a sole cause for these changes in
ventricular activation sequences seen in these hearts. Indeed, it has recently
been reported that development of the bundle branches, the proximal component
of the conduction system, is delayed by LAL-induced blood overload and is
accelerated by CTB-induced pressure overload
(Reckova et al., 2003
).
Together with the present study, it is likely that changes in hemodynamic
loads can influence development of both proximal and distal components of the
ventricular fast conduction system.
The importance of hemodynamic forces in cardiovascular development has long been known. The present study specifically demonstrates that endocardial expression of ECE1, the enzyme essential for producing active ET-peptides, can be modulated by stretch-activated channel antagonist and CTB-induced pressure overload. The experimentally induced changes in Cx40 expression and ventricular activation sequences also suggest that biomechanical forces acting on, and created by, the cardiovascular system during embyogenesis, are a crucial regulatory component of Purkinje fiber induction and patterning. These findings would also provide a basis to further elucidate how certain regions of the endothelium produce ECE1.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Arai, H., Hori, S., Aramori, I., Ohkubo, H. and Nakanishi,
S. (1990). Cloning and expression of a cDNA encoding an
endothelin receptor. Nature
348,730
-732.[CrossRef][Medline]
Bainbridge, F. A. (1915). The influence of
venous filling upon the rate of the heart. J. Physiol.
50, 65-84.
Biermann, M., Rubart, M., Moreno, A., Wu, J., Josiah-Durant, A.
and Zipes, D. P. (1998). Differential effects of
cytochalasin D and 2,3 butanedione monoxime on isometric twitch force and
transmembrane action potential in isolated ventricular muscle: implications
for optical measurements of cardiac repolarization. J. Cardiovasc.
Electrophysiol. 9,1348
-1357.[Medline]
Bozler, E. (1942). The initiation of impulses
in cardiac muscle. Am. J. Physiol.
138,273
-282.
Brutsaert, D. L. (2003). Cardiac
endothelial-myocardial signaling: its role in cardiac growth, contractile
performance, and rhythmicity. Physiol. Rev.
83, 59-115.
Chen, J., Fabry, B., Schiffrin E. L. and Wang, N.
(2001). Twisting integrin receptors increases endothelin-1 gene
expression in endothelial cells. Am. J. Physiol.
280,C1475
-C1484.
Cheng, G., Litchenberg, W. H., Cole, G. J., Mikawa, T.,
Thompson, R. P. and Gourdie, R. G. (1999). Development of the
cardiac conduction system involves recruitment within a multipotent
cardiomyogenic lineage. Development
126,5041
-5049.[Abstract]
Chuck, E. T., Freeman, D. M., Watanabe, M. and Rosenbaum, D.
S. (1997). Changing activation sequence in the embryonic
chick heart. Implications for the development of the His-Purkinje system.
Circ. Res. 81,470
-476.
Clark, E. B., Hu, N., Frommelt, P., Vandekieft, G. K., Dummett,
J. L. and Tomanek, R. J. (1989). Effect of increased
pressure on ventricular growth in stage 21 chick embryos. Am. J.
Physiol. 257,H55
-H61.
de Jong, F., Opthof, T., Wilde, A. A., Janse, M. J., Charles,
R., Lamers, W. H. and Moorman, A. F. (1992).
Persisting zones of slow impulse conduction in developing chicken hearts.
Circ. Res. 71,240
-250.
Dull, R. O. and Davies, P. F. (1991). Flow
modulation of agonist (ATP)-response (Ca2+) coupling in vascular
endothelial cells. Am. J. Physiol.
261,H149
-H154.
Fischman, D. A. and Mikawa, T. (1997). The use
of replication-defective retroviruses for cell lineage studies of myogenic
cells. Methods Cell Biol.
52,215
-227.[Medline]
Garcia-Cardena, G., Comander, J., Anderson, K. R., Blackman, B.
R. and Gimbrone, Jr, M. A. (2001). Biomechanical
activation of vascular endothelium as a determinant of its functional
phenotype. Pro. Natl. Acad. Sci. USA
98,4478
-4485.
Gourdie, R. G., Green, C. R., Severs, N. J., Anderson, R. H.
and Thompson, R. P. (1993). Evidence for a distinct
gap-junctional phenotype in ventricular conduction tissues of the developing
and mature avian heart. Circ. Res.
72,278
-289.
Gourdie, R. G., Mima, T., Thompson, R. P. and Mikawa, T.
(1995). Terminal diversification of the myocyte lineage generates
Purkinje fibers of the cardiac conduction system.
Development, 121,1423
-1431.[Abstract]
Gourdie, R. G., Wei, Y., Kim, D., Klatt, S. C. and Mikawa,
T. (1998). Endothelin-induced conversion of heart muscle
cells into impulse-conducting Purkinje fibers. Proc. Natl. Acad.
Sci. USA 95,6815
-6818.
Gourdie, R. G., Kubalak, S. and Mikawa, T.
(1999). Conducting the embryonic heart: Orchestrating development
of the conduction system. Trends Cardiovasc. Med.
9, 18-26.[CrossRef][Medline]
Hamburger, V. and Hamilton, H. L. (1951). A
series of normal stages in the development of the chick embryo. J.
Morphol. 88,49
-92.[CrossRef]
Harrison, V. J., Ziegler, T., Bouzourene, K., Suciu, A.,
Silacci, P. and Hayoz, D. (1998). Endothelin-1 and
endothelin-converting enzyme-1 gene regulation by shear stress and
flow-induced pressure. J. Cardiovasc. Pharmacol.
31,538
-541.
Hogers, B., DeRuiter, M. C., Baasten, A. M., Gittenberger-de
Groot, A. C. and Poelmann, R. E. (1995). Intracardiac blood
flow patterns related to the yolk sac circulation of the chick embryo.
Circ Res. 76,871
-877.
Hu, H. and Sachs, F. (1996). Mechanically
activated currents in chick heart cells. J. Membr.
Biol. 154,205
-216.[CrossRef][Medline]
Hyer, J., Johanssen, M., Prasad, A., Wessels, A., Kirby, M. L.,
Gourdie, R. G. and Mikawa, T. (1999). Induction of
Purkinje fiber differentiation by coronary arterialization. Proc.
Natl. Acad. Sci. USA 96,13214
-13218.
Jacobs, E. E., Cheliakine, C., Gebremedhin, D., Birks, E. K.,
Davies, P. F. and Harder, D. R. (1995). Shear activated
channels in cell-attached patches of cultured bovine aortic endothelial cells.
Pflugers Arch. Eur. J. Physiol.
431,129
-131.[CrossRef][Medline]
Jalife, J., Morley, G. E., Tallini, N. Y. and Vaidya, D.
(1998). A fungal metabolite that eliminates motion artifacts.
J. Cardiovasc. Electrophysiol.
9,1358
-1362.[Medline]
Kamino, K. (1991). Optical approaches to
ontogeny of electrical activity and related functional organization during
early heart development. Physiol. Rev.
71, 53-91.
Kamino, K., Hirota, A. and Fujii, S. (1981).
Localization of pacemaking activity in early embryonic heart monitored using
voltage-sensitive dye. Nature
290,595
-597.[CrossRef][Medline]
Kanzawa, N., Poma, C. P., Takebayashi-Suzuki, K., Diaz, K. G.,
Layliev, J. and Mikawa, T. (2002). Competency of
embryonic cardiomyocytes to undergo Purkinje fiber differentiation is
regulated by endothelin receptor expression.
Development 129,3185
-3194.
Lab, M. J. (1980). Transient depolarization and
action potential alterations following mechanical changes in isolated
myocardium. Cardiovasc. Res.
14, 624-637[Medline]
Lansman, J. B., Hallam, T. J. and Rink, T. J.
(1987). Single stretch-activated ion channels in vascular
endothelial cells as mechanotransducers? Nature
325,811
-813.[CrossRef][Medline]
Lecoin, L., Sakurai, T., Ngo, M. T., Abe, Y., Yanagisawa, M. and
Le Douarin, N. M. (1998). Cloning and characterization
of a novel endothelin receptor subtype in the avian class. Proc.
Natl. Acad. Sci. USA 95,3024
-3029.
Li, J., Hampton, T., Morgan, J. P. and Simons, M.
(1997). Stretch-induced VEGF expression in the heart.
J. Clin. Invest. 100,18
-24.[Medline]
Lieberman, M. and Paes De Carvalho, A. (1967).
Effect of locally applied acetylcholine on the embryonic cardiac action
potential. Experientia
23,539
-540.[CrossRef][Medline]
Litchenberg, W. H., Norman, L. W., Holwell, A. K., Martin, K.
L., Hewett, K. W. and Gourdie, R. G. (2000). The rate
and anistopy of impulse propagation in the postnatal terminal crest and
correlated with remodeling of Cx43 gap junction pattern.
Cardiovasc. Res. 45,379
-387.
Macarthur, H., Warner, T. D., Wood, E. G., Corder, R. and Vane,
J. R. (1994). Endothelin-1 release from endothelial cells in
culture is elevated both acutely and chronically by short periods of
mechanical stretch. Biochem. Biophys. Res. Commun.
200,395
-400.[CrossRef][Medline]
Malek, A. and Izumo, S. (1992). Physiological
fluid shear stress causes downregulation of endothelin-1 mRNA in bovine aortic
endothelium. Am. J. Physiol.
263,C389
-C395.
Markos, F., Hennessy, B. A., Fitzpatrick, M., O'Sullivan, J. and
Snow, H. M. (2002). The effect of tezosentan, a
non-selective endothelin receptor antagonist, on shear stress-induced changes
in arterial diameter of the anaesthetized dog. J.
Physiol. 544,913
-918.
Masatsugu, K., Itoh, H., Chun, T.-H., Ogawa, Y., Tamura, N.,
Yamashita, J., Doi, K., Inoue, M., Fukunaga, Y., Sawada, N., Saito, T.,
Korenaga, R, Ando, J. and Nakao, K. (1998). Physiologic shear
stress suppresses endothelin-converting enzyme-1 expression in vascular
endothelial cells. J. Cardiovasc. Pharmacol.
31,542
-545.
Mikawa, T. (1999a). Cardiac lineages. In
Heart Development (ed. R. P. Harvey and N. Rosenthal),
pp. 19-33. San Diego, CA: Academic Press.
Mikawa, T. (1999b). Determination of heart cell
lineages. In Cell Fate Determination (ed. S. A.
Moody), pp. 449-460. San Diego, CA: Academic
Press.
Mikawa, T. and Fischman, D. A. (1996). The
polyclonal origin of myocyte lineages. Annu. Rev.
Physiol. 58,509
-521.[Medline]
Moorman, A. F. M., de Jong, F., Denyn, M. M. F. J. and Lamers,
W. H. (1998). Development of the cardiac conduction system.
Circ. Res. 82,629
-644.
Morawietz, H., Talanow, R., Szibor, M., Rueckschloss, U.,
Schubert, A., Bartling, B., Darmer, D. and Holtz, J.
(2000). Regulation of the endothelin system by shear stress in
human endothelial cells. J. Physiol.
525,761
-770.
Naruse, K., Yamada, T. and Sokabe, M. (1998).
Involvement of SA channels in orienting response of cultured endothelial cells
to cyclic stretch. Am. J. Physiol.
274,H1532
-H1538.
Nataf, V., Lecoin, L., Eichmann, A. and LeDouarin, N. M.
(1996). Endothelin-B receptor is expressed by neural crest cells
in the avian embryo. Proc. Natl. Acad. Sci. USA
93,9645
-9650.
Nataf, V., Grapin-Botton, A., Champeval, D., Amemiya, A.,
Yanagisawa, M. and Le Douarin, N. M. (1998). The
expression patterns of endothelin-A receptor and endothelin 1 in the avian
embryo. Mech. Dev. 75,145
-149.[CrossRef][Medline]
Olensen, S., Clapham, D. and Davies, P. (1988).
Haemodynamic shear stress activates a K+ current in vascular endothelial
cells. Nature 331,168
-170.[CrossRef][Medline]
Orzechowski, H.-D., Richter, C.-M., Funke-Kaiser, H., Kroger,
B., Schmidt, M., Menzel, S., Bohnemeier, H. and Paul, M.
(1997). Evidence of alternative promoters directing
isoform-specific expression of human endothelin-converting enzyme-1 mRNA in
cultured endothelial cells. J. Mol. Med.
75,512
-521.[CrossRef][Medline]
Patten, B. M. and Kramer, T. C. (1933). The
initiation of contraction in the embryonic chick heart. Am. J.
Anat. 53,349
-375.[CrossRef]
Pennisi, D., Rentchler, S., Poma, C. P., Shulimovich, M.,
Gourdie, R. G., Fishman, G. I. and Mikawa, T. (2002).
Induction and patterning of the cardiac conduction system. Int. J.
Dev. Biol. 46,765
-775.[Medline]
Rajala, G. M., Kalbfleisch, J. H. and Kaplan, S.
(1976). Evidence that blood pressure controls heart rate in the
chick embryo prior to neural control. J. Embryol. Exp.
Morphol. 36,685
-695.[Medline]
Rajala, G. M., Pinter, M. J. and Kaplan, S.
(1977). Response of the quiescent heart tube to mechanical
stretch in the intact chick embryo. Dev. Biol.
61,330
-337.[CrossRef][Medline]
Reckova, M., Rosengarten, C., deAlmeida, A., Stanley, C. P.,
Wessels, A., Gourdie, R. G. Thompson, R. P. and Sedmera D.
(2003). Hemodynamics is a key epigenetic factor in development of
the cardiac conduction system. Circ. Res.
93, 77-85.
Rentschler, S., Vaidya, D. M., Tamaddon, H., Degenhardt, K.,
Sassoon, D., Morley, G. E., Jalife, J. and Fishman, G. I.
(2001). Visualization and functional characterization of the
developing murine cardiac conduction system.
Development 128,1785
-1792.[Abstract]
Rentschler, S., Zander, J., Meyers, K., France, D., Levine, R.,
Porter, G., Rivkees, S. A., Morley, G. E. and Fishman, G. I.
(2002). Neuregulin-1 promotes formation of the murine cardiac
conduction system. Proc. Natl. Acad. Sci. USA
99,10464
-10469.
Ruknudin, A., Sachs, F. and Bustamente, J. O.
(1993). Stretch-activated ion channels in tissue-cultured chick
heart. Am. J. Physiol.
264,H960
-H972.
Sakurai, T., Yanagisawa, M., Takuwa, Y., Miyazaki, H., Kimura,
S., Goto, K. and Masaki, T. (1990). Cloning of a cDNA
encoding a non-isopeptide-selective subtype of the endothelin receptor.
Nature 348,732
-735.[CrossRef][Medline]
Schiaffino, S. (1997). Protean patterns of gene
expression in the heart conduction system. Circ. Res.
80,749
-750.
Sedmera, D., Pexieder, T., Rychterova, V., Hu, N. and Clark, E.
B. (1999). Remodeling of chick embryonic ventricular
myoarchitecture under experimentally changed loading conditions.
Anat. Rec. 254,238
-252.[CrossRef][Medline]
Suchyna, T., Johnson, J. H., Hamer, K., Leykam, J. F., Gage, D.
A., Clemo, H. F., Baumgarten, C. M. and Sachs, F.
(2000). Identification of peptide toxin from Grammostola
spatulata spider venom that blocks cation-selective stretch-activated
channels. J. Gen. Physiol.
115,583
-598.
Takahashi, M. and Berk, B. C. (1996).
Mitogen-activated protein kinase (ERK1/2) activation by shear stress and
adhesion in endothelial cells. Essential role for a herbimycin-sensitive
kinase. J. Clin. Invest.
98,2623
-2631.[Medline]
Takebayashi-Suzuki, K., Yanagisawa, M., Gourdie, R. G., Kanzawa,
N. and Mikawa, T. (2000). In vivo induction of
cardiac Purkinje fiber differentiation by co-expression of preproendothelin
and endothelin converting enzyme-1. Development
127,3523
-3532.[Abstract]
Takebayashi-Suzuki, K., Pauliks, B. L., Eltsefon, Y. and Mikawa,
T. (2001). Purkinje fibers of the avian heart express a
myogenic transcription factor program distinct from cardiac and skeletal
muscle. Dev. Biol. 234,390
-401.[CrossRef][Medline]
Tamaddon, H. S., Vaidya, D., Simon, A. M., Paul, D. L., Jalife,
J. and Morley, G. E. (2000). High-resolution optical
mapping of the right bundle branch in connexin40 knockout mice reveals slow
conduction in the specialized conduction system. Circ.
Res. 87,929
-936.
Tawara, S. (1906). Das
reizleitungssystem des Saugetierherzens. Gustv Fischer:
Jena.
Thompson, R. P., Kanai, T., Gemroth, P., Gourdie, R. G., Thomas,
P., Barton, P. J., Mikawa, T. and Anderson, R. H.
(1995). Organization and function of early specialized
myocardium. In Developmental Mechanisms of Congenital Heart
Disease (ed. E. B. Clark, R. R. Markwald and A. Takao), pp.269
-279. Armonk, NY: Futura.
Tobita, K., Schroder, E. A., Tinney, J. P., Garrison, J. B. and
Keller, B. B. (2002). Regional passive ventricular
stress-strain relations during development of altered loads in chick embryo.
Am. J. Physiol. 282,H2386
-H2396.
Traub, O. and Berk, B. C. (1998). Laminar shear
stress, Mechanisms by which endothelial cells transduce an atheroprotective
force. Arterioscler. Thromb. Vasc. Biol.
18,677
-685.
Vassal-Adams, P. R. (1982). The development of
the atrioventricular bundle and its branches in the avian heart. J.
Anat. 134,169
-183.[Medline]
Wang, D. L., Tang, C. C., Wung, B. S., Chen, H. H., Hung, M. S.
and Wang, J. J. (1993). Cyclical strain increases
endothelin-1 secretion and gene expression in human endothelial cells.
Biochem. Biophys. Res. Commun.
195,1050
-1056.[CrossRef][Medline]
Welikson, R. D. and Mikawa, T. (2001).
Cytoskeletal gene expression in the developing cardiac conduction system. In
Myofibrillogenesis (ed. D. K. Dube), pp.153
-177. Berlin: Springer-Verlag.
Xu, D., Emoto, N., Giaid, A., Slaughter, C. A., Kaw, S., deWit,
D. and Yanagisawa, M. (1994). ECE-1: A membrane-bound
metalloprotease that catalyzes the proteolytic activation of big endothelin-1.
Cell 78,473
-485.[CrossRef][Medline]
Yanagisawa, M., Kurihara, H., Kimura, S., Tomobe, Y., Kobayashi,
M., Mitsui, Y., Yazaki, Y., Goto, K. and Masaki, T.
(1988). A novel vasoconstrictor peptide produced by vascular
endothelial cells. Nature
332,411
-415.[CrossRef][Medline]
Yang, X.-C. and Sachs, F. (1989). Block of
stretch-activated ion channels in Xenopus oocytes by gadolinium and calcium
ions. Science 243,1068
-1071.
Yoshizumi, M., Kurihara, H., Sugiyama, T., Takaku, F.,
Yanagisawa, M., Masaki, T. and Yazaki, Y. (1989).
Hemodynamics shear stress stimulates endothelin production by cultured
endothelial cells. Biochem. Biophys. Res. Commun.
161,859
-864.[CrossRef][Medline]
Zhao, Y. Y., Sawyer, D. R., Baliga, R. R., Opel, D. J., Han, X.,
Marchionni, M. A. and Kelly, R. A. (1998). Neuregulins
promote survival and growth of cardiac myocytes. Persistence of ErbB2 and
ErbB4 expression in neonatal and adult ventricular myocytes. J.
Biol. Chem. 273,10261
-10269.
Zhu, Z.-G., Li, H.-H. and Zhang, B.-R. (1997).
Expression of endothelin-1 and constitutional nitric oxide synthase messenger
RNA in saphenous vein endothelial cells exposed to arterial flow shear stress.
Ann. Thorac. Surg. 64,1333
-1338.
Ziegler, T., Bouzourene, K., Harrison, V. J., Brunner, H. R. and
Hayoz, D. (1998). Influence of oscillatory and unidirectional
flow environments on the expression of endothelin and nitric oxide synthase in
cultured endothelial cells. Arterioscler. Thromb. Vasc.
Biol. 118,686
-692.
This article has been cited by other articles:
![]() |
V. M. Christoffels and A. F.M. Moorman Development of the Cardiac Conduction System: Why Are Some Regions of the Heart More Arrhythmogenic Than Others? Circ Arrhythm Electrophysiol, April 1, 2009; 2(2): 195 - 207. [Full Text] [PDF] |
||||
![]() |
B. J.D. Boukens, V. M. Christoffels, R. Coronel, and A. F.M. Moorman Developmental Basis for Electrophysiological Heterogeneity in the Ventricular and Outflow Tract Myocardium As a Substrate for Life-Threatening Ventricular Arrhythmias Circ. Res., January 2, 2009; 104(1): 19 - 31. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. W. Groenendijk, K. Van der Heiden, B. P. Hierck, and R. E. Poelmann The Role of Shear Stress on ET-1, KLF2, and NOS-3 Expression in the Developing Cardiovascular System of Chicken Embryos in a Venous Ligation Model Physiology, December 1, 2007; 22(6): 380 - 389. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Gurjarpadhye, K. W. Hewett, C. Justus, X. Wen, H. Stadt, M. L. Kirby, D. Sedmera, and R. G. Gourdie Cardiac neural crest ablation inhibits compaction and electrical function of conduction system bundles Am J Physiol Heart Circ Physiol, March 1, 2007; 292(3): H1291 - H1300. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tobita, L. J. Liu, A. M. Janczewski, J. P. Tinney, J. M. Nonemaker, S. Augustine, D. B. Stolz, S. G. Shroff, and B. B. Keller Engineered early embryonic cardiac tissue retains proliferative and contractile properties of developing embryonic myocardium Am J Physiol Heart Circ Physiol, October 1, 2006; 291(4): H1829 - H1837. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Milan, A. C. Giokas, F. C. Serluca, R. T. Peterson, and C. A. MacRae Notch1b and neuregulin are required for specification of central cardiac conduction tissue Development, March 15, 2006; 133(6): 1125 - 1132. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. W. Hewett, L. W. Norman, D. Sedmera, R. J. Barker, C. Justus, J. Zhang, S. W. Kubalak, and R. G. Gourdie Knockout of the neural and heart expressed gene HF-1b results in apical deficits of ventricular structure and activation Cardiovasc Res, August 15, 2005; 67(3): 548 - 560. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C.W. Groenendijk, B. P. Hierck, J. Vrolijk, M. Baiker, M. J.B.M. Pourquie, A. C. Gittenberger-de Groot, and R. E. Poelmann Changes in Shear Stress-Related Gene Expression After Experimentally Altered Venous Return in the Chicken Embryo Circ. Res., June 24, 2005; 96(12): 1291 - 1298. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. I. Fishman Understanding Conduction System Development: A Hop, Skip and Jump Away? Circ. Res., April 29, 2005; 96(8): 809 - 811. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||