|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 7 January 2004
doi: 10.1242/dev.00964
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1 U 368 INSERM, Ecole Normale Supérieure, 46 rue d'Ulm, 75230 Paris cedex
5, France
2 Department of Biochemistry, University of Washington, Box 357350, Seattle, WA
98195-7350, USA
3 Unité `Macrophages et Développement de l'Immunité'
Institut Pasteur, 25 rue du Dr Roux, 75724 Paris Cedex 15, France
4 Institut de Génétique et de Biologie Moléculaire et
Cellulaire, CNRS/INSERM/ULP, BP 163, 67404 Illkirch Cedex, Strasbourg,
France
5 UMR CNRS 7138, Université Pierre et Marie Curie, Batiment A, 4eme
etage, case 5, 7 quai Saint Bernard, 75252 Paris Cedex 05, France
Author for correspondence (e-mail:
peyriera{at}wotan.ens.fr)
Accepted 5 November 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Nodal, Fgf, Zebrafish, Gastrulation, Mesoderm
| Introduction |
|---|
|
|
|---|
At the molecular level, secreted molecules of the transforming growth
factor ß (TGFß) family have been implicated in the formation of
mesoderm in both organisms (Harland and
Gerhart, 1997
). In the Xenopus embryo, TGFß family
members such as Activin and Vg1 were initially thought to act as maternal
factors. However, characterization of the maternal transcription factor VegT,
localized at the vegetal pole, led to a model in which the TGFß family
members Vg1-related Derriere and Nodal-type Xnr1, Xnr2 and Xnr4 are required
zygotically downstream of VegT for the formation of the entire mesoderm
(Sun et al., 1999
;
Clements et al., 1999
;
Kofron et al., 1999
;
Yasuo and Lemaire, 1999
;
Agius et al., 2000
;
Hyde and Old, 2000
). Although
VegT does not seem to be involved in the early steps of mesoderm formation in
mouse and zebrafish, the study of mutants affected in the Nodal pathway
indicates a conserved role for Nodals in vertebrate mesoderm development.
In zebrafish, genetic analysis of the Nodal-related genes squint
(sqt), cyclops (cyc) and of oep, which
encodes a Nodal co-factor, reveals that Nodal signalling is implicated in both
mesoderm and endoderm formation (Feldman
et al., 1998
; Gritsman et al.,
1999
). Indeed, embryos lacking maternal and zygotic Oep function
(MZoep), and sqt;cyc double mutants are devoid of endoderm
and mesoderm in the head and trunk. However, the tail mesoderm is still
induced and maintained in these mutants, which indicates that pathways other
than the Oep-dependent Nodal pathway are implicated in formation of ventral
mesoderm.
Fgf was identified in Xenopus as a mesoderm inducer
(Kimelman and Kirschner, 1987
;
Slack et al., 1987
) and
overexpression of a dominant-negative form of a Fgf receptor impairs mesoderm
induction in Xenopus and zebrafish gastrulae
(Amaya et al., 1991
;
Griffin et al., 1995
), which
indicates that Fgf activity could be involved in mesoderm induction in
vertebrate embryos. However, Fgf signalling is not sufficient for mesoderm
induction in Xenopus, because embryos expressing a dominant-negative
form of the activin receptor lack mesoderm but have an intact Fgf signalling
pathway (Hemmati-Brivanlou and Melton,
1992
). The current model, based largely on experiments in
Xenopus, proposes that Fgf is required either in parallel to or
downstream of Nodal/Activin signals to induce and maintain mesodermal fates
(Cornell and Kimelman, 1994
;
Labonne and Whitman, 1994
;
Schulte-Merker et al., 1994
;
Labonne et al., 1995
).
However, the molecular basis of the interaction between the two pathways is
largely unknown. One possibility is that Fgf acts downstream of Nodal
signalling as a relay mechanism required for mesoderm induction
(Rodaway et al., 1999
).
In addition to their role in cell-fate induction, Nodal and Fgf signalling
have been implicated in cell movements, but their possible cooperation in this
matter has not been studied. In zebrafish, MZoep cells do not ingress
at the margin of the embryo (Carmany-Rampey
and Schier, 2001
), however they are able to involute in a
wild-type environment (Aoki et al.,
2002a
). In addition, activation of Nodal signalling promotes
cell-autonomous movements (David and Rosa,
2001
). Analysis of fgf8 and fgfR1-mutant mice
revealed that Fgf signalling is involved in gastrulation movements
(Ciruna and Rossant, 2001
). In
Xenopus, inhibiting Fgf signalling by overexpressing either a
dominant-negative receptor or a MAP kinase phosphatase severely affects
gastrulation (Isaacs et al.,
1994
; Labonne et al.,
1995
; Labonne and Whitman,
1997
). The regulation of gastrulation movements through Fgf
signalling is probably a common trait of amphibians and teleosts, because
overexpression of either Fgf or a dominant-negative FgfR dramatically affects
gastrulation in zebrafish (Griffin et al.,
1995
; Rodaway et al.,
1999
).
The analysis of a putative interaction between Nodal and Fgf signalling
pathways is complicated by the fact that both are regulated through positive
and negative feedback loops. It was shown in Xenopus, zebrafish and
mouse, that Nodal promotes its own expression as well as the expression of its
antagonist Lefty/Antivin (Meno et al.,
1999
; Thisse and Thisse,
1999
; Hyde and Old,
2000
). Similarly, Fgf promotes the expression of its antagonists
sprouty and sef
(Furthauer et al., 2001
;
Furthauer et al., 2002
;
Tsang et al., 2002
), and eFgf
positively regulates its own expression through the T-box transcription factor
Xbra (Isaacs et al., 1994
;
Labonne et al., 1995
;
Schulte-Merker and Smith,
1995
; Umbhauer et al.,
1995
; Casey et al.,
1998
).
Together, these data indicate the existence of a gene network involving Fgf
and Nodal signalling components, the connectivity and function of which remain
to be understood. In the present study, we show that intact Fgf signalling is
required for the cell-autonomous and cell-nonautonomous induction of
oep downstream of the Nodal pathway, and that intact Oep signalling
is required for the cell-nonautonomous induction of the Activin/Nodal type I
receptor Taram-A (Renucci et al.,
1996
). This regulation circuit provides a model for the
involvement of the Fgf pathway in the cellular response to Nodal signals, and
for the maintenance, amplification and cell-to-cell propagation of Nodal
activity after the activation of the zygotic genome. Such a model predicts
that lowering Fgf and Nodal levels will have cooperative, deleterious effects
on the cell-nonautonomous induction of genes downstream of the Tar*/Nodal
pathway. Indeed, this is what we observe for the regulation of the mesoderm
marker no tail (ntl) expression in chimeric embryos. In
addition, overexpression data and analysis of the oep;ace
double-mutant phenotype show that Fgf8 takes part in this process. The genetic
interaction between oep and ace differentially affects cell
movements and survival of distinct mesodermal cell populations and is
consistent with a synergistic activity of Nodal and Fgf8 in mesoderm cells
through the genetic regulation of the Nodal co-factor Oep.
| Materials and methods |
|---|
|
|
|---|
Microinjection and transplantation
Synthetic mRNAs were transcribed in vitro using the SP6 mMessage
mMachineTM transcription kit (Ambion). Embryos were injected at the
1-4-cell stage with tar* (2 pg), sqt (5 pg), cyc (5
pg), fgf8 (40 pg) and fgf3 (40 pg) synthetic mRNAs.
fgf3 (CATTGTGGCATGGCGGGATGTCGGC 0.2 mM) and fgf8
(GAGTCTCATGTTTATAGCCTCAGTA 0.5 mM) morpholino modified antisense
oligonucleotides (GeneTools) were prepared and injected as described
(Furthauer et al., 2001
). For
transplantation experiments, donor embryos were injected at the 1-4-cell stage
with LacZ RNA (50 pg) and/or gfp RNA (50 pg) as lineage
tracers in combination with tar* (2 pg).
Labelling hypoblast cells
A solution of 10-kD DMNB-caged fluorescein (5 mg ml1)
(Molecular Probes) was injected at the one-cell stage. When embryos reached
the shield stage, the dye was activated in a few blastomeres by a microlaser
beam, as described (Serbedzija et al.,
1998
). At the tail-bud stage, the location of the labelled cells
was assessed by immunocytochemistry against fluorescein following in situ
hybridization.
SU5402 treatment
Embryos were treated in the dark with either 10 µM or 30 µM SU5402
(Calbiochem) from the two-cell stage until they were fixed or rinsed with
embryo medium to allow development to proceed.
Acridine Orange treatment
Live embryos were treated with 5 µg ml1Acridine Orange
(Sigma) in embryo medium for 30 minutes, then washed with embryo medium and
observed in epifluorescence.
Annexin V injection
Annexin-V-Alexa 488 (Nexins Research B.V., 2-5 nl, injected pure) was
injected directly into the posterior hypoblast of embryos at the tail-bud
stage with an eppendorf transjector (5246) and a pulled glass needle. 15
minutes after the injection, embryos were mounted in methylcellulose 3% in
embryo medium and observed with a confocal microscope (Leica TCS SP2) with a
40x objective (Leica 40x/0.80 W).
In situ hybridisation and immunocytochemistry
In situ hybridisation was carried out as described
(Hauptmann and Gerster, 1994
)
using the following mRNA: myoD
(Weinberg et al., 1996
);
ntl (Schulte-Merker et al.,
1992
); tbx6 and fgf3
(Hug et al., 1997
);
fgf8 (Furthauer et al.,
1997
); tar (Renucci
et al., 1996
); oep
(Zhang et al., 1998
);
cyc (Rebagliati et al.,
1998b
); sqt (Feldman
et al., 1998
; Rebagliati et
al., 1998a
); her5
(Müller et al., 1996
);
spt (Griffin et al.,
1998
); hgg1 (Thisse
et al., 1994
); sprouty4
(Furthauer et al., 2001
); and
myhz1 (Xu et al.,
2000
). ß-galactosidase was revealed with a rabbit polyclonal
antibody (Cappel) at 1:1000 dilution and diaminobenzidine staining. Green
fluorescent protein was revealed with a rabbit polyclonal antibody (Molecular
Probes) at 1:1000 dilution and anti-rabbit CY3 (Jackson Immuno Research) at
1:500.
Genotyping
Embryos were genotyped after in situ hybridization using a PCR-based
method. Single embryos were boiled in 10 µl lysis buffer (Tris-HCl 10 mM pH
7.3, KCl 50 mM, MgCl2 1.5 mM, Tween-20 3%, NP40 3%). They were then
digested for 4 hours at 56°C with 1 mg ml-1 proteinase K. The
latter was inactivated by boiling for 5 minutes. PCR reaction was performed
using 2.5 µl of the embryo extract in a 25 µl reaction volume. The
oeptz57 allele was identified using the primers tzup,
5'-AGATGGAGATGTTCTAATGGTGTTTTTGGG-3', and tzdown,
5'-TGACAAATAATCACAGCAAACATCAAGAAC-3'. The PCR product was digested
with MaeIII, which cuts the mutant allele only. The
aceti282a allele was identified using the primers EcoRVup,
5'-CTTCGGATTTCACATATTTATGCCCGTATGTATGCATATC-3', and EcoRVdown,
5'-CAGTTTTAGTAAGTCACAAAAGTGATGACTTTTTCAGATA-3'. The PCR product
was digested with Eco RV, which cuts the mutant allele only.
| Results |
|---|
|
|
|---|
|
|
Previously, Fgf signalling was proposed to act as a relay signal from the
Nodal-expressing mesendoderm into the mesoderm proper
(Rodaway et al., 1999
).
Consistent with such a model, Tar* expressing cells, which have mesendodermal
characteristics (Mathieu et al.,
2002
), could induce both cell-autonomous and nonautonomous
expression of the mesoderm marker ntl in chimeric, wild-type embryos
(Fig. 1G and
Table 1). Cells that express
Cyc or Sqt are also very potent inducers of ntl in wild-type chimeras
(Fig. S1C,I at
http://dev.biologists.org/supplemental).
Therefore, we investigated whether Fgf signalling was involved in the response
to Tar* and Nodals, using SU5402, a pharmacological inhibitor of FgfR activity
(Mohammadi et al., 1997
). The
cell-nonautonomous induction of the mesoderm marker ntl by Tar*, Cyc
or Sqt expressing wild-type cells was abolished by SU5402 treatment, and the
cell-autonomous induction of ntl in the same chimeric embryos was
strongly diminished (Fig. 1G,N,
Fig. S1C,F,I,L at
http://dev.biologists.org/supplemental
and Table 1). In addition, the
induction of ntl by Tar* expressing cells in MZoep embryos,
was abolished by SU5402 treatment (Fig.
1R,X, Table 1).
These observations are in agreement with previous studies in Xenopus
demonstrating that TGFß-dependent induction of mesodermal genes such as
ntl depends on FGF signalling
(Cornell and Kimelman, 1994
;
Labonne and Whitman, 1994
). In
addition, they indicate that Fgf signalling might act as a relay signal from
the Nodal-expressing cells into the neighbouring cells, and that Fgf
signalling cooperates with Oep-dependent signalling to induce downstream
genes.
The activation of oep and tar expression by Tar*/Nodal differs in their requirements for Oep and FGF. The cell-nonautonomous induction of oep by Tar*, Sqt and Cyc in wild-type cells was abolished by the SU5402 treatment and there remained only traces of oep cell-autonomous expression in the chimeric embryos (Fig. 1I, Fig. S1E,K at http://dev.biologists.org/supplemental and Table 1). Similarly, cell-nonautonomous induction of oep by Tar* expressing cells was abolished in the presence of SU5402 in MZoep background and there only remained traces of cell-autonomous induction (Fig. 1V). In contrast, the induction of tar by Tar* was not affected by the SU5402 treatment in either background (Fig. 1H,U, Table 1) and the induction of cyc and sqt by Tar* in the wild-type background, was not affected by the SU5402 treatment either (Fig. 1J,K, Table 1). In summary, these observations indicate that at least two relays act in the positive-feedback loop of the Nodal signalling pathway: Nodal, which is needed for non-autonomous tar expression; and Fgf, which is needed for autonomous and nonautonomous oep expression.
Fgf3 and Fgf8 are candidates for involvement in the Nodal positive-feedback loop
Because our data indicated that Fgf signalling is involved in a relay
mechanism downstream of Nodal, we predicted that the expression of specific
Fgf ligands should be regulated by Nodal, and that these ligands should be
involved in the regulation of endogenous oep. Both fgf3 and
fgf8 are expressed at early developmental stages in marginal
blastomeres and could play such a role. To investigate this possibility, we
tested whether fgf3 and fgf8 could be induced by
overexpression of RNA encoding Nodal ligands Sqt and Cyc. Sqt and Cyc
overexpression was sufficient to induce the expression of both fgf3
and fgf8 (Fig. 2A-F).
In chimeric embryos, Tar*-expressing cells also induced fgf3 and
fgf8 cell-autonomously and cell-nonautonomously
(Fig. 1E,F,
Table 1). Treatment with SU5402
had little effect on the expression of these fgf genes by
Tar*-expressing cells (Fig.
1L,M, Table 1). However, fgf8 expression was induced in a higher percentage of
embryos that expressed Tar* than fgf3 (twice as much), which makes
Fgf8 a better candidate to act downstream of Tar*. These observations indicate
that activation of the Nodal pathway is sufficient to induce expression of Fgf
ligands.
|
We next asked whether Fgf signalling was involved in the regulation of endogenous oep. Again consistent with the hypothesis that Fgf3 and/or Fgf8 may act downstream of the Tar*/Nodal pathway to induce the cell-nonautonomous expression of oep, we observed that fgf3 and fgf8 overexpression induced the expression of oep but not tar (Fig. 2G-L) sqt and cyc (data not shown). In addition, impairment of Fgf signalling selectively affected the expression of oep but not tar as observed in embryos treated from the one-cell stage with 30 µM SU5402 (Fig. 2S-U and data not shown). However, impairment of both fgf3 and fgf8 using morpholino modified antisense oligonucleotides (MOs) reduced but did not abolish oep expression at early gastrula stages (Fig. S2 at http://dev.biologists.org/supplemental) indicating that other Fgfs might contribute to the regulation of oep. To further investigate the contribution of Fgf8 to the induction of oep downstream of Tar*/Nodal, we performed transplantation experiments in the context of impaired Fgf8 function by injection of a fgf8 MO at the one-cell stage into wild-type or MZoep donor and host embryos (Fig. 1S,T,Y,Z, Table 1). Induction of Tar was not affected in fgf8 MO-injected embryos, and although oep expression was much weaker than in uninjected embryos, it was not lost. Thus, fgf8 MO injection does not completely mimic the effects of SU5402 treatment.
Together, these results show that Fgf signalling is necessary and sufficient to trigger the induction of oep downstream of the Nodal pathway, and indicate that Fgf3 and Fgf8 are likely to be involved in such a relay mechanism, although other Fgfs may take part in this process.
oep and fgf8 interact genetically in vivo in the formation of mesoderm
The previous experiments indicated the presence of a previously unsuspected
regulatory interaction between the Oep/Nodal and Fgf pathways and indicated
the involvement of Fgf8 in this process. To further address the interaction in
vivo between Nodal and Fgf8, we examined the phenotype of Zoep;ace
double mutants. The presence of maternal Oep protein enables some Nodal
signalling to occur in embryos lacking Zoep function. Similarly,
aceti282a is a mutant allele of fgf8, but the
presence of correctly spliced full-length fgf8 message renders
aceti282-mutant embryos hypomorphic in Fgf8 signalling
(Reifers et al., 1998
).
Because both these mutations reduce but do not eliminate the corresponding
activities, they can be used as sensitised mutant backgrounds to uncover
processes in which both pathways may be involved.
By day one of development, the double mutants were identified easily by the additive combination of brain defects, including the absence of hypothalamus, cerebellum and midbrain-hindbrain boundary. They also exhibited a profoundly altered morphology of mesoderm derivatives in the trunk and tail, contrasting with the phenotype of Zoep and ace single mutants (Fig. 3D,G,J). The posterior trunk and tail tissue of the double-mutants appeared necrotic and was heavily stained by acridine orange (Fig. 4A-D). However, remnants of notochord and somites could be detected in the anterior trunk. Furthermore, we found by in situ hybridization that a variable number of trunk cells in most double-mutant embryos expressed myoD (Fig. 3K,M,N) and myhz1 myosin heavy chain RNA (Fig. 3L,O,P), indicating that the differentiation of some muscle fibres occurred in a region extending at most until somite 8.
|
|
The dorsal mesoderm of Zoep;ace embryos undergoes massive cell death at the end of gastrulation
We further investigated the timing of the mesodermal cell death observed in
Zoep;ace mutants by inspecting live embryos during gastrulation by
Nomarski video microscopy. We observed that dorsal hypoblastic cells underwent
a dramatic morphological change by the end of gastrulation, losing their
transparency and displaying the typical morphology of apoptotic cells
(Fig. 4E-J). These cells were
stained neither by acridine orange nor by TUNEL, which only marked small
vesicles dispersed in the overlying ectoderm (data not shown), but they were
stained by Annexin V Alexa injected directly into the extracellular space
(Fig. 4G,H). The latter
observation indicated that these hypoblastic cells were undergoing an
apoptotic process (van den Eijnde et al.,
1997
). More laterally, cells with a typical hypoblastic morphology
were found 100 µm from the bulk of dying cells
(Fig. 4I). As development
proceeded, somite condensation and notochord formation occurred in the
anterior trunk and the mass of dead cells was pushed caudally
(Fig. 4J and data not shown).
Concomitantly, numerous cell corpses were incorporated into the yolk cell, as
indicated by Nomarski images (Fig.
4J,L).
We conclude from these observations that the mesoderm is subdivided into populations that differ in their requirement for cooperation between the Oep and Fgf8 pathways. Most of the dorsal mesoderm undergoes massive cell death by the end of gastrulation in Zoep;ace mutants and this aspect of the double-mutant phenotype is fully penetrant. More lateral mesoderm cells, although somewhat scattered on the yolk syncytium, displayed a normal morphology by the end of gastrulation (Fig. 4I).
Cooperation between oep and ace is required before the onset of gastrulation to maintain axial mesoderm fate
As described above, the dorsal mesoderm underwent massive cell death by the
end of gastrulation in Zoep;ace mutants. However, some cells were
able to contribute to anterior notochord and somites and we hypothesized that
they expressed mesoderm markers. To investigate this, we analyzed the
expression of the axial and adaxial mesoderm markers ntl and
myoD, respectively, at the end of gastrulation
(Fig. 5A,B). In the double
mutant, myoD was undetectable by this stage
(Fig. 5B). Staining of
ntl was detected at the blastoderm margin and was very limited and
scattered in the embryonic axis (Fig.
5B). In addition, we found that the anterior limit of ntl
staining along the rostro-caudal axis did not reflect the hypoblast involution
that occurred in the double mutants. The hypoblast involution was assessed in
wild-type and Zoep;ace embryos by labelling cells in the embryonic
shield. This was achieved by locally uncaging caged-fluorescein injected at
the one-cell stage in the progeny of double-heterozygous fish. By the end of
gastrulation, treated embryos were stained with ntl and uncaged
fluorescein was revealed by immunocytochemistry
(Fig. 5C,D). From the
observation of the cell tracer, we concluded that the rostro-caudal extension
of the axial hypoblast in the double-mutants
(Fig. 5D) was significantly
less than in wild-type (Fig.
5C) and single mutants (data not shown). However, the defects in
involution do not readily explain the loss of ntl and myoD
expression in the hypoblast of Zoep;ace mutants. Rather, we
hypothesize that Oep and Fgf8 cooperate in maintaining dorsal mesodermal
markers.
|
The phenotype of Zoep;ace mutants reveals a cooperation between Oep and Fgf8 pathways differentially affecting the morphogenesis of various mesodermal territories. In particular, we conclude that the axial hypoblast requires cooperation between Oep and Fgf8 before the onset of gastrulation to maintain the expression of the notochord marker ntl and insure the survival of dorsal mesodermal cells.
Cooperation between oep and fgf8 acts differentially on the induction of mesoderm markers but is mainly required for the maintenance of mesodermal fates
The above results did not address whether Oep and Fgf8 act cooperatively in
the initial phase of mesoderm induction. To investigate this, we analyzed the
expression of the T-box mesoderm markers ntl, tbx6 and spadetail
(spt) before the onset of gastrulation in Zoep;ace mutants
(Fig. 6). No difference was
seen between wild-type and single mutants, but the latter differed slightly
from Zoep;ace double mutants in the levels of expression of
ntl at 30% epiboly (Fig.
6A,G) and of tbx6 at 30% epiboly and shield stage
(Fig. 6C,I,F,L). By contrast,
the expression of spt was not obviously affected at either stage
(Fig. 6D,E).
|
These observations indicate that oep and fgf8 act synergistically on the maintenance of all the mesoderm markers tested. Their combined action on induction of T-box genes is rather subtle but suggests a differential regulation with no effect on spt expression, a delay in the amplification of ntl and a downregulation of tbx6 that can be detected at all stages.
However, the induction of mesoderm still occurs in the absence of the zygotic contribution of oep and fgf8. We hypothesized that Oep maternal contribution rescued earlier aspects of the formation of mesoderm. To assess this, we investigated the phenotype of MZoep;ace embryos. By 30 hours of development they were devoid of somites in the tail (Fig. 7B) unlike MZoep mutants (Fig. 7A), confirming that Oep and Fgf8 also cooperate in the maintenance of the presumptive tail mesoderm and consistent with our observation that fgf8 is expressed in the posterior mesoderm during gastrulation (Fig. 2R).
|
| Discussion |
|---|
|
|
|---|
Fgf is required for the amplification and propagation of Nodal signalling through a positive regulatory loop
Our overexpression data indicates a model in which Fgf signalling is
required both cell-autonomously and cell-nonautonomously for the activation of
oep expression downstream of Tar*/Nodal. In this model, the
mechanisms and dynamics of the positive regulation loop of the Nodal pathway
depend on the role of Oep. Analysis of zebrafish and mouse mutants indicates
that this EGF-CFC co-factor is essential for Nodal function during early
embryogenesis (Whitman, 2001
).
However, it has been suggested recently that Nodal signalling might function
in the absence of EGF-CFC co-factors
(Reissmann et al., 2001
). Such
a hypothesis is not supported by our transplantation experiments. Indeed,
cells that expressed sqt had no detectable inducing activity in the
MZoep background. In any case, the cell-nonautonomous induction of
both tar and oep by Tar*-expressing cells indicates that
Nodal signalling might propagate to the neighbouring cells via the secreted
ligand Sqt because the latter can act 10 cells away from its source
(Chen and Schier, 2001
).
However, Tar*-expressing cells induce the expression of cyc and
sqt cell-autonomously only, indicating that the activity of Nodal
signalling in neighbouring cells is modulated, and that the propagation of
Nodal signalling is restricted. This could result from the negative regulation
of the pathway. Indeed, the Nodal antagonist Antivin is induced downstream of
Tar*/Nodal (Meno et al., 1999
;
Thisse and Thisse, 1999
;
Hyde and Old, 2000
) and has
been shown to limit the range of action of Sqt
(Meno et al., 2001
).
We assessed the potential role of Fgf signalling downstream of Nodal by
using SU5402, inhibitor of the Fgf pathway
(Mohammadi et al., 1997
). Any
Fgf molecules present between the sphere stage and 50% epiboly at the margin
of the blastoderm in the mesodermal precursors could, potentially, account for
the drug effects. Although we have reasons to implicate Fgf8, the high doses
of SU5402 required to inhibit oep expression at the onset of
gastrulation indicate contributions by other Fgfs. We explored the possibility
of a combined role of FGF3 and FGF8 by using specific morpholinos
(Maroon et al., 2002
) and
concluded that Fgf3 and Fgf8 account for at least part of the Fgf activity in
early steps of mesoderm formation, but that other, as yet unidentified, Fgfs
might be involved.
Oep/Nodal and Fgf8 signalling pathways act synergistically and their cooperation differentially affects the expression of mesoderm-marker genes
We discussed above a role for Fgf downstream of Nodal and suggested that
tar, fgf and oep are connected directly through a cascade of
gene activation. Several mechanisms operating at the genetic and epigenetic
level might account for a strict requirement of fgf8 downstream of,
or in parallel to oep. By contrast, analysis of the zebrafish
oep and ace single and double-mutant phenotypes demonstrates
that Oep and Fgf8 cooperate in the formation of mesoderm. This means that both
pathways also act in parallel, but in a redundant way rather than with a
strict requirement for each other. We suggest that both types of interaction
between oep and fgf8 coexist within the nodal/fgf
molecular network. Cooperation between Nodal and Fgf pathways might be
achieved at the genetic level, through the interaction of their downstream
components with the regulatory sequences of common target genes. This might
happen for the regulation of the T-box genes. This hypothesis fits with our
expression data in the Zoep and ace single and double-mutant
backgrounds.
Analysis of single and double mutants of oep and ace indicates that several aspects of mesoderm formation depend on the Nodal/Fgf8 cooperation. However, the latter is not crucial for induction of mesoderm and initiation of the expression of the T-box genes ntl, spt and tbx6, although it does modulate their level of expression, probably through an amplification step. However, the Nodal/Fgf8 interaction is essential for the maintenance of mesodermal cell populations. This is shown by the loss of T-box gene expression during somitogenesis in Zoep;ace mutants, and even earlier in MZoep;ace mutants. The timing of oep and fgf8 interaction, determined from our SU5402 incubation experiments, reveals an early requirement, which correlates with the later maintenance of ntl expression in the embryonic axis. It fits with the detection of fgf8 RNA at the margin of the blastoderm before gastrulation. Later, fgf8 staining is excluded from the embryonic axis during gastrulation and retained in the presomitic mesoderm. At these stages, the Oep-Fgf8 cooperation might occur at the blastoderm margin where both are expressed, and act on the maintenance of nonaxial mesoderm.
Zoep;ace and oep;ntl double mutants have a dramatic
deficit in the formation of mesoderm
(Schier et al., 1997
). The
similarities between the phenotypes of the two mutants indicate that
ntl has a major role downstream of fgf8 and probably also
parallel to it through a positive regulatory loop, as shown for eFgf and Xbra
(Cornell and Kimelman, 1994
;
Labonne and Whitman, 1994
;
Schulte-Merker et al., 1994
;
Labonne et al., 1995
). This
also fits with the hypothesis that the T-box genes ntl, spt and
tbx6 are interconnected, either as common targets of oep and
fgf8, or because they interact at the genetic level to regulate each
others expression (Kimelman and Griffin,
2000
).
Expression of myoD reveals other aspects of the cooperation between Oep and Fgf8
As in ntl mutants, the early phase of myoD expression in
the adaxial cells (Weinberg et al.,
1996
), which extends from midgastrula to prior to somite
formation, is abolished on combined zygotic reduction of function of
oep and ace. However, myoD expression occurs at
later stages in Zoep;ace mutants. Notably, by one day of development
the myoD-expression domain reveals a transition in the trunk mesoderm
at the 68-somite level. This rostro-caudal transition is distinct from
the trunk-tail transition at the level of somite 18, which has been discussed
previously (Kimelman and Griffin,
2000
), and is reminiscent of that described in mouse embryos
(Soriano, 1997
). Recently, it
has been suggested (Holley et al.,
2002
) that in both mouse and zebrafish mutants affected in the
formation of somites show an anterior to posterior polarity in phenotype, with
anterior regions less severely affected than posterior regions. This
rostro-caudal transition may reflect profound morphogenetic differences
between the anterior and posterior somites. The first six somites are known to
form more rapidly and display a more synchronous morphogenesis than the
posterior somites and it has been suggested that their formation might be
independent of oscillating gene expression
(Holley et al., 2002
). Here,
we suggest that this rostro-caudal transition also affects the axial mesoderm
because the notochord does not form at more posterior rostro-caudal levels in
Zoep;ace mutant embryos.
Differential requirement for the synergy between ace and oep defines distinct mesodermal territories
Our data point to regional differences in the behaviour of mesodermal cells
that correlate with their requirement for the cooperation between oep
and ace. The fate of lateral mesoderm is maintained until
mid-somitogenesis in the absence of oep and fgf8 zygotic
components, but it is disrupted during gastrulation when maternal oep
function is also removed.
Except for a few cells that either form notochord or undergo somite condensation and myogenic differentiation, cells of the dorsal mesoderm require cooperation between zygotic oep and fgf8 before the onset of gastrulation in order to survive. Indeed, we observed that in a domain that probably encompasses the notochord and paraxial mesoderm territories, cells undergo a dramatic morphological change at the time of epiboly completion. Our Annexin V binding data indicates that these hypoblastic cells might undergo an apoptotic process with the exposure of phosphatidyl-serine on the outer lipid leaflet of the cell membrane. The link between this cell behaviour and disruption of the Oep and Fgf8 pathways remains to be elucidated. Subsequent morphogenesis in the Zoep;ace mutants is profoundly affected by the presence of this mass of dying cells, even though the yolk cell can engulf numerous cell corpses.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
* Present address: EMBL, Meyerhofstr. 1 D-69117 Heidelberg, Germany ![]()
| REFERENCES |
|---|
|
|
|---|
Agius, E., Oelgeschlager, M., Wessely, O., Kemp, C. and De
Robertis, E. M. (2000). Endodermal Nodal-related
signals and mesoderm induction in Xenopus. Development
127,1173
-1183.[Abstract]
Amaya, E., Musci, T. J. and Kirschner, M. W.
(1991). Expression of a dominant negative mutant of the FGF
Receptor disrupts mesoderm formation in Xenopus embryos.
Cell 66,257
-270.[CrossRef][Medline]
Aoki, T. O., David, N. B., Minchiotti, G., Saint-Etienne, L.,
Dickmeis, T., Persico, G. M., Strahle, U., Mourrain, P. and Rosa, F.
M. (2002a). Molecular integration of casanova in the Nodal
signalling pathway controlling endoderm formation.
Development 129,275
-286.
Aoki, T. O., Mathieu, J., Saint-Etienne, L., Rebagliati, M. R.,
Peyrieras, N. and Rosa, F. M. (2002b). Regulation of
nodal signalling and mesendoderm formation by TARAM-A, a TGFbeta-related type
I receptor. Dev Biol
241,273
-288.[CrossRef][Medline]
Brand, M., Heisenberg, C. P., Warga, R. M., Pelegri, F.,
Karlstrom, R. O., Beuchle, D., Picker, A., Jiang, Y. J.,
Furutani-Seiki, M., van Eeden, F. J. et al. (1996). Mutations
affecting development of the midline and general body shape during zebrafish
embryogenesis. Development
123,129
-142.[Abstract]
Carmany-Rampey, A. and Schier, A. F. (2001).
Single-cell internalization during zebrafish gastrulation. Curr
Biol 11,1261
-1265.[CrossRef][Medline]
Casey, E. S., O'Reilly, M. A., Conlon, F. L. and Smith, J.
C. (1998). The T-box transcription factor Brachyury regulates
expression of eFGF through binding to a non-palindromic response element.
Development 125,3887
-3894.[Abstract]
Chen, S. and Kimelman, D. (2000). The role of
the yolk syncytial layer in germ layer patterning in zebrafish.
Development 127,4681
-4689.[Abstract]
Chen, Y. and Schier, A. F. (2001). The
zebrafish Nodal signal Squint functions as a morphogen.
Nature 411,607
-610.[CrossRef][Medline]
Ciruna, B. and Rossant, J. (2001). FGF
signaling regulates mesoderm cell fate specification and morphogenetic
movement at the primitive streak. Dev Cell
1, 37-49.[CrossRef][Medline]
Clements, D., Friday, R. V. and Woodland, H. R.
(1999). Mode of action of VegT in mesoderm and endoderm
formation. Development
126,4903
-4911.[Abstract]
Cornell, R. A. and Kimelman, D. (1994).
Activin-mediated mesoderm induction requires FGF.
Development 120,453
-462.[Abstract]
David, N. B. and Rosa, F. M. (2001). Cell
autonomous commitment to an endodermal fate and behaviour by activation of
Nodal signalling. Development
128,3937
-3947.
Dickmeis, T., Aanstad, P., Clark, M., Fischer, N., Herwig, R.,
Mourrain, P., Blader, P., Rosa, F., Lehrach, H. and Strahle, U.
(2001). Identification of nodal signaling targets by array
analysis of induced complex probes. Dev. Dyn.
222,571
-580[CrossRef][Medline]
Feldman, B., Gates, M. A., Egan, E. S., Dougan, S. T.,
Rennebeck, G., Sirotkin, H. I., Schier, A. F. and Talbot, W. S.
(1998). Zebrafish organizer development and germ-layer formation
require Nodal-related signals. Nature
395,181
-185.[CrossRef][Medline]
Furthauer, M., Thisse, C. and Thisse, B.
(1997). A role for FGF-8 in the dorsoventral patterning of the
zebrafish gastrula. Development
124,4253
-4264.[Abstract]
Furthauer, M., Reifers, F., Brand, M., Thisse, B. and Thisse,
C. (2001). sprouty4 acts in vivo as a feedback-induced
antagonist of FGF signaling in zebrafish. Development
128,2175
-2186.
Furthauer, M., Lin, W., Ang, S. L., Thisse, B. and Thisse,
C. (2002). Sef is a feedback-induced antagonist of
Ras/MAPK-mediated FGF signalling. Nat. Cell Biol.
4, 170-174.[CrossRef][Medline]
Griffin, K., Patient, R. and Holder, N. (1995).
Analysis of FGF function in normal and no tail zebrafish embryos reveals
separate mechanisms for formation of the trunk and the tail.
Development 121,2983
-2994.[Abstract]
Griffin, K. J., Amacher, S. L., Kimmel, C. B. and Kimelman,
D. (1998). Molecular identification of spadetail: regulation
of zebrafish trunk and tail mesoderm formation by T-box genes.
Development 125,3379
-3388.[Abstract]
Gritsman, K., Zhang, J., Cheng, S., Heckscher, E., Talbot, W. S.
and Schier, A. F. (1999). The EGF-CFC protein one-eyed
pinhead is essential for Nodal signaling. Cell
97,121
-132.[CrossRef][Medline]
Hammerschmidt, M., Pelegri, F., Mullins, M. C., Kane, D. A.,
Brand, M., van Eeden, F. J., Furutani-Seiki, M., Granato, M., Haffter, P.,
Heisenberg, C. P. et al. (1996). Mutations affecting
morphogenesis during gastrulation and tail formation in the zebrafish,
Danio rerio. Development
123,143
-151.[Abstract]
Harland, R. and Gerhart, J. (1997). Formation
and function of Spemann's organizer. Annu. Rev. Cell Dev.
Biol. 13,611
-667.[CrossRef][Medline]
Hauptmann, G. and Gerster, T. (1994). Two-color
whole-mount in situ hybridization to vertebrate and Drosophila
embryos. Trends Genet.
10, 266.[CrossRef][Medline]
Hemmati-Brivanlou, A. and Melton, D. A. (1992).
A truncated activin receptor inhibits mesoderm induction and formation of
axial structures in Xenopus embryos. Nature
359,609
-614.[CrossRef][Medline]
Holley, S. A., Julich, D., Rauch, G. J., Geisler, R. and
Nusslein-Volhard, C. (2002). her1 and the notch pathway
function within the oscillator mechanism that regulates zebrafish
somitogenesis. Development
129,1175
-1183.
Hug, B., Walter V. and Grunwald, D. J. (1997).
tbx6, a Brachyury-related gene expressed by ventral mesendodermal precursors
in the zebrafish embryo. Dev. Biol.
183, 61-73.[CrossRef][Medline]
Hyde, C. E. and Old, R. W. (2000). Regulation
of the early expression of the Xenopus Nodal-related 1 gene, Xnr1.
Development 127,1221
-1229.[Abstract]
Isaacs, H. V., Pownall, M. E. and Slack, J. M. W.
(1994). eFGF regulates Xbra expression during
Xenopus gastrulation. EMBO J.
13,4469
-4481.[Medline]
Kimelman, D. and Griffin, K. J. (2000).
Vertebrate mesendoderm induction and patterning. Curr. Opin. Genet.
Dev. 10,350
-356.[CrossRef][Medline]
Kimelman, D. and Kirschner, M. (1987).
Synergistic induction of mesoderm by FGF and TGF-beta and the identification
of an mRNA coding for FGF in the early Xenopus embryo.
Cell 51,869
-877.[CrossRef][Medline]
Kofron, M., Demel, T., Xanthos, J., Lohr, J., Sun, B., Sive, H.,
Osada, S., Wright, C., Wylie, C. and Heasman, J.
(1999). Mesoderm induction in Xenopus is a zygotic event
regulated by maternal VegT via TGFß growth factors.
Development 126,5759
-5770.[Abstract]
Labonne, C. and Whitman, M. (1994). Mesoderm
induction by activin requires FGF-mediated intracellular signals.
Development 120,463
-472.[Abstract]
Labonne, C. and Whitman, M. (1997).
Localization of MAP kinase activity in early Xenopus embryos:
implications for endogenous FGF signaling. Dev. Biol.
183, 9-20.[CrossRef][Medline]
Labonne, C., Burke, B. and Whitman, M. (1995).
Role of MAP kinase in mesoderm induction and axial patterning during
Xenopus development. Development
121,1475
-1486.[Abstract]
Maroon, H., Walshe, J., Mahmood, R., Kiefer, P., Dickson, C. and
Mason, I. (2002). Fgf3 and Fgf8 are required together
for formation of the otic placode and vesicle.
Development 129,2099
-2108.
Mathieu, J., Barth, A., Rosa, F. M., Wilson, S. W. and
Peyrieras, N. (2002). Distinct and cooperative roles for
Nodal and Hedgehog signals during hypothalamic development.
Development 129,3055
-3065.
Meno, C., Gritsman, K., Ohishi, S., Ohfuji, Y., Heckscher, E.,
Mochida, K., Shimono, A., Kondoh, H., Talbot, W. S., Robertson, E. J.
et al. (1999). Mouse Lefty2 and zebrafish antivin are
feedback inhibitors of Nodal signaling during vertebrate gastrulation.
Mol. Cell 4,287
-298.[CrossRef][Medline]
Meno, C., Takeuchi, J., Sakuma, R., Koshiba-Takeuchi, K.,
Ohishi, S., Saijoh, Y., Miyazaki, J., ten Dijke, P., Ogura, T. and
Hamada, H. (2001). Diffusion of Nodal signaling activity in
the absence of the feedback inhibitor Lefty2. Dev.
Cell 1,127
-138.[CrossRef][Medline]
Mizuno, T., Yamaha, E., Wakahara, E., Kuroiwa, M. and Takeda,
H. (1996). Mesoderm induction in zebrafish.
Nature 383,131
-132.[CrossRef]
Mohammadi, M., McMahon, G., Sun, L., Tang, C., Hirth, P., Yeh,
B. K., Hubbard, S. R. and Schlessinger, J. (1997).
Structures of the tyrosine kinase domain of fibroblast growth factor receptor
in complex with inhibitors. Science
276,955
-960.
Müller, M. V., Weizsäcker, E. and Campos-Ortega, J.
A. (1996). Transcription of a zebrafish gene of the
hairy-Enhancer of split family delineates the midbrain anlage in the neural
plate. Dev. Genes Evol.
206,153
-160.[CrossRef]
Nieuwkoop, P. D. (1973). The
"organization center" of the amphibian embryo: its origin, spatial
organization and morphogenetic action. Adv.
Morphogenet. 10,1
-39.
Peyrieras, N., Strahle, U. and Rosa, F. (1998).
Conversion of zebrafish blastomeres to an endodermal fate by TGF-beta-related
signaling. Curr. Biol.
8, 783-786.[CrossRef][Medline]
Rebagliati, M. R., Toyama, R., Fricke, C., Haffter, P. and
Dawid, I. B. (1998a). Zebrafish Nodal-related genes are
implicated in axial patterning and establishing left-right asymmetry.
Dev. Biol. 199,261
-272.[CrossRef][Medline]
Rebagliati, M. R., Toyama, R., Haffter, P. and Dawid, I. B.
(1998b). cyclops encodes a Nodal-related factor involved in
midline signaling. Proc. Natl. Acad. Sci. USA
95,9932
-9937.
Reifers, F., Bohli, H., Walsh, E. C., Crossley, P. H., Stainier,
D. Y. and Brand, M. (1998). Fgf8 is mutated in
zebrafish acerebellar (ace) mutants and is required for maintenance of
midbrain-hindbrain boundary development and somitogenesis.
Development 125,2381
-2395.[Abstract]
Reissmann, E., Jornvall, H., Blokzijl, A., Andersson, O., Chang,
C., Minchiotti, G., Persico, M. G., Ibanez, C. F. and Brivanlou, A.
H. (2001). The orphan receptor ALK7 and the Activin receptor
ALK4 mediate signaling by Nodal proteins during vertebrate development.
Genes Dev. 15,2010
-2022.
Renucci, A., Lemarchandel, V. and Rosa, F.
(1996). An activated form of type I serine/threonine kinase
receptor TARAM-A reveals a specific signalling pathway involved in fish head
organiser formation. Development
122,3735
-3743.[Abstract]
Rodaway, A. and Patient, R. (2001).
Mesendoderm. an ancient germ layer? Cell
105,169
-172[CrossRef][Medline]
Rodaway, A., Takeda, H., Koshida, S., Broadbent, J., Price, B.,
Smith, J. C., Patient, R. and Holder, N. (1999).
Induction of the mesendoderm in the zebrafish germ ring by yolk cell-derived
TGF-beta family signals and discrimination of mesoderm and endoderm by FGF.
Development 126,3067
-3078.[Abstract]
Schier, A. F., Neuhauss, S. C., Helde, K. A., Talbot, W. S. and
Driever, W. (1997). The one-eyed pinhead gene functions in
mesoderm and endoderm formation in zebrafish and interacts with no tail.
Development 124,327
-342.[Abstract]
Schulte-Merker, S., Ho, R. K., Hermann, B. G. and
Nusslein-Volhart, C. (1992). The protein product of the
zebrafish homologue of the mouse T gene is expressed in nuclei of he
germ ring and the notochord of the early embryo.
Development 116,1021
-1032.[Abstract]
Schulte-Merker, S. and Smith, J. C. (1995).
Mesoderm formation in response to Brachyury requires FGF signalling.
Curr. Biol. 5,62
-67.[CrossRef][Medline]
Schulte-Merker, S., Smith, J. C. and Dale, L.
(1994). Effects of truncated activin and FGF receptors and of
follistatin on the inducing activities of BVg1 and activin: does activin play
a role in mesoderm induction? EMBO J.
13,3553
-3541.
Serbedzija, G. N., Chen, J. N. and Fishman, M. C.
(1998). Regulation in the heart field of zebrafish.
Development 125,1095
-1101.[Abstract]
Slack, J. M., Darlington, B. G., Heath, J. K. and Godsave, S.
F. (1987). Mesoderm induction in early Xenopus
embryos by heparin-binding growth factors. Nature
326,197
-200.[CrossRef][Medline]
Soriano, P. (1997). The PDGF alpha receptor is
required for neural crest cell development and for normal patterning of the
somites. Development
124,2691
-2700.[Abstract]
Sun, B. I., Bush, S. M., Collins-Racie, L. A., LaVallie, E. R.,
DiBlasio-Smith, E. A., Wolfman, N. M., McCoy, J. M. and Sive, H. L.
(1999). derriere: a TGF-beta family member required for posterior
development in Xenopus. Development
126,1467
-1482.[Abstract]
Thisse, C. and Thisse, B. (1999). Antivin, a
novel and divergent member of the TGFbeta superfamily, negatively regulates
mesoderm induction. Development
126,229
-240.[Abstract]
Thisse, C., Thisse, B., Halpern, M. E. and Postlethwait, J.
H. (1994). goosecoid expression in neurectoderm and
mesendoderm is disrupted in zebrafish cyclops gastrulas.
Dev. Biol. 164,420
-429.[CrossRef][Medline]
Tsang, M., Friesel, R., Kudoh, T. and Dawid, I. B.
(2002). Identification of Sef, a novel modulator of FGF
signalling. Nat. Cell Biol.
4, 165-169.[CrossRef][Medline]
Umbhauer, M., Marshall, C. J., Mason, C. S., Old, R. W. and
Smith, J. C. (1995). Mesoderm induction in Xenopus
caused by activation of MAP kinase. Nature
376, 58-62.[CrossRef][Medline]
van den Eijnde, S. M., Luijsterburg, A. J., Boshart, L., De
Zeeuw, C. I., van Dierendonck, J. H., Reutelingsperger, C. P. and
Vermeij-Keers, C. (1997). In situ detection of apoptosis
during embryogenesis with annexin V: from whole mount to ultrastructure.
Cytometry 29,313
-320.[CrossRef][Medline]
Weinberg, E. S., Allende, M. L., Kelly, C. S., Abdelhamid, A.,
Murakami, T., Andermann, P., Doerre, O. G., Grunwald, D. J. and
Riggleman, B. (1996). Developmental regulation of zebrafish
MyoD in wild-type, no tail and spadetail embryos.
Development 122,271
-280.[Abstract]
Whitman, M. (2001). Nodal signaling in early
vertebrate embryos: themes and variations. Dev Cell
1, 605-617.[CrossRef][Medline]
Xu, Y., He, J., Wang, X., Lim, T. M. and Gong, Z.
(2000). Asynchronous activation of 10 muscle-specific protein
(MSP) genes during zebrafish somitogenesis. Dev. Dyn.
219,201
-215.[CrossRef][Medline]
Yasuo, H. and Lemaire, P. (1999). A two-step
model for the fate determination of presumptive endodermal blastomeres in
Xenopus embryos. Curr. Biol.
9, 869-879.[CrossRef][Medline]
Zhang, J., Talbot, W. S. and Schier, A. F.
(1998). Positional cloning identifies zebrafish one-eyed pinhead
as a permissive EGF-related ligand required during gastrulation.
Cell 92,241
-251.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
D. Maurus and W. A. Harris Zic-associated holoprosencephaly: zebrafish Zic1 controls midline formation and forebrain patterning by regulating Nodal, Hedgehog, and retinoic acid signaling Genes & Dev., June 15, 2009; 23(12): 1461 - 1473. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Geske, X. Zhang, K. K. Patel, D. M. Ornitz, and T. S. Stappenbeck Fgf9 signaling regulates small intestinal elongation and mesenchymal development Development, September 1, 2008; 135(17): 2959 - 2968. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Shi and M. Levine Ephrin signaling establishes asymmetric cell fates in an endomesoderm lineage of the Ciona embryo Development, March 1, 2008; 135(5): 931 - 940. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Maegawa, M. Varga, and E. S. Weinberg FGF signaling is required for {beta}-catenin-mediated induction of the zebrafish organizer Development, August 15, 2006; 133(16): 3265 - 3276. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Holley Anterior-posterior differences in vertebrate segments: specification of trunk and tail somites in the zebrafish blastula Genes & Dev., July 15, 2006; 20(14): 1831 - 1837. [Full Text] [PDF] |
||||
![]() |
D. P. Szeto and D. Kimelman The regulation of mesodermal progenitor cell commitment to somitogenesis subdivides the zebrafish body musculature into distinct domains Genes & Dev., July 15, 2006; 20(14): 1923 - 1932. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Poulain, M. Furthauer, B. Thisse, C. Thisse, and T. Lepage Zebrafish endoderm formation is regulated by combinatorial Nodal, FGF and BMP signalling Development, June 1, 2006; 133(11): 2189 - 2200. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Vallier, M. Alexander, and R. A. Pedersen Activin/Nodal and FGF pathways cooperate to maintain pluripotency of human embryonic stem cells J. Cell Sci., October 1, 2005; 118(19): 4495 - 4509. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Thorpe, G. Weidinger, and R. T. Moon Wnt/{beta}-catenin regulation of the Sp1-related transcription factor sp5l promotes tail development in zebrafish Development, April 15, 2005; 132(8): 1763 - 1772. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||