|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 7 January 2004
doi: 10.1242/dev.00955
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


Department of Biological Sciences and The NSF Science and Technology Center for Light Microscope Imaging and Biotechnology, Carnegie Mellon University, Pittsburgh, PA 15213, USA
Author for correspondence (e-mail:
minden{at}cmu.edu)
Accepted 30 October 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Drosophila, Gastrulation, Ventral furrow formation, Proteomics
| Introduction |
|---|
|
|
|---|
Ventral furrow cells are specified by a signaling cascade that activates
the ubiquitously distributed transmembrane receptor protein, Toll on the
ventral side of the embryo (Thisse et al.,
1988
). Toll signaling results in the dissociation of the
cytoplasmic heterodimer of Dorsal and Cactus, which are homologs of NF
B
and I
B, respectively. Free Dorsal, which is a member of the rel family
of transcription factors, migrates into the nucleus where it activates the
transcription of twist (twi), which encodes a basic
helix-loop-helix protein (Boulay et al.,
1987
). Twist and Dorsal act cooperatively to activate the
transcription of snail (sna), which encodes a zinc-finger
transcriptional regulator
(González-Crespo and Levine,
1993
; Leptin and Grunewald,
1990
; Leptin,
1991
). Embryos mutant in twi or sna fail to form
proper ventral furrows (St. Johnston and
Nüsslein-Volhard, 1992
). twi mutant embryos are
capable of eventually forming a shallow, narrow furrow. Transverse sections of
twi embryos show that the ventral cells release their nuclei, but
fail to constrict their apical membranes and shorten. sna mutant
embryos form a weaker furrow that is very shallow and wavy. The ventral cells
of sna embryos fail to release their nuclei from the apical surface,
which appears to inhibit apical constriction, but they are capable of cell
shortening. Embryos doubly mutant for twi and sna fail to
form a ventral furrow of any kind. Thus it appears that twi and
sna control separate processes and these processes occur
independently.
Two other genes known to be required for proper furrow formation are
folded gastrulation and concertina
(Costa et al., 1994
;
Parks and Wieschaus, 1991
).
Embryos mutant for either gene form a ventral furrow, but in an uncoordinated
and delayed fashion. folded gastrulation and concertina are
also essential for posterior-midgut invagination. Concertina is a maternally
supplied G
homologue that is uniformly distributed throughout the
embryo, while folded gastrulation encodes a novel secreted protein
that is expressed zygotically in a ventral pattern. It is thought that these
proteins are part of a signaling pathway that is required for the coordination
of the ventral furrow cell shape changes. A germline mutant screen identified
a role for DRhoGEF2 in ventral furrow formation
(Chou and Perrimon, 1996
;
Perrimon et al., 1996
).
DRhoGEF stimulates the small GTPase, Rho, to exchange its bound GDP for GTP,
thereby activating Rho. A dominant negative form of Rho also produces ventral
furrow defects. In tissue culture cells, Rho has been shown to stimulate
stress fiber formation (Hall,
1998
). These results indicate that the actin cytoskeleton is
involved in ventral furrow formation. However, the precise role of Rho and
RhoGEF in ventral furrow morphogenesis is still unknown.
Ventral furrow morphogenesis is a complex process that encompasses many
different cellular functions, such as: signal transduction, transcriptional
regulation and cytoskeletal rearrangements. Recently, mutations in
tribbles and frühstart, were found to have ventral
furrow defects because the ventral cells entered mitosis prematurely
(Mata et al., 2000
;
Grosshans and Wieschaus, 2000
;
Seher and Leptin, 2000
). Thus,
cell cycle control is also part of the cellular processes that distinguish
ventral cells from their neighbors.
We have taken a comparative proteomics approach to identify additional
proteins that make ventral furrow cells different from adjacent lateral cells.
There are several thousand protein species in Drosophila embryonic
cells (Santaren, 1990
). We
presume that the vast majority of proteins are common to both ventral and
lateral cells and that the difference between these cells lies in a relatively
small number of proteins that are either differentially expressed or modified,
which we call difference-proteins. To characterize this small population of
difference-proteins, we have used difference gel electrophoresis [DIGE
(Ünlü et al., 1997
)]
to compare the proteomes of genetically ventralized and lateralized embryos,
where most cells in these embryos behave as if they are ventral or lateral
cells, respectively. More than 50 difference-proteins were detected. These
difference-proteins appeared as the result of increased or decreased abundance
and isoform changes resulting from differences in alternative splicing or
post-translational modification. Many of these difference-proteins have been
identified by mass spectrometry. Seven of the difference-proteins were knocked
down by RNAi and all cause ventral furrow defects.
| Materials and methods |
|---|
|
|
|---|
Embryos were collected on yeasted, apple-juice agar plates over periods of
1-2 hours as described previously (Minden
et al., 2000
). The embryos were viewed with a dissecting
microscope (Wild) using transmitted-light illumination and staged according to
Campos-Ortega and Hartenstein (Campos-Ortega and Hartenstein, 1985). Embryos
at the desired stage were removed, washed with ethanol, frozen in dry ice and
stored at 80°C. Three developmental stages were collected:
precellularization (PC) nuclear cycle 11-13, which is 70-100 minutes prior to
gastrulation), early gastrulation (EG) 0-10 minutes from the start of
gastrulation, and late gastrulation (LG) 10-20 minutes from the start of
gastrulation. The start of gastrulation was noted as the first appearance of
the cephalic furrow in lateralized embryos and when the basal margin of the
cells of ventralized embryos became irregular. For master gel comparisons,
embryos were collected for 2 hours and aged for 2 hours at 25°C such that
the embryos spanned all three developmental stages from PC to LG.
Difference gel electrophoresis (DIGE)
Typical DIGE gels contained 100 µg of protein for each sample, which is
equivalent to about 100 embryos. Protein samples were prepared by pooling the
embryos in ethanol into one tube. All transfers were done on dry ice to
prevent the embryos from warming above the freezing point. Once sufficient
embryos were amassed, they were transferred to a 1.5 ml centrifuge tube that
had a fitted plastic pestle, the ethanol was removed and lysis buffer (7 M
urea, 2 M thiourea, 4% CHAPS, 10 mM DTT and 10 mM Na-Hepes pH 8.0) was added
to 0.5 µl of lysis buffer per embryo, with a maximum of 200 µl per tube.
The tube was then transferred to an ice bath and the embryos were homogenized
manually with the fitted pestle. This typically yielded a 2 mg/ml protein
solution. The protein solutions were labeled with 1 µl of either
propyl-Cy3-NHS or methyl-Cy5-NHS referred to as Cy3 and Cy5,
respectively (CyDye DIGE Fluors; Amersham Biosciences) as described previously
(Ünlü et al., 1997
).
Isoelectric focusing was carried out on 13 cm, pH 3-10 non-linear Immobiline
strips according to the manufacturer's protocol (Amersham Biosciences). The
strips were electrophoresed on an IPGphor apparatus (Amersham Biosciences) for
a total of 60-70 kVxhours. After isoelectric focusing, the strips were
first equilibrated in a reducing solution containing 2% SDS, 10 mM DTT for 15
minutes at room temperature with gentle swirling and then equilibrated in an
alkylating solution containing 2% SDS, 25 mM iodoacetamide and bromophenol
blue. The strips were then either immediately loaded on 10-15%
SDS-polyacrylamide gradient gels or stored at 80°C. Second
dimension electrophoresis was performed at 4°C at a constant current of
10-25 mA per gel.
Gel imaging, image analysis and protein excision
After two-dimensional gel electrophoresis, the gels were removed from the
glass plates and fixed in a solution of 40% methanol and 1% acetic acid. Gels
were placed in a home-built gel imaging device with an integral gel cutting
tool and imaged at two excitation wavelengths (545±10 nm for Cy3 and
635±15 nm for Cy5) using a cooled CCD camera with a 16-bit CCD chip
(Roper Scientific). Two separate images for Cy3- and Cy5-labeled proteins were
acquired and viewed as a two-frame movie played in a continuous loop. Image
manipulation and viewing was done with IPLab Spectrum (Signal Analysis Corp.)
and Quicktime (Apple Computer, Inc.) software. Protein differences were
detected visually and quantified using an astronomical image analysis software
package, SExtractor (Bertin and Arnouts,
1996
).
To determine the fold-difference between ventral and lateral expression of a protein, the image fragments were summed to generate a composite image. This summed image was then submitted to SExtractor, which detected the protein spots and created a measurement mask to be applied to the two original image fragments. The mask outlined an area of the gel that contained a protein spot. This was used to define the area in which the pixel values were integrated. The SExtractor program also performed a localized background estimation to determine the base values across the mask area. The output from the image analysis was the sum of pixel values in the mask area less the background sum, which will be referred to as the fluorescence intensity.
Since the overall fluorescence ratio between the dye-labeled proteins is not unity because of the different extinction coefficients of Cy3 and Cy5 and variation in sample labeling and loading, a normalization factor was determined by averaging the intensity of a set of eight constant regions, which contained a total of 21 protein spots. To aid in balancing the display contrast of the Cy3 and Cy5 images, 1 µg of BSA was added to each protein sample prior to labeling (Fig. 2). The measured intensity ratio for the BSA spots was within one standard deviation (±10%) of the normalization factor.
|
Protein identification
MS fingerprint analysis was performed on a PerSeptive Biosystems Voyager
STR MALDI-TOF instrument operating in the positive ion mode. The range
observed was set to 500 3000 m/e with 750-1000 scans per spectrum.
Each spectrum was processed using Data Explorer (Applied Biosystems).
Post-acquistion calibration was performed using the trypsin autolysis products
(MH+ 842.51 and 2211.10) in addition to an added standard
(Glu-fibrinogen peptide, 1570.68). Protein identification was done using
MASCOT online software
[www.matrixscience.com
(Perkins et al., 1999
)].
Embryo injection and microscopy
Embryos were collected at stage 3 and prepared for micro-injection and
time-lapse, fluorescence microscopy as previously described
(Minden et al., 2000
).
Time-lapse microscopy was performed using a Delta Vision microscope system
controlled by softWoRx software (Applied Precision, Issaquah, WA) configured
around an Olympus IX70 inverted microscope. Time-lapse recordings consisted of
5 optical sections, spaced 2 µm apart, taken at 2 minute intervals over a
period of 4 hours. Each image stack was then projected into a single plane and
viewed as a time-lapse series of images. Lactacystin was injected as a 5 mM
solution in 10% DMF.
dsRNA was synthesized from the following DNA clones (the amplified segments
are shown in parentheses, all DNAs were obtained from Research Genetics): twi,
BAC clone RPC1-98-8.P.9 (407-1104); sna, BAC clone RPC1-98-23.I.4 (716-1410);
pros35, cDNA clone AT04245 (105-598); pros25, cDNA clone RE22680 (5-533);
CG17331, cDNA clone GM03626 (7-684); pros29, cDNA clone RE23862 (15-531); bel,
cDNA clone RE28061 (11-5720); sqd, cDNA clone LD09691 (104-682); eIF-4e, cDNA
clone SD05406 (62-652) and CG3210, cDNA clone GM01975 (13-515). PCR was
carried out using primers that contained a T7 promoter sequence on their
5' ends (TAATACGACTCACTATAGGGAGACCAC). RNA was synthesized using the
MEGAscript kit (Ambion) following the manufacturer's instructions. The RNA
products were treated with DNaseI for 15 minutes at 37°C and annealed at
65°C for 30 minutes and then allowed to cool slowly at room temperature.
The dsRNA was dissolved in injection buffer
(Rubin and Spradling, 1982
) to
a final concentration of not more than 2.5 µM. RT-PCR of dsRNA-injected
embryos was performed to confirm the loss of the targeted mRNA.
| Results and discussion |
|---|
|
|
|---|
To compare the proteomes of ventralized and lateralized embryos, we used DIGE, which is a rapid and sensitive two-dimensional electrophoresis (2DE) method (Fig. 1A). DIGE works as follows. Lysine residues of proteins from whole-embryo homogenates were covalently labeled with either propyl-Cy3 or methyl-Cy5 (referred to as Cy3 and Cy5, respectively). The DIGE dyes were designed to have minimal effect on protein migration during electrophoresis. The Cy3- and Cy5-labeled protein samples were combined and run on the same 2DE gel. After electrophoresis, fluorescence imaging of the 2DE gel with Cy3 and Cy5 excitation light generated two images of the two protein samples in perfect register. Proteins that are common to both samples appear as spots composed of both fluorescent dye molecules. Proteins that are more abundant in one or the other sample appear as spots composed of more of one of the dyes than the other. DIGE is a very sensitive method that can detect as little as 1 fmole of protein and protein differences as low as ±1.2-fold, which is greater than two standard deviations.
|
To display the full spectrum of protein differences observed in the specific comparisons, master DIGE gels comparing ventralized to lateralized embryos from 2-hour collections spanning all three stages from PC to LG were generated (Fig. 2). Many of the protein changes appeared as protein spots whose abundance varied reciprocally; one protein increased in abundance, while a nearby spot decreased. These reciprocal changes were most probably due to isoform differences resulting from changes in post-translational modification or alternative splicing. To display this phenomenon, difference-proteins are shown as boxed regions that contain multiple protein spots with arrows indicating the proteins that changed. A total of 57 regions are indicated in Fig. 2. The vast majority of the protein changes (55/57 difference regions) were found to be ventrolateral-specific and temporal-independent. Two regions contained proteins that changed in a temporal-specific fashion (Fig. 2, regions T1 and T2). These temporal-specific changes were ventrolateral-independent. Only one region was found to contain a protein that changed in both a ventrolateral- and temporal-specific manner (Fig. 2, region 41). Also shown on the master DIGE gel are: enolase, which was used to determine the relative fluorescent signal of the difference-proteins, BSA, which was added to each labeling reaction as a loading control, and MAPKK, which was used to demonstrate that relatively low abundance proteins are detectable and identifiable on DIGE gels. The two large, dark protein masses are, as indicated, yolk protein clusters.
To view the individual difference-regions more closely, pairs of image sub-fragments showing the ventral and lateral proteins were contrast enhanced and matched (Table 1). These image fragments contained unchanging and changing proteins (difference-proteins are indicated by arrows). In all, 105 difference-proteins were detected from a total of 1315 proteins detected in the master DIGE gel shown in Fig. 2. Of the 105 difference-protein spots, 65 were identified by MS (Tables 1 and 2). The remainder of unidentified protein spots produced insufficient MS spectra because of their low abundance. As mentioned previously, many of the difference-proteins appeared to be isoform changes. This was verified by MS. Thus, a total of 37 unique difference-proteins were identified from the 65 initially identified protein differences. Almost half (18/37) of these difference-proteins appeared to be the result of differential, post-translation modification, while the others appeared to be changes in protein abundance. However, a number of the abundance changes have reciprocally changing neighboring spots that could not be identified by MS. Thus, the ratio of isoform-changes to abundance-changes may be closer to two-thirds. These data indicate that isoform changes appear to play a major role in generating ventrolateral differences. The nature of these changes will be discussed later.
|
|
Protein difference quantification
To reliably compare different proteomes, it is essential to measure protein
abundance accurately. Digital imaging of fluorescently tagged proteins
provides a very high level of accuracy. The fluorescent gel imager used for
these studies employed a scientific-grade, cooled CCD camera with a 16-bit CCD
chip, which is capable of linearly detecting light over more than four orders
of magnitude. The scientific discipline most accustomed to using similar CCD
cameras for quantitative image analysis is astronomy. Since at the start of
this endeavor there were no commercially available proteomics-oriented gel
image analysis software packages capable of dealing with 16-bit images of
fluorescently labeled proteins, we adapted an astronomical image analysis
package, Source Extractor (referred to as SExtractor), to measure the
fluorescence intensity of the protein spots
(Bertin and Arnouts, 1996
).
Our primary goal for image quantitation was to determine the ratio of ventrally derived proteins relative to laterally derived proteins and to estimate the relative cellular abundance of the difference-proteins. The ratio between a ventral and lateral protein is expressed as fold-difference, where a positive value indicates an excess of ventral protein over lateral protein; a negative value indicates the inverse ratio. Table 1 lists the fold-change for the detected difference-proteins. Over 80% of the difference-proteins could be quantified; the remainder were not detected by the software because of low signal or unresolvable protein spots that were too close to very abundant protein spots. The number of increasing proteins was roughly equal to the decreasing proteins (40:43). These data demonstrate that the vast majority of differences between ventral and lateral cells occur prior to ventral furrow formation. There was no bias in the direction of protein change and only a minority represented absolute on/off changes.
The fluorescent gel imager has a linear detection range of over
10,000-fold. To demonstrate the concentration range of difference-proteins
detected, the intensity of the most abundant difference-protein per region was
calculated relative to enolase, which is a high abundance, constant protein
(Table 1). The
difference-proteins occurred over a wide concentration range from
4x103 (region 9) to 0.4 (region 23) of the enolase
signal. It is not possible to provide an absolute measure of protein abundance
since we do not know the exact correlation between fluorescence signal and the
amount of a particular protein. These values should be considered as estimates
since the exact stoichiometry of labeling may vary slightly from protein to
protein. This small variation in individual protein labeling characteristics
does not lead to variability in difference detection as evidenced by earlier
experiments (Ünlü et al.,
1997
; Tonge et al.,
2001
).
Classes of difference-proteins
As stated above, there are two general classes of protein changes:
abundance and isoform changes. Abundance changes can be the result of changes
in the rate of synthesis or rate of degradation. Isoform changes may be due to
alternative splicing or post-translational modification. Post-translational
modification generally alters the isoelectric point of a protein (pI).
Phosphorylation, myristylation and methylation make proteins more acidic,
causing a leftward shift on 2DE gels; esterification makes proteins more
basic, causing a rightward shift. Some modifications, such as glycosylation
and prenylation, alter the molecular weight of proteins. Proteolysis can
change both the pI and molecular mass of a protein. We have seen examples of
shifts in protein location in all possible directions. MS analysis for some
proteins, such as pyruvate caboxylase (regions 10 and 11), NADH-ubiquinone
reductase (region 16) and leukotriene-A4 hydrolase (region 23), indicated
differential phosphorylation. Larger quantities of these proteins will be
required to precisely determine the nature of their phosphorylation
differences. Some proteins exhibited complex changes. Leukotriene-A4 hydrolase
(region 23) and asparagine tRNA synthetase (regions 25 and 26) were detected
as three isoforms with the central isoform increasing at the expense of the
flanking isoforms. This behavior suggests that these proteins are undergoing
multiple molecular changes. These results show that isoform changes are likely
to play a significant role in ventrolateral specification since over half of
all differences are isoform changes.
Temporal-specific protein changes
The vast majority of protein changes appeared in all ventrolateral
comparisons regardless of the developmental stage. There were, however, three
regions that contained proteins that changed between pre-cellularization and
early gastrulation and remained constant over late gastrulation
(Fig. 2, 41b, T1 and T2
regions, and Fig. 3). The
protein changes in two of these regions (T1 and T2) appeared to be independent
of ventral or lateral specification; while the third region (41b) contained a
protein that changed both temporally and spatially.
|
Two temporal-specific changes were found in the T2 region. T2a increased
upon gastrulation, while T2b decreased. Both experienced greater than
threefold changes that did not show any ventrolateral specificity. T2a was
identified as Squid, a protein required for mRNA localization. Squid was
originally discovered as an RNA-binding protein required for dorsoventral axis
formation (Kelly, 1993; Matunis et al.,
1994
). T2b was identified as eIF-4E, which binds directly to the
mRNA 5'-cap and has been shown to accumulate in the mesoderm
(Hernández et al.,
1997
). The role of four of these time-dependant proteins in
ventral furrow formation was investigated further and is shown in a subsequent
section.
The only difference-protein to show both ventrolateral and temporal
specificity was region 41b, which was identified as PROS35, an
1
proteasome subunit. Previous analysis of PROS35 showed that it accumulates in
the ventral furrow (Haass et al.,
1989
). Unfortunately, the antibody used in these studies has since
been lost. The PROS35 difference-protein spot was located just to the left of
a moderately abundant, unchanging protein that was also identified as PROS35.
These two proteins spot were so closely associated in the master gel that they
could not be resolved by SExtractor (Fig.
2, region 41). The nature of the acidic shift of PROS35 is not
known. The limited number of temporal-specific changes indicates that our
original hypothesis regarding the mechanics of ventral formation needs to be
re-examined.
Synopsis of difference-proteins
One of the main reasons for using a proteomics approach to analyze ventral
furrow morphogenesis was to identify new proteins involved in this complex
process. The MS-identified difference-proteins fell into several distinct
categories, which are lists in Table
2. The two most highly represented groups of proteins were
metabolic enzymes and proteases, with ten and eight candidates, respectively.
A preponderance (7 of 10) of the metabolic enzymes are involved in redox
reactions, many of which utilize NAD or flavin co-factors. This may indicate
that ventral and lateral cells have different energy requirements and
different metabolic or oxidative states.
Further indication of the different metabolic states of ventral and lateral cells is the changing levels of two iron-carrying proteins: transferrin 1 (Tsf1), and ferritin 2 light chain homolog, FER2LCH, both of which are reduced in ventral cells. The majority of cellular iron is found in the mitochondria where it is required for redox reactions. Differences in iron-transport proteins and several mitochondrial proteins involved in redox reactions suggest clear metabolic differences between ventral and lateral cells.
Proteases make up the second largest group of difference-proteins, with eight members. Three are proteasome subunits and two are ubiquitin hydrolases showing that proteasome-dependent degradation may play a role in ventral furrow formation. The remaining three are involved in modifying amino termini, which may also affect protein stability. All three of the proteasome subunit changes appear to be isoform changes. It is not possible to determine the functional state or capabilities of the different isoforms without further biochemical analysis. Additional rounds of DIGE and other biochemical experiments will be required to determine the substrates for these proteases and their ultimate role in ventral furrow formation. Further analysis of the role of the proteasome is presented in the following section.
Cell shape changes most probably involve cytoskeletal changes. Three of the
difference-proteins are known to interact with the cytoskeleton. Cofilin,
which is decreasing in ventral cells, is a well-known actin binding protein
required for destabilizing the cortical actin network
(Svitkina and Borisy, 1999
).
Hsp23 has been shown to have an actin binding homology domain
(Goldstein and Gunawardena,
2000
). CG18190 appears to interact with actin filaments through a
calponin homology domain (Korenbaum and
Rivero, 2002
) and with microtubules through an EB1 domain
(Tirnauer and Bierer,
2000
).
In addition to the cytoskeletal associated proteins, we detected a change
in a member of the T-complex chaperonin, CG5525, which is a homologue of CCT4.
The T-complex chaperonin is involved in folding newly synthesized
- and
ß-tubulin and actin. This may indicate different actin and tubulin
turnover rates in ventral and lateral cells. The levels of actin and tubulin
appear to be constant. It is reasonable to expect the turnover rate of
cytoskeletal proteins to change during cell shape modulation. Perhaps the
cyto-architecture is being altered by coupling local proteolysis to the
synthesis of new cytoskeletal elements elsewhere in the cell.
Three of the difference-proteins were tRNA synthetases (RS): tyr-RS, gly-RS
and asn-RS, all three RS differences were seen as isoform changes. RSs are
generally thought of as housekeeping genes. However, the expression of
specific RSs appears to be developmentally regulated in a tissue-specific
manner in Drosophila embryos
(Seshaiah and Andrews, 1999
).
During mammalian apoptosis, tyr-RS has been shown to be cleaved to generate
two different cytokines (Wakasugi and
Schimmel, 1999
). Further experiments are required to test if
tyr-RS is acting as a cytokine during ventral furrow formation.
In addition to cytoskeletal changes, one might expect membrane changes
during ventral furrow formation. Three of the difference-proteins are
associated with membrane changes. Leukotriene-A4 hydrolase functions in
leukotriene B4 biosynthesis from arachadonic acid. Leukotrienes are known to
stimulate cell migration during inflammation
(Ford-Hutchinson, 1990
). The
phosphatidylinositol transporter, Vibrator (Vib), was seen as two, vertical
spots that were shifted upward in molecular mass in ventral cells
(Table 1, spot 44). Vib has
been implicated in both actin-based processes and signal transduction and is
used repeatedly throughout development
(Spana and Perrimon, 1999
).
The third membrane-associated difference-protein is CG3210, a dynamin-like
protein that shows a temporal-specific, isoform change. Dynamin is a GTPase
involved in the pinching off of membrane vesicles. Dynamin-like proteins have
also been implicated in mitochondrial membrane fusion and plant cell
cytokinesis and polarity (McQuibban et
al., 2003
; Kang et al.,
2003
). Clearly, vib and CG3210 will require
further investigation to determine their link to ventral furrow formation.
Validating the role of the proteasome in ventral furrow morphogenesis
Three of the ventrolateral-specific changes were in proteasome subunits. To
explore the role of these proteins in ventral furrow formation, the proteasome
was inhibited by drug treatment and RNA interference. Ventral furrow formation
was monitored by time-lapse, fluorescence microscopy of embryos ubiquitously
expressing nuclear localized GFP (Ubi-GFP.nls). In wild-type embryos,
ventral cells invaginate rapidly; the furrow was visible within 4 minutes of
the end of cellularization and completed about 12 minutes later
(Fig. 4, column A). Injection
of the proteasome inhibitor, lactacystin, into syncytial-stage embryos caused
a pronounced delay in ventral furrow formation. A modest furrow first appeared
20 minutes after the end of cellularization and was completed 80 minutes later
(Fig. 4, column B). To gauge
the lactacystin effect, RNAi against twi and sna was done.
twi and sna are transcription factors that cause ventral
furrow defects when mutated. Embryos that are mutant for both twi and
sna completely fail to form a ventral furrow. Injection of dsRNA
against both twi and sna caused a range of defects from
mild, with delayed furrow formation, (Fig.
4, column C) to severe, with a complete inhibition of furrow
formation (Fig. 4, column D).
The lactacystin-injected embryo shown in
Fig. 4 suffered a mild ventral
furrow defect. The distribution of mild to severe ventral furrow defects is
plotted in Fig. 5. The overall
percentage of defects was similar for twi and sna RNAi alone
or in combination. The main difference was that twi and sna
together had a slightly higher fraction of severe defects. Lactacystin was not
as potent as the twi + sna RNAi.
|
|
Validating the role of time-dependent difference proteins in ventral furrow morphogenesis
Four temporal-specific difference proteins were chosen as targets for RNAi
in an attempt to elucidate their roles in ventral furrow formation. dsRNA was
synthesized against belle (bel), squid (sqd),
eIF-4e and CG3210 and injected into syncytial-stage embryos. Reducing
the levels of all these proteins led to defects in ventral furrow
morphogenesis, albeit showing different levels of severity
(Fig. 5). Inhibiting
bel resulted in low levels of ventral furrow defects; this can be
attributed to the small change in levels of Bel at gastrulation. Inhibition of
all the other genes led to ventral furrow defects similar to those seen
before. As before, mock injections performed with only buffer resulted in
extremely low levels of defects. It is interesting to note that even though
there were fewer temporal-specific changes seen than expected, all
time-dependent proteins tested seem to play an important role in some aspect
of ventral furrow formation, since reducing their levels in embryos leads to
defects in ventral furrow morphogenesis. It remains to be determined why the
timing of appearance of these proteins is critical in controlling changes
associated with ventral furrow formation.
Concluding remarks
It is curious that the majority of ventrolateral-specific changes are stage
independent and that all but one of the temporal-specific changes are
ventrolateral independent. Only PROS35 was found to be both ventrolateral- and
temporal-specific for ventral furrow formation. Our findings indicate that the
ventral side of the embryo is primed for the cell shape changes associated
with ventral furrow morphogenesis during the syncytial blastoderm stage.
Initially, we had anticipated that most of the protein changes would coincide
with ventral furrow formation. It is possible that such a class of proteins
might either not be resolved by 2DE or be below the detection level of the
fluorescence imager. Our results show that of the ventrolateral-specific
differences, there was a 32:1 ratio of temporal-independent to
temporal-dependent protein changes. Increasing the resolution and sensitivity
of 2DE is not likely to alter this ratio radically. It is reasonable to assume
that most of the protein differences that specify ventral cells occur well
before gastrulation. It is well established that the dorsoventral signaling
components are activated during the syncytial blastoderm stage. Dorsal is
nuclear localized as early as nuclear cycle 10
(Steward, 1989
;
Roth et al., 1989
); nuclear
Twist is also evident by nuclear cycle 13
(Thisse et al., 1988
). There
are limits to DIGE protein detection and MS identification of proteins
isolated from 2DE gels. Neither Twist nor Snail has been identified in the
ventrolateral comparisons. These are low abundance, transcription factors that
are difficult to accumulate in sufficient amounts for MS identification. Over
half of the difference-proteins represent isoform changes. The only class of
modifying enzymes identified were proteases; no kinases were identified as
difference-proteins. Further biochemical characterization of the isoform
differences will provide clues to the identity of the modifying proteins.
Two previous studies of transcript differences between ventralized and
lateralized embryos revealed a number of ventral-specific transcripts [nine
novel ventral genes (Casal and Leptin,
1996
); 19 novel ventral genes
(Stathopoulos et al., 2002
)].
None of these gene products were identified in this proteome analysis. It
could be argued that the abundance of the differentially expressed gene
products was too low for MS identification. Several studies have demonstrated
that there is no direct correlation between transcript level and protein level
(Anderson and Seilhamer, 1997
;
Gygi et al., 1999
). One of the
most highly changing transcripts was found to be actin57B, which is a major
cytoskeletal component in the embryo
(Stathopoulos et al., 2002
).
Actin is a highly abundant, well resolved protein on 2DE gels. We did not
observe any changes in actin abundance in the ventrolateral comparisons. The
reason for this discrepancy is not clear. Perhaps the gene is transcribed, but
not translated or there is increased protein turnover holding the actin level
at a steady state. Understanding the relationship between mRNA and protein
levels will surely provide additional insight into this process.
What, then, triggers the formation of the ventral furrow? We propose that the ventral cells are primed to change shape at the completion of cellularization. Prior to basal closure at the end of cellularization, the ventral cytoskeletal components are poised to perform the apical constriction, but the gross morphological changes cannot occur without individual cells. Upon completion of cellularization, the cytoskeleton is able to deform the surface of the newly formed ventral cells, precipitating ventral furrow morphogenesis. It would be interesting to block cellularization without perturbing the hexagonal arrangement of nuclei and determine if ventral furrow formation is also blocked. The four temporal-specific difference-proteins that have no ventrolateral-specificity, may provide insight into the process of cellularization. Clearly there is much more work to be done. Comparative proteomics should be viewed as a starting point in an investigative cycle that, with other experimental manipulations, can help to uncover the network of functions and interactions required for a variety of developmental process. Our studies have shown that in addition to cell signaling, transcriptional regulation, cytoskeletal changes and cell cycle regulation, ventral furrow morphogenesis also involves translational control, protein degradation, membrane alterations and metabolic changes, demonstrating that morphogenesis is a complex process that encompasses nearly all cellular processes.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Present address: Millennium Pharmaceuticals, Cambridge, MA 02319, USA ![]()
| REFERENCES |
|---|
|
|
|---|
Anderson, L. and Seilhamer, J. (1997). A comparison of selected mRNA and protein abundances in human liver. Electrophoresis 18,533 -537.[CrossRef][Medline]
Bertin, E. and Arnouts, S. (1996). SExtractor: software for source extraction. Astronomy and Astrophysics 117,393 -404.
Boulay, J. L., Dennefeld, C. and Alberga, A. (1987). The Drosophila developmental gene snail encodes a protein with nucleic acid binding fingers. Nature 330,395 -398.[CrossRef][Medline]
Campus-Ortega, J. A. and Hartenstein, V. (1985). Stages of Drosophila embryogenesis. InThe Embryonic Development of Drosophila melanogaster , pp. 9-84. Berlin: Springer-Verlag.
Casal, J. and Leptin, M. (1996). Identification
of novel genes in Drosophila reveals the complex regulation of early
gene activity in the mesoderm. Proc. Natl. Acad. Sci.
USA 93,10327
-10332.
Chou, T. B. and Perrimon, N. (1996). The Autosomal FLP-DFS technique for generating germline mosaics in Drosophila melanogaster. Genetics 144,1673 -1679.[Abstract]
Costa, M., Sweeton, D. and Wieschaus, E. (1993). Gastrulation in Drosophila: cellular mechanisms of morphogenetic movements. In The Development of Drosophila melanogaster (ed. M. Bate and A. Martinez Arias), pp.425 -465. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press.
Costa, M., Wilson, E. T. and Wieschaus, E. (1994). A putative cell signal encoded by the folded gastrulation gene coordinates cell shape changes during Drosophila gastrulation. Cell 76,1075 -1089.[CrossRef][Medline]
Ferguson, E. L. and Anderson, K. V. (1992). decapentaplegic acts as a morphogen to organize dorsal-ventral pattern in the Drosophila embryo. Cell 71,451 -461.[CrossRef][Medline]
Ford-Hutchinson, A. W. (1990). Leukotriene B4 in inflammation. Crit. Rev. Immunol. 10, 1,1 -12.[Medline]
Goldstein, L. S. and Gunawardena, S. (2000). Flying through the Drosophila cytoskeletal genome. J. Cell Biol. 150,F63 -F68.
González-Crespo, S. and Levine, M.
(1993). Interactions between DORSAL and helix-loop-helix proteins
initiate the differentiation of the embryonic mesoderm and neuroectoderm in
Drosophila. Genes Dev.
7,1703
-1713.
Grosshans, J. and Wieschaus, E. (2000). A genetic link between morphogenesis and cell division during formation of the ventral furrow in Drosophila. Cell 101,523 -531.[CrossRef][Medline]
Gygi, S. P., Rochon, Y., Franza, B. R. and Aebersold, R.
(1999). Correlation between protein and mRNA abundance in yeast.
Mol. Cell. Biol. 19,1720
-1730.
Haass, C., Pesold-Hurt, B., Multhaup, G., Beyreuther, K. and Kloetzel, P. M. (1989). The PROS-35 gene encodes the 35 kd protein subunit of Drosophila melanogaster proteasome. EMBO J. 8,2373 -2379.[Medline]
Hall, A. (1998). Rho GTPases and the actin
cytoskeleton. Science
279,509
-514.
Hernández, G., Diez del Corral, R., Santoyo, J., Campuzano, S. and Sierra, J. M. (1997). Localization, structure and expression of the gene for translation initiation factor eIF-4E from Drosophila melanogaster. Mol. Gen. Genet. 253,624 -633.[CrossRef][Medline]
Kam, Z., Minden, J. S., Agard, D. A., Sedat, J. W. and Leptin, M. (1991). Drosophila gastrulation: analysis of cell shape changes in living embryos by three-dimensional fluorescence microscopy. Development 112,365 -370.[Abstract]
Kang, B. H., Busse, J. S. and Bednarek, S. Y.
(2003). Members of the Arabidopsis dynamin-like gene family,
ADL1, are essential for plant cytokinesis and polarized cell growth.
Plant Cell 15,899
-913.
Kelley, R. L. (1993). Initial organization of
the Drosophila dorsoventral axis depends on an RNA-binding protein
encoded by the squid gene. Genes Dev.
7, 948-960.
Korenbaum, E. and Rivero, F. (2002). Calponin
homology domains at a glance. J. Cell Sci.
115,3543
-3545.
Lasko, P. (2000). The Drosophila
melanogaster genome: translation factors and RNA binding proteins.
J. Cell Biol. 150,F51
-F56.
Leptin, M. (1991). TWIST and SNAIL as positive
and negative regulators during Drosophila mesoderm development.
Genes Dev. 5,1568
-1576.
Leptin, M. and Grunewald, B. (1990). Cell shape changes during gastrulation in Drosophila. Development 110, 73-84.[Abstract]
Mata, J., Curado, S., Ephrussi, A. and Rorth, P. (2000). Tribbles coordinates mitosis and morphogenesis in Drosophila by regulating string/CDC25 proteolysis. Cell 101,511 -522.[CrossRef][Medline]
Matunis, E. L., Kelley, R. and Dreyfuss, G.
(1994). Essential role for a heterogeneous nuclear
ribonucleoprotein (hnRNP) in oogenesis: hrp40 is absent from the germ line in
the dorsoventral mutant squid. Proc. Natl. Acad. Sci.
USA 91,2781
-2784.
McQuibban, G. A., Saurya, S. and Freeman, M. (2003). Mitochondrial membrane remodeling regulated by a conserved rhomboid protease. Nature 423,537 -541.[CrossRef][Medline]
Minden, J. S., Namba, R. and Cambridge, S. (2000). Photoactivated gene expression for cell-fate mapping and cell manipulation. In Drosophila protocols (ed. W. Sullivan, M. Ashburner and R. S. Hawley), pp 413-427. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press.
Parks, S. and Wieschaus, E. (1991). The
Drosophila gastrulation gene concertina encodes a
G
-like protein. Cell
64,447
-458.[CrossRef][Medline]
Perkins, D. N., Pappin, D. J., Creasy, D. M. and Cottrell, J. S. (1999). Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis 20,3551 -3567.[CrossRef][Medline]
Perrimon, N., Lanjuin, A., Arnold, C. and Noll, E. (1996). Zygotic lethal mutations with maternal effect phenotypes in Drosophila melanogaster. ii. Loci on the second and third chromosomes identified by P-element-induced mutations. Genetics 144,1681 -1692.[Abstract]
Preckel, T., Fung-Leung, W. P., Cai, Z., Vitiello, A.,
Salter-Cid, L., Winqvist, O., Wolfe, T. G., Von Herrath, M., Angulo, A.,
Ghazal, P. et al. (1999). Impaired immunoproteasome assembly
and immune responses in PA28/ mice.
Science 286,2162
-2165.
Roth, S., Stein, D. and Nüsslein-Volhard, C. (1989). A gradient of nuclear localization of the dorsal protein determines dorsoventral pattern in the Drosophila embryo. Cell 59,1189 -1202.[CrossRef][Medline]
Rubin, G. M. and Spradling, A. C. (1982).
Genetic transformation of Drosophila with transposable element
vectors. Science 218,348
-353.
Santaren, J. (1990). Towards establishing a protein database of Drosophila. Electrophoresis 11,254 -267.[CrossRef][Medline]
Seher, T. C. and Leptin, M. (2000). Tribbles, a cell-cycle brake that coordinates proliferation and morphogenesis during Drosophila gastrulation. Curr. Biol. 10,623 -629.[CrossRef][Medline]
Seshaiah, P. and Andrews, D. J. (1999).
WRS-85D: a tryptophanyl-tRNA synthetase expressed to high levels in the
developing Drosophila salivary gland. Mol. Biol.
Cell 10,1595
-1608.
Spana, E. and Perrimon, N. (1999). The vibrator gene encodes a phosphatidylinositol transfer protein and is required for the acquisition and execution of cell fate. A. Dros. Res. Conf. 40,368A .
St. Johnston, D. and Nüsslein-Volhard, C. (1992). The origin of pattern and polarity in the Drosophila embryo. Cell 68,201 -219.[CrossRef][Medline]
Stathopoulos, A., Van Drenth, M., Erives, A., Markstein, M. and Levine, M. (2002). Whole-genome analysis of dorsal-ventral patterning in the Drosophila embryo. Cell 111,687 -701.[CrossRef][Medline]
Steward, R. (1989). Relocalization of the dorsal protein from the cytoplasm to the nucleus correlates with its function. Cell 59,1179 -1188.[CrossRef][Medline]
Svitkina, T. M. and Borisy, G. G. (1999).
Arp2/3 complex and actin depolymerizing factor/cofilin in dendritic
organization and treadmilling of actin filament array in lamellipodia.
J. Cell Biol. 145,1009
-1026.
Sweeton, D., Parks, S., Costa, M. and Wieschaus, E. (1991). Gastrulation in Drosophila: the formation of the ventral furrow and posterior midgut invaginations. Development 112,775 -789.[Abstract]
Tanaka, K. (1994). Role of proteasomes modified by interferon-gamma in antigen processing. J. Leukoc. Biol. 56,571 -575.[Abstract]
Thisse, B., Stoetzel, C., Gorostiza, T. C. and Perrin-Schmitt, F. (1988). Sequence of the twist gene and nuclear localization of its protein in endomesodermal cells of early Drosophila embryos. EMBO J. 7,2175 -2183.[Medline]
Tirnauer, J. S. and Bierer, B. E. (2000). EB1
proteins regulate microtubule dynamics, cell polarity, and chromosome
stability. J. Cell Biol.
149,761
-766.
Tonge, R., Shaw, J., Middleton, B., Rowlinson, R., Rayner, S., Young, J., Pognan, F., Hawkins, E., Currie, I. and Davison, M. (2001). Validation and development of fluorescence two-dimensional differential gel electrophoresis proteomics technology. Proteomics 1,377 -396.[CrossRef][Medline]
Ünlü, M, Morgan, M. E. and Minden, J. S. (1997). Difference gel electrophoresis: a single gel method for detecting protein changes in cell extracts. Electrophoresis 18,2071 -2077.[CrossRef][Medline]
Wakasugi, K. and Schimmel, P. (1999). Two
distinct cytokines released from human aminoacyl-tRNA synthetase.
Science 284,147
-151.
Young, P. E., Pesacreta, T. C. and Kiehart, D. P. (1991). Dynamic changes in the distribution of cytoplasmic myosin during Drosophila embryogenesis. Development 111, 1-14.[Abstract]
This article has been cited by other articles:
![]() |
V. Link, L. Carvalho, I. Castanon, P. Stockinger, A. Shevchenko, and C.-P. Heisenberg Identification of regulators of germ layer morphogenesis using proteomics in zebrafish J. Cell Sci., May 15, 2006; 119(10): 2073 - 2083. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nakahara, K. Kim, C. Sciulli, S. R. Dowd, J. S. Minden, and R. W. Carthew Targets of microRNA regulation in the Drosophila oocyte proteome PNAS, August 23, 2005; 102(34): 12023 - 12028. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||