|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 7 January 2004
doi: 10.1242/dev.00963
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


Institute of Biology III, University of Freiburg, Schänzlestraße 1, 79104 Freiburg, Germany
Author for correspondence (e-mail:
laux{at}biologie.uni-freiburg.de)
Accepted 29 October 2003
| SUMMARY |
|---|
|
|
|---|
Key words: WOX genes, Arabidopsis embryogenesis, Pattern formation
| Introduction |
|---|
|
|
|---|
How do different cell fates originate from a single celled zygote and how
are they integrated into a meaningful context? Expression studies indicated
that molecular differences between cells are established relatively early in
embryo development (Lu et al.,
1996
; Weterings et al.,
2001
). However, it is clear from a large body of evidence that
plant cells acquire their fate irrespective of their clonal origin. Rather
they are specified by signals at their current position. In this regard, auxin
signaling appears to play an important role during early embryo patterning
(Jürgens, 2001
). The
distribution of auxin within the embryo appears to require directional
transport involving putative auxin transporters of the PINFORMED (PIN) family
(Friml et al., 2002
;
Gälweiler et al., 1998
;
Hadfi et al., 1998
;
Steinmann et al., 1999
). Polar
localization of PIN1 at one side of the cell is established by intracellular
vesicle transport mediated by GNOM/EMB30 (GN) activity and predicts the
directionality of auxin flow (Busch et al.,
1996
; Geldner et al.,
2001
; Shevell et al.,
1994
; Steinmann et al.,
1999
). Mutations in the GN gene result in cellular
mislocalization of PIN1 and embryos that variably have lost various aspects of
apical-basal patterning (Mayer et al.,
1993
). In addition to its regulated transport, local auxin
response is also important for embryo patterning. For example, normal root
development requires specific auxin response in the embryo proper, mediated by
MONOPTEROS (MP) and BODENLOS (BDL)
functions, and subsequent signaling to the hypophyseal cell
(Hamann et al., 2002
;
Hardtke and Berleth,
1998
).
Despite these findings, the question of when and how cells become different
and which mechanisms govern embryonic pattern formation remains largely
elusive. Further important genes regulating early embryonic pattern formation
might have been overlooked genetic mutant screens because of genetic
redundancy. This is exemplified by findings that specification of epidermal
cells and patterning of the shoot apex are controlled by redundant pairs of
genes and only double mutants display informative phenotypes, but single
mutants do not (Abe et al.,
2003
; Aida et al.,
1997
).
We have therefore used a genomic approach to analyze early events in
embryonic patterning and searched for homeodomain transcription factor genes
that are expressed in a manner suggestive of a specific role in this process.
This approach was based on the observation that members of homeobox gene
families in diverse organisms are involved in the regulation of similar
developmental processes. For example, members of the HOX gene family
are expressed in specific regions of animal embryos and play a major
regulatory role during early pattern formation
(Krumlauf, 1994
).
We have chosen WUSCHEL (WUS) related genes as an entry
point, since WUS is expressed very early in precursor cells of the
shoot meristem primordium and plays an important role in regulating cell fates
during embryonic shoot meristem formation
(Brand et al., 2002
;
Laux et al., 1996
;
Mayer et al., 1998
). We
describe the WUS gene family and show that the expression dynamics of
several family members reveal events in early embryonic patterning. We also
show that one member, WOX2, is functionally required for correct
development of the apical domain of the embryo.
| Materials and methods |
|---|
|
|
|---|
Genomic WOX1 DNA was amplified with primers WOX1-S (tcccacgtctcacttcttgc) and WOX1-AS (cctggaggatctttcttgtcg), and genomic WOX9 DNA with primers WOX9-S (ccaagatggaatccaaagccag) and WOX9-AS (ggtccgaagttgatgggacagtag).
All DNA fragments were subcloned into the pGEM-T® vector
from Promega or the pBluescript II SK vector from
Stratagene. The WUS homeodomain sequence was used to search for related
sequences with the NCBI Blast program. Sequences were aligned using Vector NTI
and searched for protein domains using the ExPASy algorithms
(http://us.expasy.org/tools/scanprosite/).
A dendrogram was established using ClustalW from the DDBJ Homology Search
System
(http://crick.genes.nig.ac.jp/homology/clustalw-e.shtml).
The dendrogram was drawn with help of the Treestar program
(Page, 1996
).
In situ hybridization
In situ hybridization was performed as previously described
(Mayer et al., 1998
). All
plant material was of the Ler background. mp, bdl and
gn seeds were kindly provided by Dr Gerd Jürgens
(Tübingen). For every gene, sense and antisense probes were analyzed and
sense controls never showed specific signals. In all experiments, we confirmed
expression patterns in more than 30 embryos for each stage, except for the
expression analysis in zygotes (approx. 10 zygotes) and the infrequently
occurring abnormal wild-type embryos (3 embryos). All hybridization probes
lacked a poly(A) tail. The WOX1 probe consisted of the cDNA fragment
from position 114 to 645. For PRS/WOX3, WOX5 and WOX8 the
complete cDNA fragments (see above) were used as probes. To exclude cross
hybridization between genes with overlapping expression patterns, we generated
additional probes for WOX2 and WOX9 excluding the homeobox
as the most conserved domain within these genes. Both WOX2 probes,
the complete 850 bp probe and the homeodomain-deleted 442 bp probe from
position 408-850, gave the same expression pattern. A 1461 bp WOX9
DNA fragment (1-1461) and a 717 bp probe excluding the homeodomain (position
744 to 1461) gave the same expression pattern.
Plant work
Plant growth and phenotypic embryo analysis by DIC microscopy were
performed as described previously (Laux et
al., 1996
).
The wox2-1 line was obtained from the Arabidopsis Knockout Facility of the University of Wisconsin and the insertion was detected by PCR using the primer m-s (aagtaaacgcaggaacagcaagcagttca) and m-as (cgaaacgagtagaagtagaaccaccagaa) following the protocol of the provider. The wox2-2 line was obtained from the Torrey Mesa Research Institute (San Diego) and the insertion was detected by PCR using the primer m-as and the T-DNA specific primer LB2 (gcttcctattatatcttcccaaattaccaataca). The boundaries of both insertions were sequenced to confirm the position of the insertion.
For the complementation experiment, a 9.7 kb HindIII genomic DNA
fragment was cloned into a pBAR-A vector [a derivative of pGPTV-BAR
(Becker et al., 1992
)] and
transformed into wox2-1 plants by the floral dipping method
(Clough and Bent, 1998
).
| Results |
|---|
|
|
|---|
|
|
Expression analysis
The goal of this work was to identify WOX genes with expression
patterns suggestive of a role in early embryo patterning. Therefore, we
performed an initial survey of 12 genes by in situ hybridization and found six
family members with specific expression patterns in the embryo that we
subsequently analyzed in detail (see below).
For clarity we will briefly recapitulate Arabidopsis embryo sac
development and early embryogenesis (Fig.
2) (Jürgens and Mayer,
1994
; Mansfield and Briarty,
1991
; Mansfield et al.,
1991
). After meiosis, three rounds of nuclear divisions yield the
mature embryo sac with the egg cell and two synergid cells at the micropylar
end, a diploid central cell that gives rise to the endosperm after fusion with
one of the sperm nuclei, and three antipodal cells at the chalazal end.
Following fertilization of the egg cell, the pattern of cell division is
almost invariant during the early stages of embryogenesis; first, the
elongated zygote divides asymmetrically, producing two daughter cells that
differ in size and developmental fates. The smaller apical daughter cell will
give rise to the so-called embryo proper and finally to most of the seedling
body. It first divides twice longitudinally to give the 4-cell embryo, and
then horizontally to produce the 8-cell embryo proper with an apical and a
central domain. Subsequently, after a round of periclinal divisions, the
protoderm is separated from the inner cells, creating a radial axis of tissues
in the 16-cell embryo. The larger basal daughter cell of the zygote undergoes
a series of transverse cell divisions to give the extra-embryonic suspensor, a
file of seven to nine cells that pushes the embryo into the lumen of the
developing seed but whose uppermost cell forms the hypophysis and contributes
to the root meristem.
|
WOX2 and WOX8 mRNAs co-exist in the egg cell and zygote
WOX2 mRNA was detected in the egg cell and the central cell of the
embryo sac, but not in the synergids (Fig.
3A), the antipodals or the male gametophyte (not shown). After
fertilization, WOX2 was expressed in the zygote
(Fig. 4A). At these stages, the
WOX8 expression pattern was indistinguishable from the WOX2
pattern: expression was found in the egg cell and the central cell of the
embryo sac (Fig. 3B) and
thereafter in the zygote (Fig.
4O). Thus, mRNAs encoding both apical and basal cell-specific
transcription factors (see below) are already present in the egg cell.
|
|
WOX8 mRNA becomes restricted to basal derivatives of the zygote
After the division of the zygote, WOX8 expression was
complementary to that of WOX2 and restricted to the basal daughter
cell (Fig. 4P). Through the
16-cell stage, WOX8 expression was found in all descendants of the
basal daughter, the developing suspensor and the hypophyseal cell
(Fig. 4Q-S). After the
hypophysis had divided, WOX8 expression ceased in its descendants
(Fig. 4T), but remained present
in the extra embryonic suspensor (Fig.
4T,U). Additional WOX8 expression was found in the
cellularized endosperm of the micropylar region during the globular and heart
stages of embryogenesis (Fig.
4T,U). Similar to WOX2, we did not detect WOX8
later in embryogenesis or in postembryonic stages, suggesting a specific role
for these genes very early in embryonic development.
The asymmetric division of the zygote results in separation of WOX2 and WOX8 mRNA expression domains
Given that WOX2 and WOX8 are co-expressed in the zygote,
their asymmetric expression in its daughter cells could be achieved in two
ways. First, asymmetry could be already established in the zygote itself, if
either mRNA species were localized specifically at the apical or basal pole of
the zygote. In this case, each daughter cell would obtain only one mRNA
species. Alternatively, each daughter cell could initially contain both mRNA
species, but subsequently establish asymmetric mRNA expression.
To distinguish between these possibilities we performed a series of in situ hybridizations. Since the experimental procedure used does not provide subcellular resolution, we could not directly assess whether WOX2 and WOX8 mRNAs were localized in a polar fashion in the zygote. Instead, we examined over 100 embryos after the division of the zygote. We exclusively found asymmetric expression of WOX2 (Fig. 4B) and WOX8 (Fig. 4P) mRNAs, but not a single case where both daughter cells expressed the same gene. This suggests that asymmetry of the mRNA distribution is established either before cytokinesis in the zygote or rapidly thereafter in the daughter cells.
WOX9 expression dynamics reflect the initiation of the central embryo domain
WOX9 expression was first detected in the basal daughter cell of
the zygote (Fig. 4I). Unlike
WOX2 and WOX8, we never detected WOX9 expression in
the egg cell (not shown) or the zygote
(Fig. 4H). During two
subsequent rounds of transverse cell divisions, WOX9 expression
became restricted to the hypophysis (Fig.
4J). At the 8-cell stage, WOX9 expression expanded into
the central domain of the embryo, in addition to weakening in the hypophysis
(Fig. 4K). After protoderm
formation, WOX9 expression in the central embryo domain became
restricted to the protodermal cells and also disappeared from the hypophyseal
cell (Fig. 4L). In subsequent
stages, a ring of WOX9 expression remained at the presumptive
boundary between root and hypocotyl (Fig.
4M,N), at about the same position as WOX2 expression in
heart stage embryos (compare to Fig.
4G). In addition to its embryonic expression, WOX9
expression was found postembryonically in the epidermal cells of the placenta
during gynoecium development, but not in the developing ovules (not shown).
The placental expression disappeared soon after fertilization.
In summary, we established that in the 8-cell embryo the basic domains along the apical-basal axis are distinguished by the expression patterns of three WOX genes: (1) the apical domain expresses WOX2, (2) the central domain expresses WOX9 and for a limited time low levels of WOX2, (3) the basal domain (hypophysis) expresses WOX8 and WOX9, and (4) the suspensor expresses WOX8. Expression of these genes is initiated in single precursor cells as early as the egg cell stage and subsequently becomes dynamically confined to the respective embryo domains.
WOX9 expression dynamics require MP and BDL, but not GN activity
Since the WOX9 expression domain shifted across the clonal
boundary between derivatives of the basal and apical daughter cells of the
zygote, i.e. hypophysis and central embryo region, we considered how this
process might be regulated. MP and BDL encode proteins
presumably involved in auxin-dependent development of the embryo proper and
signaling from the embryo proper to the hypophysis for its correct
specification (Hamann et al.,
2002
; Hardtke and Berleth,
1998
). The earliest defect detected in each mutant is an abnormal
division of the apical daughter cell of the zygote, eventually leading to a
double octant embryo proper (Fig.
5A). To address whether WOX9 expression dynamics requires
MP/BDL-dependent signaling from the embryo proper, we analyzed WOX9
expression in mp and bdl mutants. We found that in contrast
to wild type, WOX9 expression was not shifted into the embryo proper
in the mutants (Fig. 5A-C) but
rather persisted in the hypophysis (compare to
Fig. 4K-N).
|
Taken together, our results strongly suggest that MP- and BDL-dependent signaling from the embryo proper is required for the shift of WOX9 expression from the hypophysis to the lower cells of the embryo proper.
We also considered whether the apical shift of WOX9 expression
requires correct apical-basal polarization of embryo cells by analyzing
WOX9 expression in gn mutant embryos. In the strongest
manifestation of the gn defect, a ball-shaped embryo with severely
disturbed cellular polarity is formed
(Steinmann et al., 1999
). We
found WOX9 to be expressed in the gn embryo proper, but not
in the hypophysis, similar to wild-type embryos
(Fig. 5D, compare with the
wild-type embryo in Fig. 4N).
In contrast to wild type, however, expression was scattered in epidermal cells
throughout the embryo proper rather than being restricted to the central
domain, consistent with observations made on the expression patterns of other
genes in gn embryos (Vroemen et
al., 1996
). Thus, although gn embryos cells are severely
perturbed in cellular polarity, this does not appear to affect the apical
shift of WOX9 expression from the hypophysis into the embryo
proper.
WOX5 expression dynamics reveal early specification of quiescent center identity
After the basic apical-basal pattern is evident at the 8-cell stage, the
body plan of the embryo is further elaborated by the initiation of shoot and
root apical meristems and the cotyledons. We found that the quiescent center
(QC) of the root meristem expressed the WOX5 gene
(Fig. 6E) and this allowed us
to analyze early events during QC initiation. We detected specific expression
of WOX5 in the hypophysis of the majority of early globular embryos,
approximately one round of cell division after the 16-cell stage
(Fig. 6B), but never at the
16-cell stage itself (Fig. 6A).
In rare cases early globular embryos did not show expression (not shown),
suggesting that WOX5 expression was initiated at some time during
this stage. After the division of the hypophysis, WOX5 mRNA was
detected in the upper lens-shaped cell that gives rise to the QC
(Fig. 6C), but not in the lower
daughter cell that gives rise to the central root cap
(Scheres et al., 1994
).
Subsequently, in heart stage (Fig.
6D) and bent cotyledon stage embryos
(Fig. 6E), WOX5 mRNA
was detected in the four cells of the QC, which are the direct descendants of
the lens-shaped cell. In addition to the expression in the QC and its
precursor cells, we found expression in patches of cells that appeared
associated with the vascular primordium of the cotyledons
(Fig. 6F). This expression was
strongest in late heart stage embryos and then gradually decreased.
|
WOX2 function regulates establishment of the apical embryo domain
In order to obtain initial insight into the function of WOX genes
during embryo development, we analyzed insertional mutants for WOX1, 2, 5,
8 and 9. We found that embryonic patterning was specifically
perturbed in wox2 mutants but not in any other mutant.
We identified two independent insertion mutants, wox2-1, and wox2-2. By sequencing the wox2-1 allele, we detected an insertion after nucleotide 233 in the first exon that disrupts the predicted homeodomain, indicating that this allele probably represents a complete loss of WOX2 function (Fig. 7A). After backcrossing three times to wild-type plants, we were able to identify fertile plants homozygous for the wox2 mutation by PCR based insert analysis. Self-fertilized homozygous wox2-1 plants gave rise to 30-50% of embryos with abnormal apical development (Fig. 7, Table 2). Between the 4-cell and 16-cell stage, some cells in the mutant embryo failed to divide (Fig. 7E) From the 16-cell stage on, wox2 embryos additionally showed aberrant oblique cell divisions not observed in the wild type (Fig. 7F,G). At the mid-globular stage, wox2-1 embryos started to recover by forming a protoderm (Fig. 7G) and eventually gave rise to fertile plants. The wox2-2 allele contains an insertion after nucleotide 477 in the second exon (Fig. 7A). Homozygous wox2-2 plants produced embryos with defects similar to those observed for wox2-1 (Fig. 7, Table 2) and did not complement the wox2-1 mutation.
|
|
Since WOX2 is expressed in the female gametophyte from an early stage, we considered whether WOX2 function is essential during female gametophytic and/or during embryonic development. For this purpose, we compared the progeny of selfed wox2-1 mutants with those obtained from reciprocal back-crosses between a homozygous wox2-1 plant and wild type. We found embryos with abnormal apical cells exclusively in the progeny of selfed wox2-1 plants. Division patterns of apical cells were unperturbed in heterozygous wox2-1 embryos, even when these developed in a homozygous wox2-1 mother (Table 3). Thus, even though WOX2 is expressed in the embryo sac, it is only required for apical embryo development after fertilization.
|
| Discussion |
|---|
|
|
|---|
|
How is this asymmetry established? Two mechanisms can be envisioned. In the
first, WOX2 and WOX8 mRNAs, or factors that regulate their
expression such as RNA degrading enzymes or transcriptional regulators, could
be localized in the zygote in a polar fashion and be inherited asymmetrically
by the daughter cells (Fig. 8). This could be accomplished by interactions of molecules with the cytoskeleton
and subsequent localization to one pole of the zygote. Consistent with this
hypothesis, both egg cell and zygote display a highly polar organization; the
nucleus and most of the cytoplasm are located at the apical pole whereas the
vacuole is located at the basal pole
(Mansfield and Briarty, 1991
;
Mansfield et al., 1991
). In an
alternative mechanism, the daughter cells would initially inherit the same
molecules and asymmetric mRNA expression would be established afterwards in
response to differential positional cues by specific RNA degradation and/or
gene transcription. One example of such a mechanism is the gradual restriction
of ATML1 gene expression to the apical protoderm of globular embryos
(Lu et al., 1996
).
Our results argue in favor of the model in which apical- and basal-specific
molecules, either WOX2 and WOX8 mRNAs or factors regulating
them, are already laid down in a polar fashion within the zygote
(Fig. 8). In every embryo we
examined we found asymmetric distribution of WOX2 and WOX8
mRNAs in the apical and basal daughter cells. It is possible that both
daughter cells contain the same transcript for a very brief period after
division of the zygote, and that we have missed observing this situation
because of its transient nature. However, this scenario would nevertheless
require that factors regulating mRNA degradation and/or specific gene
expression be asymmetrically distributed upon the division of the zygote. The
proposed mechanism would be similar to, for example, separation of
developmental determinants by the asymmetric cell divisions of the
Caenorhabditis elegans zygote
(Lyczak et al., 2002
)
suggesting that related strategies are employed during initiation of the main
body axis in plants and animals. It is noteworthy that such a mechanism does
not imply autonomous specification of cell fates, since polarization of the
plant zygote might conceivably be regulated by positional cues from the
surrounding micropylar and/or chalazal tissues.
Dynamic establishment of central embryo domain identity
Once apical-basal polarity is established, progressive refinement along the
apical-basal axis is evident by WOX gene expression dynamics:
WOX2 and WOX8 expression become gradually confined to the
most apical and basal descendants of the zygote respectively and the
precursors of hypocotyl and root are established between them. This is
reflected by the shift of WOX9 expression across the clonal boundary
from the hypophysis into the basal cells of the embryo proper, concurrent with
the downregulation of WOX2 expression, indicating progressive
confinement of `apicalness' to the most apical cells and specification of
central embryo domain identity in the cells underneath.
Our results indicate that the shift of WOX9 expression requires auxin response in the embryo proper mediated by MP and BDL activities and signaling from the embryo proper to the hypophysis. The failure to initiate WOX9 expression in the central domain and the inability to repress it in the hypophysis do not appear to be due to the aberrant morphology of mp and bdl embryos. This suggests WOX9 as a potential target of MP/BDL-dependent signaling.
A common mechanism during initiation of apical and basal stem cell niches
After embryogenesis, the cells required for continuous plant growth are
ultimately derived from stem cell niches within the root and shoot meristems.
In the shoot meristem, WUS expression in the organizing center (OC)
provides signals to maintain adjacent undifferentiated stem cells
(Mayer et al., 1998
).
Likewise, in the root meristem, signaling from the QC is required to maintain
neighboring stem cells in an undifferentiated state
(van den Berg et al., 1997
),
suggesting that OC and QC are functionally equivalent signaling centers that
constitute stem cell maintaining microenvironments.
Our results suggest that during formation of the root pole in the embryo,
QC identity is established in the hypophyseal cell soon after the 16-cell
stage and subsequently becomes restricted to the lens-shaped upper daughter
cell by an asymmetric division. Similarly, at the future shoot pole,
WUS expression specifies precursor cells of the OC from the 16-cell
stage onwards and subsequently becomes restricted to its appropriate position
within the shoot meristem by asymmetric cell divisions
(Mayer et al., 1998
).
Therefore, both signaling centers are not only functionally equivalent but
also share striking developmental and molecular similarities.
A potential role for the WOX family in embryonic pattern formation
Several lines of evidence suggest that WOX genes function in early
embryonic patterning. First, it is plausible that WOX homeodomain
proteins confer specific transcriptional programs upon the cells expressing
them. Second, these programs are initiated in precursor cells as early as in
the egg cell, suggesting a function early in the regulatory hierarchy. Third,
WOX gene expression is restricted to stages in embryogenesis during
which developmental decisions conceivably take place.
Finally, our mutant analysis demonstrates that WOX2 is functionally required to regulate the timing and the orientation of divisions in the cells expressing it, the descendants of the apical daughter cell of the zygote. At this stage of embryonic development the cell division pattern is essentially invariable in Arabidopsis, indicating that the information about when and how to divide is an integral part of the identity of a cell. We therefore suggest that WOX2 is involved in specifying apical cell identity during early embryogenesis. In this view, the separation of WOX2 and WOX8 expression domains during the asymmetric division of the zygote appears to be a very early event in establishing different cell fates along the apical-basal body axis of the Arabidopsis embryo. We do not know why embryos mutant for WOX genes other than WOX2 and WUS, which exhibit intriguing expression dynamics in early embryogenesis, did not show any detectable developmental defects. However, since several of the respective genes, e.g. WOX8 and WOX9 represent pairs or triplets of highly related WOX family members (compare Fig. 1D), the lack of phenotypic defects in these mutants could be due to genetic redundancy.
In several animal species, cell fate decisions during early embryonic
development are regulated by members of a homeobox gene family (HOX)
which are expressed in specific domains of the embryo
(Krumlauf, 1994
). Although a
detailed functional analysis is the subject of further studies, our results
suggest that members of the plant-specific WOX homeodomain family
could fulfill similar functions in plant embryonic patterning.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
While this paper was under review, a putative rice homolog of WOX5
was described (Kamiya et al.,
2003
).
* Present address: Department of Developmental Biology, Stockholm University,
Svente Arrhenius Väg 16-18, 10691 Stockholm, Sweden ![]()
Present address: Institute of Plant Biology, University of Zürich,
Zollikerstraße 107, 8008 Zürich, Switzerland ![]()
| REFERENCES |
|---|
|
|
|---|
Abe, M., Katsumata, H., Komeda, Y. and Takahashi, T.
(2003). Regulation of shoot epidermal cell differentiation by a
pair of homeodomain proteins in Arabidopsis.Development 130,635
-643.
Aida, M., Ishida, T., Fukaki, H., Fujisawa, H. and Tasaka,
M. (1997). Genes involved in organ separation in Arabidopsis:
An analysis of the cup-shaped cotyledon mutant. Plant
Cell 9,841
-857.
Becker, D., Kemper, E., Schell, J. and Masterson, R. (1992). New plant binary vectors with selectable markers located proximal to the left T-DNA border. Plant Mol. Biol. 20,1195 -1197.[CrossRef][Medline]
Brand, U., Grunewald, M., Hobe, M. and Simon, R.
(2002). Regulation of CLV3 expression by two homeobox genes in
Arabidopsis. Plant Physiol.
129,565
-575.
Busch, M., Mayer, U. and Jürgens, G. (1996). Molecular analysis of the Arabidopsis pattern formation gene GNOM: Gene structure and intragenic complementation. Molecular and General Genetics 250,681 -691.
Clough, S. J. and Bent, A. F. (1998). Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16,735 -743.[CrossRef][Medline]
Feng, Q., Zhang, Y., Hao, P., Wang, S., Fu, G., Huang, Y., Li, Y., Zhu, J., Liu, Y., Hu, X. et al. (2002). Sequence and analysis of rice chromosome 4. Nature 420,316 -320.[CrossRef][Medline]
Friml, J., Benkova, E., Blilou, I., Wisniewska, J., Hamann, T., Ljung, K., Woody, S., Sandberg, G., Scheres, B., Jürgens, G. et al. (2002). AtPIN4 mediates sink-driven auxin gradients and root patterning in Arabidopsis. Cell 108,661 -673.[CrossRef][Medline]
Gälweiler, L., Guan, C., Müller, A., Wisman, E.,
Mendgen, K., Yephremov, A. and Palme, K. (1998). Regulation
of polar auxin transport by AtPIN1 in Arabidopsis vascular tissue.
Science 282,2226
-2230.
Gehring, W. J., Muller, M., Affolter, M., Percival-Smith, A., Billeter, M., Qian, Y. Q., Otting, G. and Wuthrich, K. (1990). The structure of the homeodomain and its functional implications. Trends Genet 6, 323-329.[Medline]
Gehring, W. J., Qian, Y. Q., Billeter, M., Furukubo-Tokunaga, K., Schier, A. F., Resendez-Perez, D., Affolter, M., Otting, G. and Wuthrich, K. (1994). Homeodomain-DNA recognition. Cell 78,211 -223.[CrossRef][Medline]
Geldner, N., Friml, J., Stierhof, Y. D., Jürgens, G. and Palme, K. (2001). Auxin transport inhibitors block PIN1 cycling and vesicle trafficking. Nature 413,425 -428.[CrossRef][Medline]
Hadfi, K., Speth, V. and Neuhaus, G. (1998). Auxin-induced developmental patterns in Brassica juncea embryos. Development 125,879 -887.[Abstract]
Hamann, T., Benkova, E., Bäurle, I., Kientz, M. and
Jürgens, G. (2002). The Arabidopsis BODENLOS gene
encodes an auxin response protein inhibiting MONOPTEROS-mediated embryo
patterning. Genes Dev.
16,1610
-1615.
Hardtke, C. S. and Berleth, T. (1998). The Arabidopsis gene MONOPTEROS encodes a transcription factor mediating embryo axis formation and vascular development. EMBO J. 17,1405 -1411.[CrossRef][Medline]
Jürgens, G. (2001). Apical-basal pattern formation in Arabidopsis embryogenesis. EMBO J. 20,3609 -3616.[CrossRef][Medline]
Jürgens, G. and Mayer, U. (1994). Arabidopsis. In A Colour Atlas of Developing Embryos (ed. J. Bard), pp. 7-21. London: Wolfe Publishing.
Kamiya, N., Nagasaki, H., Morikami, A., Sato, Y. and Matsuoka, M. (2003). Isolation and characterization of a rice WUSCHEL-type homeobox gene that is specifically expressed in the central cells of a quiescent center in the root apical meristem. Plant J. 35,429 -441.[CrossRef][Medline]
Krumlauf, R. (1994). Hox genes in vertebrate development. Cell 78,191 -201.[CrossRef][Medline]
Laux, T., Mayer, K. F. X., Berger, J. and Jürgens, G. (1996). The WUSCHEL gene is required for shoot and floral meristem integrity in Arabidopsis. Development 122, 87-96.[Abstract]
Lu, P., Porat, R., Nadeau, J. A. and O'Neill, S. D. (1996). Identification of a meristem L1 layer-specific gene in Arabidopsis that is expressed during embryonic pattern formation and defines a new class of homeobox genes. Plant Cell 8,2155 -2168.[Abstract]
Lyczak, R., Gomes, J. E. and Bowerman, B. (2002). Heads or tails: cell polarity and axis formation in the early Caenorhabditis elegans embryo. Dev. Cell 3, 157-166.[CrossRef][Medline]
Mansfield, S. G. and Briarty, L. G. (1991). Early embryogenesis in Arabidopsis thaliana. II. The developing embryo. Can. J. Bot. 69,461 -476.
Mansfield, S. G., Briarty, L. G. and Erni, S. (1991). Early embryogenesis in Arabidopsis thaliana. I. The mature embryo sac. Can. J. Bot. 69,447 -460.
Matsumoto, N. and Okada, K. (2001). A homeobox
gene, PRESSED FLOWER, regulates lateral axis-dependent development of
Arabidopsis flowers. Genes Dev.
15,3355
-3364.
Mayer, K. F. X., Schoof, H., Haecker, A., Lenhard, M., Jürgens, G. and Laux, T. (1998). Role of WUSCHEL in regulating stem cell fate in the Arabidopsis shoot meristem. Cell 95,805 -815.[CrossRef][Medline]
Mayer, U., Büttner, G. and Jürgens, G. (1993). Apical-basal pattern formation in the Arabidopsis embryo: studies on the role of the gnom gene. Development 117,149 -162.[Abstract]
Page, R. D. (1996). TreeView: an application to
display phylogenetic trees on personal computers. Comput. Appl.
Biosci. 12,357
-358.
Scheres, B., Wolkenfelt, H., Willemsen, V., Terlouw, M., Lawson,
E., Dean, C. and Weisbeek, P. (1994). Embryonic origin of the
Arabidopsis primary root and root meristem initials.
Development 120,2475
-2487.
Shevell, D. E., Leu, W.-M., Gilimor, C. S., Xia, G., Feldmann, K. A. and Chua, N.-H. (1994). EMB30 is essential for normal cell division, cell expansion, and cell adhesion in Arabidopsis and encodes a protein that has similarity to Sec 7. Cell 77,1051 -1062.[CrossRef][Medline]
Steinmann, T., Geldner, N., Grebe, M., Mangold, S., Jackson, C.
L., Paris, S., Galweiler, L., Palme, K. and Jürgens, G.
(1999). Coordinated polar localization of auxin efflux carrier
PIN1 by GNOM ARF GEF. Science
286,316
-318.
Stuurman, J., Jaggi, F. and Kuhlemeier, C.
(2002). Shoot meristem maintenance is controlled by a GRAS-gene
mediated signal from differentiating cells. Genes Dev.
16,2213
-2218.
van den Berg, C., Willemsen, V., Hendriks, G., Weisbeek, P. and Scheres, B. (1997). Short-range control of cell differentiation in the Arabidopsis root meristem. Nature 390,287 -289.[CrossRef][Medline]
Vroemen, C. W., Langeveld, S., Mayer, U., Ripper, G., Jürgens, G., van Kammen, A. and de Vries, S. C. (1996). Pattern formation in the Arabidopsis embryo revealed by position-specific lipid transfer protein gene expression. The Plant Cell 8, 783-791.[Abstract]
Weigel, D., Alvarez, J., Smyth, D. R., Yanofsky, M. F. and Meyerowitz, E. M. (1992). LEAFY controls floral meristem identity in Arabidopsis. Cell 69,843 -859.[CrossRef][Medline]
Weterings, K., Apuya, N. R., Bi, Y., Fischer, R. L., Harada, J.
J. and Goldberg, R. B. (2001). Regional localization of
suspensor mRNAs during early embryo development. Plant
Cell 13,2409
-2425.
Related articles in Development:
This article has been cited by other articles:
![]() |
I. Hakman, H. Hallberg, and J. Palovaara The polar auxin transport inhibitor NPA impairs embryo morphology and increases the expression of an auxin efflux facilitator protein PIN during Picea abies somatic embryo development Tree Physiol, April 1, 2009; 29(4): 483 - 496. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kawashima, X. Wang, K. F. Henry, Y. Bi, K. Weterings, and R. B. Goldberg Identification of cis-regulatory sequences that activate transcription in the suspensor of plant embryos PNAS, March 3, 2009; 106(9): 3627 - 3632. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhao, Y. Hu, M. Dai, L. Huang, and D.-X. Zhou The WUSCHEL-Related Homeobox Gene WOX11 Is Required to Activate Shoot-Borne Crown Root Development in Rice PLANT CELL, March 1, 2009; 21(3): 736 - 748. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Shimizu, J. Ji, E. Kelsey, K. Ohtsu, P. S. Schnable, and M. J. Scanlon Tissue Specificity and Evolution of Meristematic WOX3 Function Plant Physiology, February 1, 2009; 149(2): 841 - 850. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gebert, T. Dresselhaus, and S. Sprunck F-Actin Organization and Pollen Tube Tip Growth in Arabidopsis Are Dependent on the Gametophyte-Specific Armadillo Repeat Protein ARO1 PLANT CELL, October 1, 2008; 20(10): 2798 - 2814. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Saiga, C. Furumizu, R. Yokoyama, T. Kurata, S. Sato, T. Kato, S. Tabata, M. Suzuki, and Y. Komeda The Arabidopsis OBERON1 and OBERON2 genes encode plant homeodomain finger proteins and are required for apical meristem maintenance Development, May 15, 2008; 135(10): 1751 - 1759. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Rushton, M. T. Bokowiec, S. Han, H. Zhang, J. F. Brannock, X. Chen, T. W. Laudeman, and M. P. Timko Tobacco Transcription Factors: Novel Insights into Transcriptional Regulation in the Solanaceae Plant Physiology, May 1, 2008; 147(1): 280 - 295. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. D. J. Supena, B. Winarto, T. Riksen, E. Dubas, A. van Lammeren, R. Offringa, K. Boutilier, and J. Custers Regeneration of zygotic-like microspore-derived embryos suggests an important role for the suspensor in early embryo patterning J. Exp. Bot., March 1, 2008; 59(4): 803 - 814. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Nardmann, R. Zimmermann, D. Durantini, E. Kranz, and W. Werr WOX Gene Phylogeny in Poaceae: A Comparative Approach Addressing Leaf and Embryo Development Mol. Biol. Evol., November 1, 2007; 24(11): 2474 - 2484. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Gordon, M. G. Heisler, G. V. Reddy, C. Ohno, P. Das, and E. M. Meyerowitz Pattern formation during de novo assembly of the Arabidopsis shoot meristem Development, October 1, 2007; 134(19): 3539 - 3548. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Pillitteri, S. M. Bemis, E. D. Shpak, and K. U. Torii Haploinsufficiency after successive loss of signaling reveals a role for ERECTA-family genes in Arabidopsis ovule development Development, September 1, 2007; 134(17): 3099 - 3109. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. H. Le, J. A. Wagmaister, T. Kawashima, A. Q. Bui, J. J. Harada, and R. B. Goldberg Using Genomics to Study Legume Seed Development Plant Physiology, June 1, 2007; 144(2): 562 - 574. [Full Text] [PDF] |
||||
![]() |
M. Dai, Y. Hu, Y. Zhao, H. Liu, and D.-X. Zhou A WUSCHEL-LIKE HOMEOBOX Gene Represses a YABBY Gene Expression Required for Rice Leaf Development Plant Physiology, May 1, 2007; 144(1): 380 - 390. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Malik, F. Wang, J. M. Dirpaul, N. Zhou, P. L. Polowick, A. M.R. Ferrie, and J. E. Krochko Transcript Profiling and Identification of Molecular Markers for Early Microspore Embryogenesis in Brassica napus Plant Physiology, May 1, 2007; 144(1): 134 - 154. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Richardt, D. Lang, R. Reski, W. Frank, and S. A. Rensing PlanTAPDB, a Phylogeny-Based Resource of Plant Transcription-Associated Proteins Plant Physiology, April 1, 2007; 143(4): 1452 - 1466. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Takada and G. Jurgens Transcriptional regulation of epidermal cell fate in the Arabidopsis embryo Development, March 15, 2007; 134(6): 1141 - 1150. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Imin, M. Nizamidin, T. Wu, and B. G. Rolfe Factors involved in root formation in Medicago truncatula J. Exp. Bot., February 1, 2007; 58(3): 439 - 451. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Nardmann and W. Werr The Shoot Stem Cell Niche in Angiosperms: Expression Patterns of WUS Orthologues in Rice and Maize Imply Major Modifications in the Course of Mono- and Dicot Evolution Mol. Biol. Evol., December 1, 2006; 23(12): 2492 - 2504. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. W. Kim, S. H. Lee, S.-B. Choi, S.-K. Won, Y.-K. Heo, M. Cho, Y.-I. Park, and H.-T. Cho Functional Conservation of a Root Hair Cell-Specific cis-Element in Angiosperms with Different Root Hair Distribution Patterns PLANT CELL, November 1, 2006; 18(11): 2958 - 2970. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Casson and K. Lindsey The turnip Mutant of Arabidopsis Reveals That LEAFY COTYLEDON1 Expression Mediates the Effects of Auxin and Sugars to Promote Embryonic Cell Identity Plant Physiology, October 1, 2006; 142(2): 526 - 541. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Long, C. Ohno, Z. R. Smith, and E. M. Meyerowitz TOPLESS regulates apical embryonic fate in Arabidopsis. Science, June 9, 2006; 312(5779): 1520 - 1523. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Eckardt Genetic and Epigenetic Regulation of Embryogenesis PLANT CELL, April 1, 2006; 18(4): 781 - 784. [Full Text] [PDF] |
||||
![]() |
M. Kieffer, Y. Stern, H. Cook, E. Clerici, C. Maulbetsch, T. Laux, and B. Davies Analysis of the Transcription Factor WUSCHEL and Its Functional Homologue in Antirrhinum Reveals a Potential Mechanism for Their Roles in Meristem Maintenance PLANT CELL, March 1, 2006; 18(3): 560 - 573. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Keller, J. Abbott, T. Moritz, and P. Doerner Arabidopsis REGULATOR OF AXILLARY MERISTEMS1 Controls a Leaf Axil Stem Cell Niche and Modulates Vegetative Development PLANT CELL, March 1, 2006; 18(3): 598 - 611. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. K.-G. Tan and V. F. Irish The Arabidopsis Zinc Finger-Homeodomain Genes Encode Proteins with Unique Biochemical Properties That Are Coordinately Expressed during Floral Development Plant Physiology, March 1, 2006; 140(3): 1095 - 1108. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. D. Jenik, R. E.J. Jurkuta, and M. K. Barton Interactions between the Cell Cycle and Embryonic Patterning in Arabidopsis Uncovered by a Mutation in DNA Polymerase {varepsilon} PLANT CELL, December 1, 2005; 17(12): 3362 - 3377. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Vanneste, B. De Rybel, G. T.S. Beemster, K. Ljung, I. De Smet, G. Van Isterdael, M. Naudts, R. Iida, W. Gruissem, M. Tasaka, et al. Cell Cycle Progression in the Pericycle Is Not Sufficient for SOLITARY ROOT/IAA14-Mediated Lateral Root Initiation in Arabidopsis thaliana PLANT CELL, November 1, 2005; 17(11): 3035 - 3050. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. D. Jenik and M. K. Barton Surge and destroy: the role of auxin in plant embryogenesis Development, August 15, 2005; 132(16): 3577 - 3585. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Grimanelli, E. Perotti, J. Ramirez, and O. Leblanc Timing of the Maternal-to-Zygotic Transition during Early Seed Development in Maize PLANT CELL, April 1, 2005; 17(4): 1061 - 1072. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Green, M. J. Prigge, R. B. Katzman, and S. E. Clark CORONA, a Member of the Class III Homeodomain Leucine Zipper Gene Family in Arabidopsis, Regulates Stem Cell Specification and Organogenesis PLANT CELL, March 1, 2005; 17(3): 691 - 704. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. O. Park, Z. Zheng, D. G. Oppenheimer, and B. A. Hauser The PRETTY FEW SEEDS2 gene encodes an Arabidopsis homeodomain protein that regulates ovule development Development, February 15, 2005; 132(4): 841 - 849. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Okamoto, S. Scholten, H. Lorz, and E. Kranz Identification of Genes that are Up- or Down-regulated in the Apical or Basal Cell of Maize Two-celled Embryos and Monitoring their Expression During Zygote Development by a Cell Manipulation- and PCR-based Approach Plant Cell Physiol., February 1, 2005; 46(2): 332 - 338. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. E. Friedman, R. C. Moore, and M. D. Purugganan The evolution of plant development Am. J. Botany, October 1, 2004; 91(10): 1726 - 1741. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||