|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 7 January 2004
doi: 10.1242/dev.00953
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
*
Division of Developmental Biology, National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, UK
Author for correspondence (e-mail:
tmohun{at}nimr.mrc.ac.uk)
Accepted 27 October 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Xenopus, Cardiogenesis, Heart, Myocardium
| Introduction |
|---|
|
|
|---|
Although the identity of several signalling pathways likely to be involved
in specifying cardiac fate have been identified
(Harvey, 2002
;
Zaffran and Frasch, 2002
), we
still have little knowledge of how such signals trigger the onset of cardiac
differentiation nor do we understand how distinct programs of differentiation
are orchestrated in different regions of the developing heart. Initial studies
of cardiac muscle-specific transcription, based largely on cell culture
models, have identified candidate regulatory factors that appear to function
in a variable but combinatorial manner to drive expression of the terminal
differentiation program. However, such factors are apparently distributed
quite broadly, both within the developing heart and frequently within the
whole embryo, offering few clues as to the basis for regional differentiation
in the heart (Bruneau, 2002
;
Cripps and Olson, 2002
).
The scale of this problem has become evident from studies of gene
expression in the developing heart of the mouse embryo. These have
demonstrated that almost all genes identified as part of the cardiac muscle
differentiation program show some regional restriction within the heart, the
nature and extent of which frequently changes as cardiogenesis proceeds. To
compound this complexity, studies of heart-specific transcription using
transgenic models have identified enhancer elements within individual cardiac
gene promoters that drive transgene expression in very specific domains within
the developing heart. These do not necessarily correspond to any obvious
morphological compartment (Habets et al.,
2003
; Kelly et al.,
1999
).
Two explanations could account for such findings. One view is that such
discrete expression domains may indicate regions that have distinct functional
or developmental significance during cardiac morphogenesis. For example, in
addition to the different prospective fates along the anteroposterior axis of
the initial heart tube, such regional expression patterns probably indicate
the importance of patterning in both the dorsoventral and left-right axes of
the initial heart tube (Habets et al.,
2003
). Indeed, regional expression of several genes early in mouse
heart formation, combined with the changing functional characteristics of
embryonic myocardium, together form the basis of a compelling model for heart
morphogenesis (Christoffels et al.,
2000
).
From another perspective, the existence of such discrete enhancer elements
could testify to the modular nature of the regulatory elements controlling
cardiac gene expression. Such an arrangement could reflect the evolutionary
diversity of cardiogenesis amongst metazoans. In this view, distinct
regulatory modules provide the mechanisms by which functional complexity has
been achieved on the basis of a common genetic program
(Fishman and Olson, 1997
;
Habets et al., 2003
).
Progress in understanding either the basis for, or the significance of,
regional transcription patterns in the developing heart will require detailed
and comparative study of individual genes in the myocardial differentiation
program. To date, several different families of transcription factors have
been implicated in regulating cardiomyocyte differentiation, including members
of the Nkx/tinman, family, the MADS factors MEF2 and serum response factor
(SRF) and the GATA family of zinc-finger proteins
(Bruneau, 2002
). In addition,
an important role has been identified for myocardin, a regulatory factor whose
activity is mediated by protein:protein interactions rather than by direct
interaction with specific DNA sequences
(Wang et al., 2001
).
GATA transcription factors are zinc-finger proteins known to bind DNA and
transactivate target genes through the GATA-binding site, (A/T)GATA(A/G)
(Ko and Engel, 1993
). Based on
their expression patterns, the GATA proteins have been divided into two
subfamilies: GATA1/2/3, which are primarily expressed in haematopoietic
progenitors, but also in the nervous system, and GATA4/5/6 which are broadly
expressed in the heart, gut and lungs
(Molkentin, 2000
). GATA4 has
been shown to regulate a number of cardiac-specific genes in vitro, including
MHC
, cardiac TnC and ANF
(Grepin et al., 1994
;
Ip et al., 1994
;
Molkentin et al., 1994
).
SRF is involved in regulation of muscle-specific and growth
factor-inducible transcription, binding to the motif CC[A/T]6GG (termed a CArG
box or SRE). It has been shown in vitro to interact with GATA4 and Nkx2.5 to
regulate transcription of cardiac promoters. These and similar combinatorial
interactions between cardiogenic factors, which are present in broader area
then the heart, were proposed to provide molecular basis for heart-specific
transcription (Bruneau, 2002
;
Charron and Nemer, 1999
;
Cripps and Olson, 2002
).
The zinc-finger protein YY1 is pleiotropic regulator that can both repress
and activate transcription (Thomas and
Seto, 1999
). In addition, it can cause DNA bending and it has been
shown to be involved in chromatin remodelling. In Xenopus embryos,
YY1 is regulated at the level of nuclear import, being exclusively cytoplasmic
during early development, subsequently translocating to the nucleus
(Ficzycz et al., 2001
). Recent
studies have shown that YY1 interacts with GATA4 to synergistically activate
transcription of the BNP promoter in cell culture
(Bhalla et al., 2001
), but also
acts to downregulate transcription from the cardiac-specific MHC
promoter (Sucharov et al.,
2003
).
We have previously reported that the myosin light chain 2 gene provides a
sensitive marker for the onset of cardiac muscle differentiation in
Xenopus embryos (Chambers et al.,
1994
). In contrast to the MLC2 genes of amniotes
(MLC2a and MLC2v) that are restricted to the atria or
ventricles respectively (Franco et al.,
1999
), we show that XMLC2 transcripts are present
throughout the entire myocardium, from the onset of cardiac differentiation in
the tailbud embryo to the formation of a mature, chambered heart. We also show
that the Xenopus MLC2 promoter faithfully maintains its
pan-myocardial expression in transgenic mouse embryos. This suggests that
chamber restriction of the mammalian MLC2 genes may be the result of
regulatory controls that have evolved to limit a more ancient pan-myocardial
program. Using transgenesis in Xenopus embryos, we have found that
the combined activities of GATA factors, SRF and YY1 apparently drive
panmyocardial expression of the Xenopus MLC2 gene.
| Materials and methods |
|---|
|
|
|---|
XMLC2 promoter-GFP fusion gene constructs
A synthetic GFP reporter gene containing the GFP open reading frame and
SV40 polyadenylation (pA) signal was cloned into the BglII site
downstream of the 3kb XMLC2 promoter. A series of 5' deletions
-1558 bp (StuI) and
-681bp (EcoRV) were
generated by using StuI and EcoRV restriction enzymes,
respectively. Additional 5' deletions were generated by PCR using
proofreading polymerase and the 3kb reporter plasmid as a template. All
primers used consisted of18-20 bp of XMLC2 sequence with an
additional EcoRI or BamHI recognition site.
A chimeric XMLC2-TK promoter, comprising nucleotides 1558
to 48 bp of the XMLC2 promoter sequence fused to a thymidine
kinase (TK) minimal promoter, was generated by ligating a StuI
XMLC2 fragment to a 161 bp SmaI-BglII TK fragment.
Fragments comprising nucleotides 1558 to 249 and 249 to
36 of the XMLC2 promoter were generated by PCR and used to
create chimeric constructs with the minimal promoters of the TK
(McKnight and Kingsbury, 1982
)
or type 5 cytoskeletal actin (Mohun et
al., 1987
) genes. Other short XMLC2 fragments (see text
and figure legends) were synthesised as oligonucleotides with and cloned into
the Asp718 site of the minimal cytoskeletal actin promoter via
Asp718-compatible ends
(Latinki
et al.,
2002
). One such double stranded oligonucleotide
(122/85) was also used as a probe for EMSA (see Figs
6 and
7). PCR-mediated mutagenesis
was performed by the overlap method (Ho et
al., 1989
), using proofreading thermostable polymerase. The
sequence of all constructs generated by PCR or by insertion of
oligonucleotides was confirmed by sequencing, as was the oligonucleotide copy
number.
|
|
-crystallin/GFP reporter
(Offield et al., 2000
et al.,
2002
Wholemount in situ hybridisation and histology
Whole-mount in situ hybridisation was performed as described (Sive, 2000)
with probes specific for GFP (Sparrow et
al., 2000a
) or XMLC2
(Chambers et al., 1994
).
Transverse sections (10 µm) were obtained from stained Xenopus
embryos after embedding in Paraplast wax. Transgenic mouse embryos were
stained for ß-galactosidase expression and analysed directly or by
cryostat sectioning.
Mouse transgenesis
The 3 kb HindIII-BglII fragment containing the
XMLC2 promoter was fused upstream of the ß-galactosidase
reporter, pPD16.43 (Fire et al.,
1990
). Transgenic mice were generated by the Biological Services
Division of NIMR using standard methods.
EMSA
Embryo extracts were prepared as described
(Howell et al., 1999
). The
following oligonucleotides were synthesised with 5'GTAC overhangs for
use as probes or competitors in EMSA reactions: GATA#1 TOP,
GTACCTATGCCTGAGATAAGAAGGAGTCG; GATA#1-BOT, GTACCGACTCCTTCTTATCTCAGGCATAG;
GATA#2 TOP, GTACCCTTGTGCTCTTATCTCTTCCGTCTG; GATA#2-BOT,
GTACCAGACGGAAGAGATAAGAGCACAAGG; GATA#3-TOP, GTACCACTTTCCTGATAAATGAAGTATCCAG;
GATA#3-BOT, GTACCTGGATACTTCATTTATCAGGAAAGTG; YY1-TOP,
GTACGAGATCTCCCCACCCCTACTCCATGAGAA; YY1-BOT, GTACTTCTCATGGAGTAGGGGTGGGGAGATCTC;
SP1-TOP, AATTGACGCTGGGCGGGGTTTG; SP1-BOT, AATTCAAACCCCGCCCAGCGTC.
Double-stranded oligonucleotides (20 ng) were labelled with
-32P-dCTP and Klenow DNA polymerase as described (Sambrook,
1989).
Human SRF (Norman et al.,
1988
) and XGATA4 (Kelley et
al., 1993
) were translated in vitro using a coupled
transcription-translation system (Promega) according to manufacturers
instructions. Binding reactions and competitions were as described previously
(Norman et al., 1988
).
Polyclonal anti-YY1 (Santa Cruz) and anti-XSRF
(Chambers et al., 1992
)
antibodies were used at 1:20 dilution.
Luciferase assays
10 pg of 122/45/cyt5/luc and RL-TK (Promega) were injected
together into the one- or two-cell stage of fertilised Xenopus eggs.
The DNA was also co-injected with 200 pg of synthetic RNA encoding SRF and/or
XGATA4. Animal pole explants were excised at the blastula stage (Sive, 2000)
and cultured until control embryos reached stage 13. Firefly and Renilla
luciferase assays were performed using the Dual Luciferase Assay kit
(Promega), according to the manufacturers recommendations.
| Results |
|---|
|
|
|---|
|
-2990,
Fig. 3A,B). Expression of the
transgene, like that of the endogenous XMLC2 gene, is confined
exclusively to the developing myocardium.
|
|
-249;
Fig. 3C,D). Further truncation
to 159 and 127 removed the most distal of three GATA motifs
(GATA#3) and resulted in weaker levels of transgene expression and a lower
frequency of expression in transgenic embryos (5'
-159 and
5'
-127; Table 1).
Nevertheless, transgene expression was detectable in the developing tadpole
heart. Removal of a further 16 bp of the 5' sequence (encompassing the
GATA#2 motif) resulted in loss of expression in the heart
(5'
-111; Table 1)
indicating that 127 nucleotides of promoter-proximal sequence is indispensable
for expression in the heart. This sequence includes two GATA sites (GATA#2 and
GATA#1) flanking a combined CArG-like/YY1 site.
|
-159, 127, 111,
85) frequently exhibited ectopic expression in the branchial arches,
pronephros and ventral side of the embryo
(Fig. 3F,G;
Table 1) presumably reflecting
the loss of regulatory elements that normally restrict XMLC2 promoter
activity to the heart.
Sequences within the proximal 249 nucleotides are indispensable for expression in the heart
To define the 3' border of the sequence required for expression in
heart, we created several constructs containing varying length of the
XMLC2 promoter upstream of a minimal promoter from the
Xenopus type 5 cytoskeletal actin or the herpes simplex
thymidine kinase genes. Removal of the most proximal 47 nucleotides
(encompassing the GATA#1 motif) had little effect on heart-specific expression
(1558/48Cyt; Fig.
4A) but a more radical 3' deletion (1558/249)
was inactive in our transgenic embryo assay (data not shown). These results
demonstrate that sequences upstream of 249 have no independent enhancer
activity and indicate that sequences between 249 and 48 in the
XMLC2 promoter can drive heart-specific expression. This minimal
region, like that defined by 5' truncation, encompasses two GATA sites
but in this case, however, they lie upstream of the CArG-like/YY1 motif rather
than flanking it.
|
-89/49;
Table 1) severely reduced (but
did not completely abolish) heart-specific transgene expression, but this was
largely restored by their replacement with heterologous DNA sequence
(Int
-89/49+40 bp; Table
1). This region may therefore be important for facilitating
promoter:enhancer interactions necessary for tissue-specific
transcription.
Proximal GATA sites are required for activity of XMLC2 promoter
Together, the results from deletion mutants indicate that the proximal
region of the promoter, which includes the three GATA motifs, is important for
myocardial expression of the XMLC2 promoter. To investigate the role
of GATA motifs further, we mutated them singly and in combination and tested
the effect on the normally robust expression driven by the 5'-681
promoter (PM-GATA series, Table
1). Mutation of any single GATA site
(Fig. 5A and data not shown;
Table 1) had little effect on
transgene expression, demonstrating that none of the GATA sites is
indispensable. Simultaneous inactivation of GATA#2 and GATA#3 reduced, but did
not abolish, cardiac-specific expression of the reporter
(Fig. 5B) but mutation of
GATA#1 together with GATA#2 abolished activity of the promoter
(Fig. 5C).
|
Inspection of the XMLC2 promoter sequence reveals that there are five additional GATA-like sites within the proximal 681 nucleotides of promoter, each comprising only the four nucleotide core of the binding site consensus (A/T GATA (A/G). Two of these lie between the GATA#2 and GATA#3 and it is conceivable that their presence in the GATA#2/GATA#3 double mutant supports the limited expression of this transgene.
XMLC2 promoter 123/41 region is sufficient for heart expression
Having established that regions encompassing a combination of GATA and
CArG-like/YY1binding sites are necessary for heart-specific expression of
transgenes, we next tested whether these sequences were sufficient to confer
this expression on a transgene containing a heterologous basal promoter. Two
copies of the sequence from 123 to 41 were cloned in front of a
transgene comprising the minimal promoter from the Xenopus
cytoskeletal actin gene driving GFP. This resulted in strong, heart-specific
expression in transgenic embryos, demonstrating that the sequence
123/41 is both necessary and sufficient for heart expression
(Fig. 4C). Similar tests using
a shorter sequence (121/81) resulted in expression of the
transgene only in the branchial arches
(Fig. 4D). This result suggests
that the minimal heart enhancer sequence requires both GATA binding sites.
Consistent with this interpretation, a transgene containing the promoter
region 85/42 was inactive in the tadpole heart
(Table 1).
CArG-like and YY1 sites are important for strong heart-restricted XMLC2 promoter activity
We next examined the contribution of the CArG-like/YY1 site lying within
the minimal heart enhancer. As YY1 has relaxed sequence requirements for
binding (Yant et al., 1995
),
we first used a gel shift assay to establish whether the motif in the proximal
XMLC2 promoter could indeed bind Xenopus YY1. Using a
tadpole nuclear or whole cell extract with the XMLC2 probe, we
obtained a specific complex that was competed by the presence of unlabelled
YY1-binding site sequence and blocked by anti-YY1 antibody
(Fig. 6A). By contrast, only
very low levels of complex were formed between the overlapping CArG-like
sequence and recombinant serum response factor
(Fig. 7A), a result that is
unsurprising given the single base mismatch between the XMLC2 motif
and the consensus binding site (CC(A/T)6GG) identified for this
protein (Pollock and Treisman,
1990
).
To assess the possible role of SRF or YY1 binding in regulating expression of the XMLC2 gene, we tested the effect of point mutations within the CArG-like/YY1 sequence on transgene expression. Mutations that inactivated SRF binding without affecting the overlapping YY1 site blocked all detectable expression of the transgene, indicating the importance of the CArG-like motif despite its low affinity for SRF (Table 1). Mutations blocking YY1 binding gave more complex results, transforming the consistently strong, heart-specific expression characteristic of the 5'-681 promoter into much more variable expression that was accompanied by ectopic transgene activity in the branchial arches and pronephros (Fig. 6B, Table 1 and data not shown). Finally, simultaneous mutation of both YY1 and CArG-like motifs also resulted in similar ectopic expression (Fig. 6C).
From these results we conclude that both the YY1 and CArG-like motifs are necessary for heart-specific expression from the XMLC2 promoter. The CArG-like sequence is important for any activity from the promoter while the YY1 site is necessary for suppression of ectopic expression. In the absence of a functional YY1-binding site, transgene expression encompasses not only the heart, but also other regions (such as branchial arches and pronephros) perhaps as a result of the more widespread expression of GATA factors. Our studies also suggest that in the absence of a functional YY1 site, levels of transgene expression within the heart are significantly reduced, indicating that YY1 binding may also have a second role as a positive regulator of heart-specific transcription. This would be consistent with other studies that have identified multiple roles for the YY1 protein (see Discussion).
GATA4 and SRF activate the XMLC2 promoter synergistically
Using a probe comprising the CArG-like motif and the adjacent GATA#2 site
(122/85), we found that SRF and GATA4 can simultaneously bind in
vitro to this region of the XMLC2 promoter
(Fig. 7A). Individually, the
importance of their binding is clear from our studies of transgene expression.
We next examined whether their combined effect as transcriptional activators
was additive, or whether simultaneous binding resulted in cooperative
stimulation of transcription. Using an animal cap explant assay, we tested the
capacity of SRF and GATA4 to transactivate a luciferase reporter driven by the
minimal heart enhancer region (123/41) fused to a heterologous
basal promoter. Overexpression of SRF gave only modest activation of the
reporter, while ectopic GATA4 expression was much more effective
(Fig. 7B). Simultaneous
overexpression of both factors clearly resulted in synergistic activation,
suggesting that functional interaction between a GATA factor (perhaps GATA4)
and SRF could play an important role in XMLC2 regulation. If such
interactions occur in vivo, their spatial requirements must be flexible
because our mapping studies demonstrate functional redundancy between the
GATA#2 and GATA#1 sites in the promoter
(Fig. 5).
XMLC2 promoter directs pan-myocardial expression in transgenic mice
Because the apparent counterpart of XMLC2 in mammals is expressed
only in atrial myocardium, the regulatory elements that direct pan-myocardial
expression of XMLC2 in the developing tadpole could represent a
specific adaptation of the cardiogenic program in amphibians. Alternatively,
they might constitute a regulatory mechanism conserved during vertebrate
evolution and perhaps modified in mammals to provide more restricted domains
of expression within the heart. To investigate this further, we tested the
expression of an XMLC2-lacZ transgene in transgenic mice.
Using the entire 3 kb of XMLC2 promoter sequence, three founder lines were obtained and in each case, staining for lacZ was first detected within the cardiac crescent (E7.5-8.0). In subsequent development, intense staining was detected throughout the linear and looped heart tube (Fig. 8A-G,J) and later in all four chambers of the embryonic heart (Fig. 8H,K). Such pan-myocardial expression was maintained in the chamber walls of the neonatal and adult mouse heart (Fig. 8I,L) but absent from the coronary arteries, valves and aorta (Fig. 8L,N,O). These results demonstrate that the regulatory mechanisms driving precise, pan-myocardial expression of XMLC2 in the tadpole are retained in the mouse.
|
| Discussion |
|---|
|
|
|---|
Combinatorial regulation of the XMLC2 promoter in embryos
Although we have identified the binding sites within the HE that are
required for its activity, we do not yet have unequivocal identification of
the factors that interact with this region of the promoter in vivo. The GATA
sites within HE are likely to be targets for GATA factors 4/5/6, and we have
shown that in vitro these factors can bind the XMLC2 promoter
(Fig. 5 and data not shown).
Similarly, we detected YY1 in embryonic extracts that is capable of binding to
the putative YY1 site within the HE (Fig.
6). Finally, the overlapping CArG-like site bound SRF with the low
affinity that might be predicted from its variant sequence
(Fig. 7)
(Pollock and Treisman, 1990
).
Assuming that the factors binding the HE in vivo are those suggested from our
in vitro experiments, the most important implication of our results is that
cardiac restricted activity of the HE results from combinatorial interactions
of factors which are themselves not tissue specific.
GATA4/5/6 factors are expressed in many endodermal cell types as well as in
the heart. They are transcriptional activators whose activity is regulated at
multiple levels, including posttranslational modifications and interactions
with other proteins (Molkentin,
2000
). As GATA factors are not restricted to a particular tissue,
the regulation of their activity, in particular through numerous binding
partners, has been proposed to provide specificity to their action. In the
context of cardiac-specific transcription, GATA4 has been shown to interact
with Nkx2.5, MEF2 and SRF. This latter interaction may play a role in
regulation of XMLC2 as well. We observed synergism between SRF and
GATA4, acting through GATA#2 site (Fig.
7). The only area of overlap of expression of GATA4 and SRF is in
the heart, and the observed interaction between these two factors may provide
a basis for cardiac-specific expression of XMLC2.
The role of YY1 in regulation of XMLC2
The HE contains a binding site for YY1 factor, which overlaps with the
CArG-like site. Inactivation of the YY1 site leads to broadening and weakening
of XMLC2 promoter activity. YY1 is known to act as both a repressor
and an activator in different contexts and our results can be interpreted in
light of these activities. Repressor activity of YY1 might be involved in
preventing expression in tissues other than cardiac muscle. More surprising
was our finding that mutation of the YY1 site frequently led to weaker
expression in the heart, indicating that YY1 might also be positively
regulating expression of XMLC2. We note that YY1 has previously been
shown to modulate the activity of Fos SRE by promoting loading of SRF
(Natesan and Gilman, 1995
) and
it is conceivable that such a mechanism may also be operating at the
YY1/CArG-like site within XMLC2 promoter. The affinity of CArG-like
site for SRF is inherently low (Fig.
7), and it will be interesting to establish whether the affinity
is altered in the presence of YY1. Ternary complex formation between GATA4 and
SRF may additionally stabilise the association of SRF with XMLC2
promoter (Figs 6 and
7)
(Belaguli et al., 2000
).
It is interesting to speculate that a dependence on YY1 for efficient
binding of SRF at the low affinity CArG-like site, could result in the HE
providing a more versatile regulatory element than could be obtained simply
with a high affinity CArG site. In addition to promoting positive regulation
by enhancing SRF loading onto the XMLC2 promoter in myocardial cells,
the presence of YY1 repressor at the promoter may also effectively suppress
ectopic activity in the somites, which contain high levels of SRF
(Latinki
et al.,
2002
). The potential for ectopic expression in the somites is
clearly revealed by mutations that simultaneously abolish YY1 binding and
transform the CArG-like motif into a high affinity SRF-binding site
(Table 1;
Fig. 6). Thus, both the
positive and negative activities of YY1 might be mediated via their effects on
SRF.
Besides acting as a transcription factor, YY1 has chromatin remodelling
activity and is known to cause DNA bending in vitro
(Natesan and Gilman, 1993
). We
have no direct evidence for involvement of chromatin remodelling in regulation
of XMLC2 promoter at the present. However, we note that several of
our observations point to the potential involvement of chromatin architecture
in regulation of XMLC2. The apparent structural role of the element
between the GATA#1 and CArG-like/YY1 sites (89/49 region)
strongly suggest that activity of the XMLC2 promoter depends on its
spatial organisation. The function of YY1 might be affected by deleting the
region 89/49. We have observed similar effects of mutating the
YY1 site and of reducing the spacing between the basal promoter and CArG/YY1
site (Table 1,
89/49). Both mutations lead to weakening and broadening of the
XMLC2 promoter activity in the head region of transgenic embryos.
This interpretation is supported by previous studies that have shown
spacing-and orientation-dependent activity of YY1
(Natesan and Gilman, 1993
).
Finally, we have observed that the XMLC2 promoter can compensate for
a loss of any single GATA site, presumably by relying on the remaining GATA
sites (Fig. 5). Such
compensation requires new interactions between active elements and the basal
promoter and presumably depends on changes in chromatin conformation.
Our finding that YY1 apparently participates in regulating heart-specific
expression of XMLC2 transgenes provides at least some explanation for
the absence of XMLC2 transcription in axial muscle of the embryo.
Cell culture studies with the chick cardiac MLC2 gene have also
provided evidence for other inhibitory factors that may block transcription in
skeletal muscle cells (Dhar et al.,
1997
) and it remains to be seen whether such factors also regulate
XMLC2 expression in the developing embryo.
In the present study, we could not reduce the sequence requirements for heart expression beyond the HE, as transgenes containing only its subregions, 122/85 and 80/45 are not expressed in the heart. This strongly suggests that the sites present in the two halves of HE interact to create a new composite function. According to our results, the 80/45 region provides two elements: a single functional enhancer element, GATA#1, and 89/49, whose role is structural. One possibility is that the GATA#1 site, which has a similar affinity for GATA4 factor as GATA#2 site (Fig. 5), is nevertheless unique and cannot be functionally substituted by the GATA#2 site. We believe it more likely that the intervening sequence 89/49 is required to maintain optimal spatial organisation of the promoter-enhancer interaction. It will be of interest to determine the molecular basis for these observations in the future.
The role of the CArG-like site
One striking result of our study is the absolute requirement of the
proximal XMLC2 promoter for the low-affinity CArG-like box within the
HE. Mutation of this element created an inactive promoter even in the presence
of 671 bp of proximal promoter sequence
(Table 1). Although expression
from the XMLC2 promoter is likely to depend on cooperative
interactions between multiple factors, it is nevertheless surprising that
elimination of one binding site has such a dramatic effect. The powerful
transcriptional activator myocardin acts via direct interactions with SRF
(Wang et al., 2001
) and one
possibility is that elimination of the CArG-like site prevents myocardin from
activating transcription of the reporter gene. However, it has also been
suggested that myocardin may require multiple SRF binding sites for activity
(Wang et al., 2001
) and if so,
its involvement in XMLC2 expression may be questioned. An alternative
explanation might be that in CArG-like mutants, the repressor activity of YY1
predominates. Consistent with this, simultaneous mutation of both CArG-like
and overlapping YY1 motifs uncovers residual promoter activity that includes
expression in the heart (Fig.
6).
MEF2 factors and XMLC2 transcription
Our studies of XMLC2 gene transcription were initially prompted by
the observation that ectopic expression of the MEF2 factor, MEF2D, in
Xenopus animal cap explants resulted in precocious activation of the
endogenous XMLC2 gene (Chambers et
al., 1994
). As MEF2D is expressed in the presumptive heart region,
these results suggested that MEF2D might play an important role in regulating
transcription of XMLC2. Members of the MEF2 family are also highly
expressed in axial, somitic muscle of the embryo and these findings therefore
left the absence of XMLC2 expression in the myotomes unexplained.
Several potential MEF2 binding sites are present in the 3 kb of XMLC2
promoter (Fig. 2) and each of
these can bind MEF2 factors in vitro (B.C. and T.M., unpublished). However, in
our current study, we have found that the MEF2 binding sites are dispensable
for promoter activity (Fig. 3).
This could indicate that the earlier results were an artefact resulting from
inducing high levels of a transcriptional activator capable of binding the
XMLC2 promoter. Alternatively, the current results could simply
reflect the nature of our transgenic assay, which only provides unequivocal
evidence for binding sites that are indispensable for transgene activity.
Furthermore, MEF2 factors may still play a role in regulation of
XMLC2 promoter constructs in which MEF2-binding sites have been
eliminated, as MEF2 proteins are capable of forming a complex with DNA-bound
GATA4, without binding the DNA itself
(Morin et al., 2000
).
Pan-myocardial expression of XMLC2
Despite repeated efforts, only a single MLC2 gene has been
isolated in Xenopus and cDNA screening suggests that a single gene is
also present in the urodele amphibian, Ambystoma mexicanum (T.M.,
unpublished results). In both cases, the gene is expressed throughout the
entire myocardium, even after differentiation of distinct atrial and
ventricular chambers. By contrast, the mammalian MLC2a and
MLC2v genes are progressively restricted in their domains of
expression during cardiogenesis, yielding reciprocal patterns of expression in
the atria and ventricles, respectively. The precise evolutionary relationship
between the amphibian and mammalian genes is unclear although within their
coding regions, the amphibian genes most closely resemble the MLC2a
sequence. There is only limited similarity between the mouse MLC2a
and Xenopus MLC2 genes in the proximal promoter region, most notably
common GATA and CArG sites in the proximal region (data not shown).
Our transgenic studies demonstrate that whatever the precise mechanisms
driving pan-myocardial expression of XMLC2 in the tadpole, the same
regulatory controls are present in the mouse embryo even though the endogenous
MLC2a and MLC2v genes are not themselves expressed in this
manner. On the basis of this, it is tempting to speculate that the
panmyocardial program retained in modern amphibians represents an ancient
regulatory program. The regional patterns of expression shown by the mammalian
MLC2 genes could indicate that the pan-myocardial program has been
lost; however, the expression of the XMLC2 transgene in mouse embryos
suggests otherwise. The alternative is that the panmyocardial program has been
transformed in mammals by additional regulatory controls that restrict
expression of individual MLC2 genes to particular regions of the
myocardium. If this hypothesis is correct, it should be possible to identify
elements within, for example, the murine MLC2a promoter, which might
impose atrial-specific expression on the XMLC2 promoter. A similar
type of analysis has, for example, recently demonstrated that the ANF
promoter can dominantly impose transcriptional repression of transcription on
the cardiac Troponin I promoter in the atrio-ventricular canal of the
embryonic mouse heart (Habets et al.,
2002
).
Conclusions
Our studies show that myocardial-specific transcription from the
Xenopus MLC2 promoter depends upon a remarkably small region of the
proximal promoter and have indicated at least some of the likely DNA-binding
factors involved. It should now be possible to examine the precise
interactions of these regulators and the participation of any co-factors in
establishing cardiac muscle-specific transcription during development of the
tadpole heart. Our finding that panmyocardial expression of XMLC2
transgenes is conserved between frogs and mice indicates that such regulatory
mechanisms are likely to be conserved among vertebrates.
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Belaguli, N. S., Sepulveda, J. L., Nigam, V., Charron, F.,
Nemer, M. and Schwartz, R. J. (2000). Cardiac tissue
enriched factors serum response factor and GATA-4 are mutual coregulators.
Mol. Cell Biol. 20,7550
-7558.
Bhalla, S. S., Robitaille, L. and Nemer, M.
(2001). Cooperative activation by GATA-4 and YY1 of the cardiac
B-type natriuretic peptide promoter. J. Biol. Chem.
276,11439
-11445.
Bruneau, B. G. (2002). Transcriptional
regulation of vertebrate cardiac morphogenesis. Circ.
Res. 90,509
-519.
Chambers, A. E., Kotecha, S., Towers, N. and Mohun, T. J.
(1992). Muscle-specific expression of SRF-related genes in the
early embryo of Xenopus laevis. EMBO J.
11,4981
-4991.[Medline]
Chambers, A. E., Logan, M., Kotecha, S., Towers, N., Sparrow, D.
and Mohun, T. J. (1994). The RSRF/MEF2 protein SL1
regulates cardiac muscle-specific transcription of a myosin light-chain gene
in Xenopus embryos. Genes Dev.
8,1324
-1334.
Charron, F. and Nemer, M. (1999). GATA
transcription factors and cardiac development. Semin. Cell Dev.
Biol. 10,85
-91.[CrossRef][Medline]
Christoffels, V. M., Habets, P. E., Franco, D., Campione, M., de
Jong, F., Lamers, W. H., Bao, Z. Z., Palmer, S., Biben, C., Harvey, R.
P. et al. (2000). Chamber formation and morphogenesis in the
developing mammalian heart. Dev. Biol.
223,266
-278.[CrossRef][Medline]
Cripps, R. M. and Olson, E. N. (2002). Control
of cardiac development by an evolutionarily conserved transcriptional network.
Dev. Biol. 246,14
-28.[CrossRef][Medline]
Dhar, M., Mascareno, E. M. and Siddiqui, M. A.
(1997). Two distinct factor-binding DNA elements in cardiac
myosin light chain 2 gene are essential for repression of its expression in
skeletal muscle. Isolation of a cDNA clone for repressor protein Nished.
J. Biol. Chem. 272,18490
-18497.
Ficzycz, A., Eskiw, C., Meyer, D., Marley, K. E., Hurt, M. and
Ovsenek, N. (2001). Expression, activity, and
subcellular localization of the Yin Yang 1 transcription factor in Xenopus
oocytes and embryos. J. Biol. Chem.
276,22819
-22825.
Fire, A., Harrison, S. W. and Dixon, D. (1990).
A modular set of lacZ fusion vectors for studying gene expression in
Caenorhabditis elegans. Gene
93,189
-198.[CrossRef][Medline]
Fishman, M. C. and Olson, E. N. (1997). Parsing
the heart: genetic modules for organ assembly. Cell
91,153
-156.[CrossRef][Medline]
Franco, D., Markman, M. M., Wagenaar, G. T., Ya, J., Lamers, W.
H. and Moorman, A. F. (1999). Myosin light chain 2a
and 2v identifies the embryonic outflow tract myocardium in the developing
rodent heart. Anat. Rec.
254,135
-146.[CrossRef][Medline]
Grepin, C., Dagnino, L., Robitaille, L., Haberstroh, L.,
Antakly, T. and Nemer, M. (1994). A hormone-encoding
gene identifies a pathway for cardiac but not skeletal muscle gene
transcription. Mol. Cell Biol.
14,3115
-3129.
Habets, P. E., Moorman, A. F., Clout, D. E., van Roon, M. A.,
Lingbeek, M., van Lohuizen, M., Campione, M. and Christoffels, V.
M. (2002). Cooperative action of Tbx2 and Nkx2.5 inhibits
ANF expression in the atrioventricular canal: implications for
cardiac chamber formation. Genes Dev.
16,1234
-1246.
Habets, P. E., Moorman, A. F. and Christoffels, V. M.
(2003). Regulatory modules in the developing heart.
Cardiovasc. Res. 58,246
-263.
Harvey, R. P. (2002). Patterning the vertebrate
heart. Nat. Rev. Genet.
3, 544-556.[CrossRef][Medline]
Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K. and Pease,
L. R. (1989). Site-directed mutagenesis by overlap extension
using the polymerase chain reaction. Gene
77, 51-59.[CrossRef][Medline]
Howell, M., Itoh, F., Pierreux, C. E., Valgeirsdottir, S., Itoh,
S., ten Dijke, P. and Hill, C. S. (1999). Xenopus
Smad4beta is the co-Smad component of developmentally regulated transcription
factor complexes responsible for induction of early mesodermal genes.
Dev. Biol. 214,354
-369.[CrossRef][Medline]
Ip, H. S., Wilson, D. B., Heikinheimo, M., Tang, Z., Ting, C.
N., Simon, M. C., Leiden, J. M. and Parmacek, M. S.
(1994). The GATA-4 transcription factor transactivates the
cardiac muscle-specific troponin C promoter-enhancer in nonmuscle cells.
Mol. Cell Biol. 14,7517
-7526.
Kelley, C., Blumberg, H., Zon, L. I. and Evans, T.
(1993). GATA-4 is a novel transcription factor expressed in
endocardium of the developing heart. Development
118,817
-827.[Abstract]
Kelly, R. G., Zammit, P. S. and Buckingham, M. E.
(1999). Cardiosensor mice and transcriptional subdomains of the
vertebrate heart. Trends Cardiovasc. Med.
9, 3-10.[CrossRef][Medline]
Ko, L. J. and Engel, J. D. (1993). DNA-binding
specificities of the GATA transcription factor family. Mol. Cell
Biol. 13,4011
-4022.
Kroll, K. L. and Amaya, E. (1996). Transgenic
Xenopus embryos from sperm nuclear transplantations reveal FGF signaling
requirements during gastrulation. Development
122,3173
-3183.[Abstract]
Latinki
, B. V., Cooper, B., Towers, N., Sparrow, D.,
Kotecha, S. and Mohun, T. J. (2002). Distinct
enhancers regulate skeletal and cardiac muscle-specific expression programs of
the cardiac alpha-actin gene in Xenopus embryos. Dev.
Biol. 245,57
-70.[CrossRef][Medline]
McKnight, S. L. and Kingsbury, R. (1982).
Transcriptional control signals of a eukaryotic protein-coding gene.
Science 217,316
-324.
Mohun, T., Garrett, N. and Treisman, R. (1987).
Xenopus cytoskeletal actin and human c-fos gene promoters share a conserved
protein-binding site. EMBO J.
6, 667-673.[Medline]
Mohun, T. J., Latinki
, B., Towers, N. and Kotecha,
S. (2002). Regulation of cardiac differentiation in
Xenopus laevis embryos. In The Cardiovascular
System, Vol. 67, pp.13
-18. Cold Spring Harbor Laboratory, NY: Cold Spring
Harbor Laboratory Press.
Molkentin, J. D. (2000). The zinc
finger-containing transcription factors GATA-4, -5, and -6.Ubiquitously
expressed regulators of tissue-specific gene expression. J. Biol.
Chem. 275,38949
-38952.
Molkentin, J. D., Kalvakolanu, D. V. and Markham, B. E.
(1994). Transcription factor GATA-4 regulates cardiac
muscle-specific expression of the alpha-myosin heavy-chain gene.
Mol. Cell Biol. 14,4947
-4957.
Morin, S., Charron, F., Robitaille, L. and Nemer, M.
(2000). GATA-dependent recruitment of MEF2 proteins to target
promoters. EMBO J. 19,2046
-2055.[CrossRef][Medline]
Natesan, S. and Gilman, M. Z. (1993). DNA
bending and orientation-dependent function of YY1 in the c-fos promoter.
Genes Dev. 7,2497
-2509.
Natesan, S. and Gilman, M. (1995). YY1
facilitates the association of serum response factor with the c-fos serum
response element. Mol. Cell Biol.
15,5975
-5982.[Abstract]
Norman, C., Runswick, M., Pollock, R. and Treisman, R.
(1988). Isolation and properties of cDNA clones encoding SRF, a
transcription factor that binds to the c-fos serum response element.
Cell 55,989
-1003.[CrossRef][Medline]
Offield, M. F., Hirsch, N. and Grainger, R. M.
(2000). The development of Xenopus tropicalis transgenic lines
and their use in studying lens developmental timing in living embryos.
Development 127,1789
-1797.[Abstract]
Pollock, R. and Treisman, R. (1990). A
sensitive method for the determination of protein-DNA binding specificities.
Nucleic Acids Res. 18,6197
-6204.
Sambrook, J., Fritsch, E. F. and Maniatis, T.
(1989). Molecular Cloning: A Laboratory
Manual. Cold Spring Harbor Laboratory, NY: Cold Spring Harbor
Laboratory Press.
Sive, H. L., Grainger, R. M. and Harland, R. M.
(2000). Early Development of Xenopus laevis:
A Laboratory Manual. Cold Spring Harbor Laboratory, NY: Cold
Spring Harbor Laboratory Press.
Sparrow, D. B., Cai, C., Kotecha, S., Latinki
, B.,
Cooper, B., Towers, N., Evans, S. M. and Mohun, T. J.
(2000a). Regulation of the tinman homologues in Xenopus embryos.
Dev. Biol. 227,65
-79.[CrossRef][Medline]
Sparrow, D. B., Latinki
, B. and Mohun, T. J.
(2000b). A simplified method of generating transgenic Xenopus.
Nucleic Acids Res. 28,E12
.
Sucharov, C. C., Mariner, P. D., Bristow, M. R., Long, C. S. and
Leinwand, L. A. (2003). YY1 is increased in human
heart failure and represses the activity of the human alpha MyHC promoter.
J. Biol. Chem. 278,31233
-31239.
Thomas, M. J. and Seto, E. (1999). Unlocking
the mechanisms of transcription factor YY1: are chromatin modifying enzymes
the key? Gene 236,197
-208.[CrossRef][Medline]
Wang, D., Chang, P. S., Wang, Z., Sutherland, L., Richardson, J.
A., Small, E., Krieg, P. A. and Olson, E. N. (2001).
Activation of cardiac gene expression by myocardin, a transcriptional cofactor
for serum response factor. Cell
105,851
-862.[CrossRef][Medline]
Yant, S. R., Zhu, W., Millinoff, D., Slightom, J. L., Goodman,
M. and Gumucio, D. L. (1995). High affinity YY1
binding motifs: identification of two core types (ACAT and CCAT) and
distribution of potential binding sites within the human beta globin cluster.
Nucleic Acids Res. 23,4353
-4362.
Zaffran, S. and Frasch, M. (2002). Early
signals in cardiac development. Circ. Res.
91,457
-469.
Related articles in Development:
This article has been cited by other articles:
![]() |
C. Furman, A. L. Sieminski, A. V. Kwiatkowski, D. A. Rubinson, E. Vasile, R. T. Bronson, R. Fassler, and F. B. Gertler Ena/VASP is required for endothelial barrier function in vivo J. Cell Biol., November 19, 2007; 179(4): 761 - 775. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Pasquet, F. Naye, C. Faucheux, O. Bronchain, A. Chesneau, P. Thiebaud, and N. Theze Transcription Enhancer Factor-1-dependent Expression of the {alpha}-Tropomyosin Gene in the Three Muscle Cell Types J. Biol. Chem., November 10, 2006; 281(45): 34406 - 34420. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Rottbauer, G. Wessels, T. Dahme, S. Just, N. Trano, D. Hassel, C. G. Burns, H. A. Katus, and M. C. Fishman Cardiac Myosin Light Chain-2: A Novel Essential Component of Thick-Myofilament Assembly and Contractility of the Heart Circ. Res., August 4, 2006; 99(3): 323 - 331. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-E. Huot, N. Bisson, L. Davidovic, R. Mazroui, Y. Labelle, T. Moss, and E. W. Khandjian The RNA-binding Protein Fragile X-related 1 Regulates Somite Formation in Xenopus laevis Mol. Biol. Cell, September 1, 2005; 16(9): 4350 - 4361. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Small, A. S. Warkman, D.-Z. Wang, L. B. Sutherland, E. N. Olson, and P. A. Krieg Myocardin is sufficient and necessary for cardiac gene expression in Xenopus Development, March 1, 2005; 132(5): 987 - 997. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sakamaki, C. Takagi, K. Kominami, S.-i. Sakata, Y. Yaoita, H. Y. Kubota, M. Nozaki, S. Yonehara, and N. Ueno The adaptor molecule FADD from Xenopus laevis demonstrates evolutionary conservation of its pro-apoptotic activity Genes Cells, December 1, 2004; 9(12): 1249 - 1264. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Morgan, J. M. Woltering, P. M. J. In der Rieden, A. J. Durston, and J. P. Thiery YY1 Regulates the Neural Crest-associated slug Gene in Xenopus laevis J. Biol. Chem., November 5, 2004; 279(45): 46826 - 46834. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-H. Lee, S. Evans, T. Y. Ruan, and A. B. Lassar SMAD-mediated modulation of YY1 activity regulates the BMP response and cardiac-specific expression of a GATA4/5/6-dependent chick Nkx2.5 enhancer Development, October 1, 2004; 131(19): 4709 - 4723. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||