spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 14 January 2004
doi: 10.1242/dev.00976


Development 131, 725-732 (2004)
Published by The Company of Biologists 2004


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Supplemental Figures
Right arrowOA All Versions of this Article:
dev.00976v1
131/4/725    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Karagiosis, S. A.
Right arrow Articles by Ready, D. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Karagiosis, S. A.
Right arrow Articles by Ready, D. F.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Moesin contributes an essential structural role in Drosophila photoreceptor morphogenesis

Sue A. Karagiosis and Donald F. Ready*

Department of Biological Sciences, Purdue University, West Lafayette, Indiana 47907, USA

* Author for correspondence (e-mail: dready{at}bilbo.bio.purdue.edu)

Accepted 11 November 2003


    SUMMARY
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Ezrin-Radixin-Moesin (ERM) family proteins organize heterogeneous sub-plasma membrane protein scaffolds that shape membranes and their physiology. In Drosophila oocytes and imaginal discs, epithelial organization, fundamental to development and physiology, is devastated by the loss of Moesin. Here, we show that Moesin is crucial for Drosophila photoreceptor morphogenesis. Beyond its requirement for retinal epithelium integrity, Moesin is essential for the proper assembly of the apical membrane skeleton that builds the photosensitive membrane, the rhabdomere. Moesin localizes to the rhabdomere base, a dynamic locus of cytoskeletal reorganization and membrane traffic. Downregulation of Moesin through RNAi or genetic loss of function profoundly disrupts the membrane cytoskeleton and apical membrane organization. We find normal levels and distribution of Moesin in photoreceptors of a Moesin mutant previously regarded as protein null, suggesting alternative interpretations for studies using this allele. Our results show an essential structural role for Moesin in photoreceptor morphology.

Key words: Moesin, ERM, Morphogenesis, Photoreceptor, Cytoskeleton, F-actin, Drosophila melanogaster


    Introduction
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
ERM proteins, dynamic, regulated membrane-cytoskeleton linkers essential to apical membrane traffic and regulation (Bretscher et al., 2002Go; Reczek and Bretscher, 2001Go), are attractive candidates to coordinate pathways of cellular morphogenesis. Protein family members contain a conserved N-terminal FERM (4.1-Ezrin-Radixin-Moesin) domain that binds cytoplasmic domains of transmembrane proteins directly or indirectly through coupling proteins and a C-terminal F-actin binding domain. ERM proteins are present in cytoplasm as dormant, non-phosphorylated monomers, and are recruited to plasma membranes and activated there by phosphatidylinositol 4,5-bisphosphate [PtdIns(4,5)P2]-binding and phosphorylation of a C-terminal threonine; upon phosphorylation, binding sites masked by intramolecular association are exposed (Bretscher et al., 1997Go; Pearson et al., 2000Go).

Initially identified as a component of the intestinal brush border membrane cytoskeleton, ERM proteins are broadly associated with actin-rich membrane projections, including microvilli and lamellipodia (Berryman et al., 1993Go). A role for ERM proteins in actin-based morphogenesis is supported by in vitro observations: downregulation of ERM proteins in cultured cells disrupts membrane protrusions (Amieva et al., 1999Go), and expression of a constitutively active ERM protein produces a profusion of microvilli (Oshiro et al., 1998Go). In addition to demonstrated structural roles, ERM proteins localize important signalling regulators, including EBP50/NHERF, a regulatory subunit of the sodium-proton pump RhoGDI and others (Hamada et al., 2001Go; Takahashi et al., 1997Go; Short et al., 1998Go).

The single Drosophila ERM gene, Moesin (McCartney and Fehon, 1996Go), facilitates genetic studies, and Moesin loss in flies results in developmental defects including an inability to correctly localize maternal determinants during oocyte development (Jankovics et al., 2002Go; Polesello et al., 2002Go), cytoskeletal abnormalities (Polesello et al., 2002Go) and a breakdown of epithelial integrity (Speck et al., 2003Go). Genetic interactions, notably increased survival of Moe mutant flies in a Rho-reduced background, have suggested Moesin facilitates epithelial morphology by antagonizing Rho activity rather than contributing a structural role (Speck et al., 2003Go). The role of ERM proteins in the orchestration of complex terminal differentiation is largely unexplored.

Photoreceptor sensory organelles, the outer segments of vertebrate rod and cone photoreceptors and the rhabdomeres of arthropods, are extravagant products of a common program of epithelial differentiation: apical membrane expansion and specialization. During photoreceptor terminal differentiation, directed membrane traffic enormously amplifies a central domain of the apical membrane of the cell, and the cytoskeleton folds it into a compact stack rich in Rhodopsin and associated proteins of the phototransduction cascade. Moesin knockout mice reveal few defects (Doi et al., 1999Go); however, strong interpretation of this result is complicated by redundancy with remaining family members Ezrin and Radixin. In Drosophila, loss of epithelial integrity in Moesin mutants confounds investigation of the role of the protein in the epithelium-derived retina; mechanical integrity of the retinal epithelium is a foundation of photoreceptor morphogenesis. Epithelial integrity is preserved in mosaic eyes homozygosed for Moesin null alleles later in development and in eyes in which Moesin is reduced by stage-specific RNAi expression, permitting analysis of the protein in terminal differentiation. Here we show that Moesin contributes an essential structural role in Drosophila photoreceptor morphogenesis.


    Materials and methods
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Fly strains and genetics
w1118 was used as wild type. Flies were raised on a standard cornmeal diet at 20°C. Pupae were developmentally staged by the collection of white prepupae (0% pupal development). From white prepupae to eclosion lasts approximately 172 hours at 20°C; percentage pupal development (% pd) was measured by staging flies from the white prepupae stage to the desired time in development, and then dividing this number of hours by 172 to give the % pd. To generate somatic Moe- eye clones, the FRT/FLP (Golic et al., 1997Go) system of recombination was used by crossing y, w, MoePL54, FRT101/FM0 and y, w, MoeX5, FRT101/FM0 females (F. Payre, Centre de Biologie du Developement, France) to ovoD1, FRT101; hs-FLP males, and the second-third instar progeny were given two 1-hour, 37°C heat shocks, separated by 4 hours. To rescue lethality of the MoePL54 allele, UAS Moesin GFP was first recombined with Act5C>Gal4 and maintained over the SM1 balancer. Male Act5C>Gal4, UAS Moesin GFP/SM1 flies were then crossed to virgin y, w, MoePL54, FRT101/FM0 flies, and y, w, MoePL54/Y; Act5C>Gal4, UAS Moesin GFP/+ progeny were examined. Hemizygous and homozygous MoeG0323 adults in a reduced Rho background were generated by crossing MoeG0323/FM7i, P{ActGFP}; Rho172R/CyO, P{ActGFP} females to MoeG0323/Dp(1;Y)619, B males (R. Fehon, Duke University).

Molecular biology
Two different constructs encoding Moesin inverted repeats (IRMoesin) were generated by amplifying the Moesin coding sequence (GenBank Accession Number L38909) from positions 327-775 bp and 818-1236 bp by polymerase chain reaction (PCR), using primers that introduced unique restriction sites at the product ends. Each of the DNA fragments were subcloned, in opposite orientations, into AvrII and NheI sites of the pWIZ plasmid (a gift from R. Carthew, Northwestern University) to produce perfect hairpin RNA loops following splicing under the UAS/Gal4 promoter. The pUAST-derived vectors UAS IR-Moe [327-775] and UAS IR-Moe [818-1236] were introduced into the germline by P-element-mediated transformation. Independent transformant lines were established and mapped. Several different UAS IR-Moe [327-775] and UAS IR-Moe [818-1236] lines were tested for double-stranded RNA interference (RNAi) activity by crossing to Gal4 drivers and immunostaining with anti-Moesin antibody.

The full-length UAS Moesin Myc, UAS Moesin GFP and phosphomimetic UAS T559D Moesin Myc transgenic lines were generated by first amplifying the full-length Moesin cDNA by PCR to introduce unique restriction sites at the product ends and then ligating it into pBluescript (Stratagene, La Jolla, CA). A synthetic mutation primer, CGTGACAAGTACAAAGATCTCCGCGAGATTCGTAAGGG, was used to mutate Thr559 to Asp and silently introduce a BglII site. The Myc epitope tag or green fluorescent protein (GFP) was introduced in-frame at the C terminus of Moesin by ligation of a 6-Myc repeat from pCS2+MT (Rupp et al., 1994Go) or GFP from pBD1010 (B. Dickson, Research Institute of Molecular Pathology). Each sequence was confirmed and subcloned into pUAST. Independent lines, on the second or third chromosome, were generated with P-element-mediated germline transformation. All transgenic lines were expressed by Gal4/UAS-targeted expression (Brand and Perrimon, 1993Go).

Temperature shifts
Pupae were maintained at 20°C during non-heat shock conditions. A thermocycler was used to conduct a series of heat shocks at 37°C for 45 minutes each. Between the temperature shifts to 37°C, the flies rested at 20°C for 3 hours and 15 minutes. UAS Moesin GFP/+; hsGal4/+, UAS Moesin Myc/+; hsGal4/+ and UAS IR-Moesin/+; hsGal4/+ pupae received two heat shocks. UAS T559D Moesin Myc/+; hsGal4/+ pupae received five heat shocks. After the final heat shock, flies recovered at 20°C for 6-8 hours before dissection.

Immunolocalization and western analysis
Immunostaining and F-actin localization were performed with whole-mount preparations as described (Fan and Ready, 1997Go), with the following exceptions noted. After dissection, the retina was immediately immersed in PLP fixative (10 mM periodate, 75 mM lysine, 2% paraformaldehyde in 1x PBS) with 0.05% saponin for 20 minutes. Eyes were washed for 10 minutes, three times with 50 mM NH4Cl in PBS. Moesin was visualized using anti-Moesin antiserum at 1:5000 dilution (D. Keihart, Duke University). For activated Moesin (p-Moesin) visualization, a rabbit antibody against the Thr phosphorylated Moesin peptide (C-R553-D-K-T-K-phosphoT-L-R-QI-R563) was generated (Bethyl, Montgomery, TX) and used at 1:500. To immunolocalize dominant-active Moesin, Myc antibody 9E10 was used at 1:50 dilution. Retinas were incubated overnight in 1:300 diluted primary for Crumbs (U. Tepass, University of Toronto) visualization. All whole mounts were examined with a Bio-Rad MRC-1024 confocal microscope using a 60x objective lens. Images were processed using Adobe Photoshop 7.0. Western analysis of 1-day-old adult whole head extract was performed as previously described (Satoh et al., 1997Go), with the following modification: anti-Moesin antiserum was used at 1:20,000 dilution. Transmission electron microscopy was carried out as described (Fan and Ready, 1997Go).


    Results
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Crumbs and Moesin define photoreceptor apical membranes
We used confocal immunofluorescence to observe the membrane cytoskeleton during photoreceptor differentiation (Fig. 1). Adult Drosophila photoreceptor apical plasma membranes are organized into complementary domains: the photosensory rhabdomere and an adjacent supporting membrane, the stalk (Fig. 1A). Rhabdomeres are columns of closely packed, photosensitive microvilli; a collar of stiffened membrane, the stalk, flanks rhabdomeres and supports them on the optical axis of the eye. Prominent coated pits and vesicles in the stalk pocket (Fig. 1A, inset) suggest a special role for the stalk in endocytosis. Molecular specialization of the apical membrane cytoskeleton supports rhabdomeres: microfilaments thread each microvillus (Arikawa et al., 1990Go), and a terminal web of F-actin extends from the rhabdomere base into the cytoplasm (Chang and Ready, 2000Go). Activated, phosphorylated Moesin (p-Moesin) localizes to the rhabdomere base and the polarity determinant transmembrane protein Crumbs localizes to the stalk (Fig. 1B) (Izaddoost et al., 2002Go; Pellikka et al., 2002Go).



View larger version (173K):
[in this window]
[in a new window]
 
Fig. 1. Moesin and Crumbs define complementary subdomains of the photoreceptor apical surface. (A) Distinct apical membrane domains are evident in a transmission electron micrograph cross-section of an adult wild-type ommatidium: rhabdomeres, closely-packed photosensitive microvilli and the stalk (S), collaring the rhabdomere and connecting to the adherens junctions (AJ). Both stalk and rhabdomere face the inter-rhabdomeral space (IRS). Stalks of photoreceptors R1-R6 are typically folded, often with coated pits in the pocket (inset). (B) Confocal micrograph shows activated Moesin (p-Moesin, green) localized to the rhabdomere base, and Crumbs (blue) localized to the stalk. Rhodamine-phalloidin (red) stains axial actin filaments of rhabdomere microvilli and the rhabdomere terminal web (RTW). (C) Rhabdomere and stalk primordial domains differentiate by 50% pupal development (pd). Rhabdomere primordia are covered with short finger-like microvilli, and the smooth membrane of the future stalk displays a cytoplasmic density typical of membranes heavily invested with cytoskeleton. (D) 50% pd, p-Moesin (green) has resolved to the rhabdomere base and Crumbs (blue) to the stalk. Crumbs localization parallels stalk morphology. Crumbs staining is not present in R1, R3 and R6 at this stage. Anterior is to the right in all figures. Scale bars: 1 µm in A,C; 10 µm in B,D.

 
Definitive rhabdomere and stalk primordia are established within the photoreceptor apical membrane at approximately 50% of pupal development (% pd) (Fig. 1C). Future rhabdomeres are covered with short, finger-like microvilli. Smooth membrane defines developing stalks of R2, R4 and R7, and the asymmetrical stalk of R5; R1, R3 and R6 lack stalks at this stage. Concomitant with morphological differentiation, Moesin and Crumbs resolve to their respective adult domains (Fig. 1D). The complementary distribution of these determinants of membrane/cytoskeleton interaction suggests that photoreceptor Moesin does not partner with Crumbs, as reported for embryonic epithelia (Medina et al., 2002Go). Before this stage, Moesin (see Fig. S1 at http://dev.biologists.org/supplemental/) and Crumbs extend fully across the apical surface. The absence of stalks and the lack of Crumbs staining in photoreceptors R1, R3 and R6 suggests Moesin does not require Crumbs to establish the rhabdomere base.

In order to visualize both active phosphorylated and dormant non-phosphorylated Moesin, we used Gal4/UAS-targeted expression of full-length wild-type Myc- and GFP-tagged Moesin. In fixed (Fig. 2A) and live cells (Fig. 2B), both tagged proteins distribute throughout the cytoplasm (Fig. 2A; asterisks) and concentrate at the apical membrane. Cytoplasmic staining probably represents the soluble, dormant Moesin.



View larger version (163K):
[in this window]
[in a new window]
 
Fig. 2. Rescue of MoePL54 lethality. (A) Confocal image of 50% pd hs>Moesin Myc retina shows F-actin staining (red) and full-length wild-type Moesin (anti-Myc, green). Myc-tagged Moesin concentrates at the rhabdomere base and is distributed throughout the cell cytoplasm (asterisks). Gal4/UAS transgenes show variable levels of protein expression in pupal eyes. (B) Confocal micrograph of a live 65% pd hs>Moesin GFP retina. Strong GFP signal is seen in rhabdomeres and pigment cell cytoplasm; lesser signal is also evident in photoreceptor cytoplasm. (C) Act5C>Moe-GFP rescues MoePL54 lethality. Confocal image of 70% pd retina shows F-actin staining (red) and Moesin-GFP (green) in the MoePL54 hemizygous background. Photoreceptors with the most severe defects show the lowest detectable levels of Moesin-GFP (arrowheads). Moesin-GFP concentrates at the rhabdomere base in cells expressing lower protein amounts (arrow). (D) Electron micrograph cross-section of a 1-day post-eclosion MoePL54/Y; Act5C>Moe-GFP adult ommatidium. Photoreceptors of Act5C>Moesin-GFP rescued MoePL54 contain imperfect rhabdomeres, frequently exhibiting defects in size and microvillar organization. Scale bars: 10 µm in A,B,C; 1 µm in D.

 
To test whether the GFP-tagged Moesin is functionally active, we introduced the transgene into MoePL54 (Polesello et al., 2002Go), a homozygous lethal Moe- background. Constitutive expression of Moesin-GFP using the Act5C>Gal4 promoter rescues MoePL54 viability. Ommatidia examined with confocal microscopy (Fig. 2C) and electron microscopy (Fig. 2D) frequently exhibit rhabdomere size and organization defects, including microvillar gaps. Moesin dosage may play a crucial role in the proper organization of the apical surface.

Moesin RNAi disorganizes photoreceptor apical membrane/cytoskeleton
As epithelial organization, which defines the context of photoreceptor differentiation, fails in flies lacking Moesin (Speck et al., 2003Go), we expressed IR-Moesin, a transgene carrying an inverted repeat sequence encoding a portion of Moesin to induce RNAi and downregulate Moesin late in eye development. Epithelial integrity is preserved in these eyes, permitting dissection of the role of Moesin in photoreceptor differentiation. The efficiency of UAS IR-Moesin downregulation of Moesin expression was assayed using immunolocalization. Using the heat shock>Gal4 driver (hs>Gal4) to drive the expression of UAS IR-Moesin in staged pupae, we found photoreceptor morphogenesis to be most sensitive to Moesin loss at the time of rhabdomere/stalk resolution, approximately 50% pd. At this stage, hs>IRMoesin expression completely abolished Moesin immunodetection in many photoreceptors (Fig. 3A; arrowheads). The membrane cytoskeleton, assayed by F-actin staining, is disorganized in photoreceptors lacking Moesin. Rhabdomeres of these eyes typically have reduced, irregular microvillar fields (Fig. 3B).



View larger version (124K):
[in this window]
[in a new window]
 
Fig. 3. Moesin RNAi disorganizes F-actin and apical microvilli. (A, C) Confocal micrographs show F-actin staining (red) and Moesin immunolocalization (green). (A) In a 57% pd hs>IR-Moesin retina, photoreceptors lacking Moesin (arrowheads) are reduced in size and exhibit abnormal F-actin distribution. The asterisked ommatidium (enlarged, right) shows lack of Moesin in R1, R3 and R7. (B) An electron micrograph of 57% pd hs>IR-Moesin ommatidium shows loosely organized rhabdomere microvilli (compare with Fig. 5A); the rhabdomere of R5 is reduced. (C) GMR>IR-Moesin photoreceptor apical membrane organization is devastated by Moesin loss. A single photoreceptor (arrowhead) retains strong Moesin signal and an intact rhabdomere. (D) Electron micrograph of 70% pd GMR>IR-Moesin ommatidium shows severe rhabdomere defects. The asterisked photoreceptor lacks a rhabdomere. Adherens junctions appear normal (B,D; arrows). Scale bars: 10 µm in A,C; 1 µm in B,D.

 
Expression of UAS IR-Moesin using the GMR>Gal4 driver, which becomes active soon after photoreceptors are fated in the retinal epithelium, severely disrupts actin cytoskeleton organization and apical differentiation (Fig. 3C,D). Distinct microvillar and stalk membranes are apparent, but are discontinuous and jumbled. It remains to be determined whether higher levels of IR-Moesin, or its expression during an especially sensitive period, account for the stronger phenotype of GMR>IR-Moesin eyes. Downregulation of Moesin during photoreceptor differentiation focuses defects on the rhabdomere; cells appear otherwise healthy and possess apparently normal adherens junctions (Fig. 3B,D; arrowheads), probably accounting for the preservation of epithelial integrity. Once established, adherens junctions may not require Moesin to maintain epithelial integrity; alternatively, severely reduced levels may be sufficient.

Genetic loss of Moesin likewise disrupts rhabdomere morphogenesis
As an alternate strategy to remove zygotic Moesin later in development, we generated eye clones homozygous for either of two Moesin alleles, MoePL54 and MoeX5, shown to be null or strong hypomorphs (Polesello et al., 2002Go). In pupal MoePL54 mosaic eyes, containing a mixture of Moesin-positive cells and cells with severely reduced Moesin, rhabdomeres of photoreceptors with immuno-undetectable Moesin show severely disrupted apical membranes (Fig. 4A; arrowheads). Assayed with rhodamine-phalloidin, the rhabdomere microvillar array in Moe- cells is irregular and the RTW is replaced with abnormal F-actin accumulations. In MoeX5 mosaic eyes, cells lacking Moesin are rarely observed, but ommatidia containing reduced numbers of photoreceptors are common, suggesting that the missing cells died or were otherwise lost from the developing retinal epithelium (Fig. 4B; asterisks).



View larger version (160K):
[in this window]
[in a new window]
 
Fig. 4. Genetic Moesin loss-of-function disrupts rhabdomere morphogenesis. Confocal micrographs show F-actin staining (red) and Moesin immunolocalization (green). (A) Photoreceptors lacking Moesin exhibit extreme F-actin disorganization at the apical surface (arrowheads) in homozygous null MoePL54 65% pd eye clones. (B) Photoreceptors are missing (asterisks) in 65% pd eye clones of a second allele, MoeX5. (C,D) Retinas of 1-day post-eclosion MoeG0323/MoeG0323; Rho172R/CyO flies show wild-type Moesin immunolocalization at the rhabdomere base in cross-section (C) and side view (D, arrowheads). In side view, Moesin is prominent on the apical surfaces of cone cells lying above the rhabdomeres. Scale bars: 10 µm.

 
Notably, a third hypomorphic allele, MoeG0323, in a Rho-reduced background, which was previously shown to lack Moesin during larval development (Speck et al., 2003Go), contains normal levels of Moesin at the rhabdomere base (Fig. 4C,D; arrowheads). Both hemizygous MoeG0323/Y; Rho172R/CyO and homozygous MoeG0323/MoeG0323; Rho172R/CyO adult retinas show normal photoreceptors and Moesin localization to the rhabdomere base. Western analysis of whole head extracts of these flies shows that Moesin is present, but at a reduced level (see Fig. S2 at http://dev.biologists.org/supplemental/).

Dominant-active Moesin inhibits apical membrane differentiation
To examine the role of Moesin activation in photoreceptor morphogenesis, we generated a transgenic line expressing a constitutively active phosphomimetic mutation, UAS T559D Moesin Myc (Oshiro et al., 1998Go), under Gal4/UAS control. When hs>T559D Moesin Myc is expressed during apical morphogenesis, a profusion of irregular microvilli dominates the apical surface (Fig. 5B). This result parallels observations in cell culture (Gautreau et al., 2000Go; Oshiro et al., 1998Go), where expression of T559D Moesin results in hyper-formation of irregular microvilli. Other cellular structures, including the adherens junctions (Fig. 5B; arrows), appear to be intact. Using confocal immunofluorescence, T559D Moesin Myc localizes to the entire photoreceptor plasma membrane and concentrates at the apical membrane (Fig. 5D). The failure of basolateral Moesin to generate microvilli suggests that additional, apically-limited proteins are needed to initiate rhabdomere microvilli. T559D Moesin severely disrupts the actin cytoskeleton (Fig. 5E), and Crumbs, which should resolve to the stalk, remains distributed across the entire apical surface (Fig. 5C). Failure of Crumbs to re-localize is a harbinger of the loss of stalk/rhabdomere distinction in photoreceptors expressing dominant-active Moesin. We speculate that dynamic turnover and regulation of the protein is important for morphogenesis, and the unregulated binding of dominant-active Moesin `freezes' the apical membrane (Coscoy et al., 2002Go), compromising its reorganization.



View larger version (122K):
[in this window]
[in a new window]
 
Fig. 5. Dominant-active T559D Moesin expression prevents photoreceptor apical regionalization. (A,B) Electron micrographs of 65% pd wild type (A) and hs>T559D Moesin Myc (B) ommatidium. The apical membrane, spanning between adherens junctions (A,B; arrows), is severely disorganized by T559D Moesin expression (B). In this ommatidium (B), R5 is less affected, showing clear rhabdomere and stalk domains, presumably due to lower levels of T559D Moesin expression. (C,D) The apical actin cytoskeleton is severely disrupted in dominant-active Moesin-expressing cells, and Crumbs (C) does not properly relocalize to the stalk. (D) The field in C, showing Crumbs staining (blue) merged with staining for F-actin (red) and Myc (green). Red rhabdomeres of `escaper' cells, not expressing T559D Moesin Myc, appear normal. (E) The ommatidium marked with an asterisk in D is shown at a higher magnification. T559D Moesin was not expressed equally in all cells in this ommatidium, as reflected by the lack of Myc staining in the asterisked R7. F-actin in the rhabdomere of R7 is orderly, and Crumbs was properly cleared from the rhabdomere membrane and localizes to the stalk. Compare with neighboring photoreceptors in D. Scale bars: 1 µm in A,B; 10 µm in D.

 

    Discussion
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Epithelial cell apical plasma membranes host elaborate membrane and sub-membrane protein assemblies that support sensory and effector mechanisms and are often amplified and highly structured by the actin membrane cytoskeleton. Substantial in vitro and in vivo evidence implicates Moesin in the genesis and regulation of this membrane cytoskeleton, and our results extend this connection to a role for Moesin in the morphogenesis of a complex, compartmented apical specialization, the Drosophila rhabdomere. The dynamic distribution of Moesin during photoreceptor development and the impact of Moesin gain-and loss-of-function during morphogenesis suggest an essential role for the protein in organizing the membrane skeleton that supports the microvillar array of the rhabdomere.

The developmental cues that restrict Moesin to the rhabdomere primordium at the onset of overt morphogenesis are not known. At this stage, photoreceptor apices contact each other in a stereotyped pattern of apical cell-cell contacts within a trapped apical pocket that will later open to form the IRS, suggesting that apical contacts may localize future rhabdomeres. In other systems, ERM proteins are recruited to plasma membranes and activated there by PtdIns(4,5)P2-binding and phosphorylation of a C-terminal threonine (Hirao et al., 1996Go; Matsui et al., 1998). Rhabdomeres are rich in PtdIns(4,5)P2, and Rhodopsin-activated cleavage of PtdIns(4,5)P2 by the phospholipase C NorpA is the substrate for Drosophila phototransduction (Hardie et al., 2001Go). A Moesin-organized nexus of phosphoinositide and actin organizing proteins at the rhabdomere base may represent an economical dual use of the system for structure and physiology.

The restriction of Moesin to the rhabdomere base and its loss-of-function phenotypes suggests that Moesin links microvillar cytoplasmic ends to the underlying actin cytoskeleton, the rhabdomere terminal web (RTW). The full molecular makeup of the Moesin-organized photoreceptor cytoskeleton and the nature of the forces it organizes during morphogenesis remain to be determined, but the catenary-like deformation of the rhabdomere base as developing microvilli elongate suggests the membrane cytoskeleton contributes a sub-apical constraint, a tensile sheet that contains the expanding photosensitive membrane in an orderly microvillar stack. In other systems, Moesin-organized protein scaffolds recruit potent regulators of membrane architecture and function, such as the small GTPase regulators RhoGDI (Hamada et al., 2001Go), RabGAPs and RhoGAPs (Reczek and Bretscher, 2001Go). It is plausible that the ability of Moesin to bind F-actin and its regulators may contribute to the establishment of the RTW. Rhabdomere membrane is in dynamic exchange across the rhabdomere base with endosomes of the photoreceptor cytoplasm (Bahner et al., 2002Go), and it is notable that ERM proteins bind to regulators of membrane recycling (Rochdi and Parent, 2003Go). Moesin may participate in the membrane exchange that supports a dynamic sensory membrane.

Recent observation that the lethality of flies homozygous for MoeG0323, considered a protein null, could be rescued in Rho-reduced flies was interpreted as showing that Moesin facilitates epithelial morphology not by providing an essential structural function, but rather by antagonizing activity of the small GTPase Rho (Speck et al., 2003Go). This conclusion rests on MoeG0323 being a protein null. Our observations that Rho-reduced MoeG0323 produces Moesin detectable by western analysis and shows photoreceptor Moesin immunostaining indistinguishable from wild type suggest alternate interpretations. One possibility is that the P-element insertion in the 5' untranslated region of MoeG0323 downregulates embryonic and larval Moesin, but can be over-ridden later in development in Rho-reduced animals. Such interpretation, while not ruling out a role for Moesin in Rho regulation, is compatible with present and previous evidence for a structural role for Moesin.

Given the fundamental parallels between Drosophila and vertebrate photoreceptors, it is interesting to consider whether the ERM-organized membrane cytoskeleton will play a similar role in human photoreceptor development and disease.

Note added in proof
Observations using photoreceptors from the leopard frog Rana implicate Moesin in rod outer segment biogenesis (Deretic et al., 2004Go).


    ACKNOWLEDGMENTS
 
We owe special thanks to R. Fehon and O. Speck for providing stocks and reagents prior to publication. We also thank U. Tepass, F. Payre and R. Carthew for their kind gifts of fly stocks, antibodies and plasmids. This work was supported by a GAANN fellowship to S.A.K. and NEI grant 10306 to D.F.R.


    Footnotes
 
Supplemental data available online


    REFERENCES
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 

Amieva, M. R., Litman, P., Huang, L. Q., Ichimaru, E. and Furthmayr, H. (1999). Disruption of dynamic cell surface architecture of NIH3T3 fibroblasts by the N-terminal domains of moesin and ezrin: in vivo imaging with GFP fusion proteins. J. Cell Sci. 112,111 -125.[Abstract]

Arikawa, K., Hicks, J. L. and Williams, D. S. (1990). Identification of Actin-Filaments in the Rhabdomeral Microvilli of Drosophila Photoreceptors. J. Cell Biol. 110,1993 -1998.[Abstract/Free Full Text]

Bahner, M., Frechter, S., Da Silva, N., Minke, B., Paulsen, R. and Huber, A. (2002). Light-regulated subcellular translocation of Drosophila TRPL channels induces long-term adaptation and modifies the light-induced current. Neuron 34, 83-93.[CrossRef][Medline]

Berryman, M., Franck, Z. and Bretscher, A. (1993). Ezrin is concentrated in the apical microvilli of a wide variety of epithelial-cells whereas moesin is found primarily in endothelial-cells. J. Cell Sci. 105,1025 -1043.[Abstract]

Brand, A. H. and Perrimon, N. (1993). Targeted gene-expression as a means of altering cell fates and generating dominant phenotypes. Development 118,401 -415.[Abstract]

Bretscher, A., Reczek, D. and Berryman, M. (1997). Ezrin: a protein requiring conformational activation to link microfilaments to the plasma membrane in the assembly of cell surface structures. J. Cell Sci. 110,3011 -3018.[Abstract]

Bretscher, A., Edwards, K. and Fehon, R. G. (2002). ERM proteins and merlin: integrators at the cell cortex. Nat. Rev. Mol. Cell Biol. 3, 586-599.[CrossRef][Medline]

Chang, H. Y. and Ready, D. F. (2000). Rescue of photoreceptor degeneration in rhodopsin-null Drosophila mutants by activated Rac1. Science 290,1978 -1980.[Abstract/Free Full Text]

Coscoy, S., Waharte, F., Gautreau, A., Martin, M., Louvard, D., Mangeat, P., Arpin, M. and Amblard, F. (2002). Molecular analysis of microscopic ezrin dynamics by two-photon FRAP. Proc. Natl. Acad. Sci. USA 99,12813 -12818.[Abstract/Free Full Text]

Deretic, D., Traverso, V., Parkins, N., Jackson, F., Rodriguez de Turco, E. B. and Ransom. N. (2004). Phosphoinositides, ezrin/moesin, and rac1 regulate fusion of rhodopsin transport carriers in retinal photoreceptors. Mol. Biol. Cell 15,359 -370.[Abstract/Free Full Text]

Doi, Y., Itoh, M., Yonemura, S., Ishihara, S., Takano, H., Noda, T. and Tsukita, S. (1999). Normal development of mice and unimpaired cell adhesion cell motility actin-based cytoskeleton without compensatory upregulation of ezrin or radixin in moesin gene knockout. J. Biol. Chem. 274,2315 -2321.[Abstract/Free Full Text]

Fan, S. S. and Ready, D. F. (1997). Glued participates in distinct microtubule-based activities in Drosophila eye development. Development 124,1497 -1507.[Abstract]

Gautreau, A., Louvard, D. and Arpin, M. (2000). Morphogenic effects of ezrin require a phosphorylation-induced transition from oligomers to monomers at the plasma membrane. J. Cell Biol. 150,193 -203.[Abstract/Free Full Text]

Golic, M. M., Rong, Y. S., Petersen, R. B., Lindquist, S. L. and Golic, K. G. (1997). FLP-mediated DNA mobilization to specific target sites in Drosophila chromosomes. Nucl. Acids Res. 25,3665 -3671.[Abstract/Free Full Text]

Hamada, K., Seto, A., Shimizu, T., Takeshi, M. B., Takai, Y., Tsukita, S. and Hakoshima, T. (2001). Crystallization and preliminary crystallographic studies of RhoGDI in complex with the radixin FERM domain. Acta Crystallogr. Section D-Biol. Crystallogr. 57,889 -890.

Hardie, R. C., Raghu, P., Moore, S., Juusola, M., Baines, R. A. and Sweeney, S. T. (2001). Calcium influx via TRP channels is required to maintain PIP2 levels in Drosophila photoreceptors. Neuron 30,149 -159.[CrossRef][Medline]

Hirao, M., Sato, N., Kondo, T., Yonemura, S., Monden, M., Sasaki, T., Takai, Y. and Tsukita, S. (1996). Regulation mechanism of ERM (ezrin/radixin/moesin) protein/plasma membrane association: possible involvement of phosphatidylinositol turnover and Rho-dependent signaling pathway. J. Cell Biol. 135, 37-51.[Abstract/Free Full Text]

Izaddoost, S., Nam, S. C., Bhat, M. A., Bellen, H. J. and Choi, K. W. (2002). Drosophila Crumbs is a positional cue in photoreceptor adherens junctions and rhabdomeres. Nature 416,178 -182.[CrossRef][Medline]

Jankovics, F., Sinka, R., Lukacsovich, T. and Erdelyi, M. (2002). MOESIN crosslinks actin and cell membrane in Drosophila oocytes and is required for OSKAR anchoring. Curr. Biol. 12,2060 -2065.[CrossRef][Medline]

Maeda, M., Doi, Y., Yonemura, S., Amano, M., Kaibuchi, K. and Tsukita, S. (1998). Rho-kinase phosphorylates COOH-terminal threonines of ezrin/radixin/moesin (ERM) proteins and regulates their head-to-tail association. J. Cell Biol. 140,647 -657.[Abstract/Free Full Text]

McCartney, B. M. and Fehon, R. G. (1996). Distinct cellular and subcellular patterns of expression imply distinct functions for the Drosophila homologues of moesin and the neurofibromatosis 2 tumor suppressor, merlin. J. Cell Biol. 133,843 -852.[Abstract/Free Full Text]

Medina, E., Williams, J., Klipfell, E., Zarnescu, D., Thomas, G. and Le Bivic, A. (2002). Crumbs interacts with moesin and beta(Heavy)-spectrin in the apical membrane skeleton of Drosophila. J. Cell Biol. 158,941 -951.[Abstract/Free Full Text]

Oshiro, N., Fukata, Y. and Kaibuchi, K. (1998). Phosphorylation of moesin by Rho-associated kinase (Rho-kinase) plays a crucial role in the formation of microvilli-like structures. J. Biol. Chem. 273,34663 -34666.[Abstract/Free Full Text]

Pearson, M. A., Reczek, D., Bretscher, A. and Karplus, P. A. (2000). Structure of the ERM protein moesin reveals the FERM domain fold masked by an extended actin binding tail domain. Cell 101,259 -270.[CrossRef][Medline]

Pellikka, M., Tanentzapf, G., Pinto, M., Smith, C., McGlade, C. J., Ready, D. F. and Tepass, U. (2002). Crumbs, the Drosophila homologue of human CRB1/RP12, is essential for photoreceptor morphogenesis. Nature 416,143 -149.[CrossRef][Medline]

Polesello, C., Delon, I., Valenti, P., Ferrer, P. and Payre, F. (2002). Dmoesin controls actin-based cell shape and polarity during Drosophila melanogaster oogenesis. Nat. Cell Biol. 4,782 -789.[CrossRef][Medline]

Reczek, D. and Bretscher, A. (2001). Identification of EPI64, a TBC/rabGAP domain-containing microvillar protein that binds to the first PDZ domain of EBP50 and E3KARP. J. Cell Biol. 153,191 -205.[Abstract/Free Full Text]

Rochdi, M. D. and Parent, J. L. (2003). G alpha(q)-coupled receptor internalization specifically induced by G alpha(q) signaling - regulation by EBP50. J. Biol. Chem. 278,17827 -17837.[Abstract/Free Full Text]

Rupp, R. A. W., Snider, L. and Weintraub, H. (1994). Xenopus-embryos regulate the nuclear-localization of Xmyod. Genes Dev. 8,1311 -1323.[Abstract/Free Full Text]

Satoh, A. K., Tokunaga, F., Kawamura, S. and Ozaki, K. (1997). In situ inhibition of vesicle transport and protein processing in the dominant negative Rab1 mutant of Drosophila. J. Cell Sci. 110,2943 -2953.[Abstract]

Short, D. B., Trotter, K. W., Reczek, D., Kreda, S. M., Bretscher, A., Boucher, R. C., Stutts, M. J. and Milgram, S. L. (1998). An apical PDZ protein anchors the cystic fibrosis transmembrane conductance regulator to the cytoskeleton. J. Biol. Chem. 273,19797 -19801.[Abstract/Free Full Text]

Speck, O., Hughes, S. C., Noren, N. K., Kulikauskas, R. M. and Fehon, R. G. (2003). Moesin functions antagonistically to the Rho pathway to maintain epithelial integrity. Nature 421, 83-87.[CrossRef][Medline]

Takahashi, K., Sasaki, T., Mammoto, A., Takaishi, K., Kameyama, T., Tsukita, S. and Takai, Y. (1997). Direct interaction of the Rho GDP dissociation inhibitor with ezrin/radixin/moesin initiates the activation of the Rho small G protein. J. Biol. Chem. 272,23371 -23375.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
J. Cell Sci.Home page
N. A. Bulgakova, O. Kempkens, and E. Knust
Multiple domains of Stardust differentially mediate localisation of the Crumbs-Stardust complex during photoreceptor development in Drosophila
J. Cell Sci., June 15, 2008; 121(12): 2018 - 2026.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
S. Carreno, I. Kouranti, E. S. Glusman, M. T. Fuller, A. Echard, and F. Payre
Moesin and its activating kinase Slik are required for cortical stability and microtubule organization in mitotic cells
J. Cell Biol., February 25, 2008; 180(4): 739 - 746.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
B. K. Cole, M. Curto, A. W. Chan, and A. I. McClatchey
Localization to the Cortical Cytoskeleton Is Necessary for Nf2/Merlin-Dependent Epidermal Growth Factor Receptor Silencing
Mol. Cell. Biol., February 15, 2008; 28(4): 1274 - 1284.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
B. X. Li, A. K. Satoh, and D. F. Ready
Myosin V, Rab11, and dRip11 direct apical secretion and cellular morphogenesis in developing Drosophila photoreceptors
J. Cell Biol., May 21, 2007; 177(4): 659 - 669.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
S. C. Hughes and R. G. Fehon
Phosphorylation and activity of the tumor suppressor Merlin and the ERM protein Moesin are coordinately regulated by the Slik kinase
J. Cell Biol., October 23, 2006; 175(2): 305 - 313.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. Richard, R. Roepman, W. M. Aartsen, A. G.S.H. van Rossum, A. I. den Hollander, E. Knust, J. Wijnholds, and F. P.M. Cremers
Towards understanding CRUMBS function in retinal dystrophies
Hum. Mol. Genet., October 15, 2006; 15(suppl_2): R235 - R243.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
C. D'Alterio, D. D.D. Tran, M. W.Y. A. Yeung, M. S.H. Hwang, M. A. Li, C. J. Arana, V. K. Mulligan, M. Kubesh, P. Sharma, M. Chase, et al.
Drosophila melanogaster Cad99C, the orthologue of human Usher cadherin PCDH15, regulates the length of microvilli
J. Cell Biol., November 7, 2005; 171(3): 549 - 558.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
I. Chorna-Ornan, V. Tzarfaty, G. Ankri-Eliahoo, T. Joel-Almagor, N. E. Meyer, A. Huber, F. Payre, and B. Minke
Light-regulated interaction of Dmoesin with TRP and TRPL channels is required for maintenance of photoreceptors
J. Cell Biol., October 10, 2005; 171(1): 143 - 152.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. J. Laviolette, P. Nunes, J.-B. Peyre, T. Aigaki, and B. A. Stewart
A Genetic Screen for Suppressors of Drosophila NSF2 Neuromuscular Junction Overgrowth
Genetics, June 1, 2005; 170(2): 779 - 792.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
S. Beronja, P. Laprise, O. Papoulas, M. Pellikka, J. Sisson, and U. Tepass
Essential function of Drosophila Sec6 in apical exocytosis of epithelial photoreceptor cells
J. Cell Biol., May 23, 2005; 169(4): 635 - 646.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
A. K. Satoh, J. E. O'Tousa, K. Ozaki, and D. F. Ready
Rab11 mediates post-Golgi trafficking of rhodopsin to the photosensitive apical membrane of Drosophila photoreceptors
Development, April 1, 2005; 132(7): 1487 - 1497.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
D. R. Hipfner, N. Keller, and S. M. Cohen
Slik Sterile-20 kinase regulates Moesin activity to promote epithelial integrity during tissue growth
Genes & Dev., September 15, 2004; 18(18): 2243 - 2248.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Supplemental Figures
Right arrowOA All Versions of this Article:
dev.00976v1
131/4/725    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Karagiosis, S. A.
Right arrow Articles by Ready, D. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Karagiosis, S. A.
Right arrow Articles by Ready, D. F.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?