|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 14 January 2004
doi: 10.1242/dev.00976
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Biological Sciences, Purdue University, West Lafayette, Indiana 47907, USA
* Author for correspondence (e-mail: dready{at}bilbo.bio.purdue.edu)
Accepted 11 November 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Moesin, ERM, Morphogenesis, Photoreceptor, Cytoskeleton, F-actin, Drosophila melanogaster
| Introduction |
|---|
|
|
|---|
Initially identified as a component of the intestinal brush border membrane
cytoskeleton, ERM proteins are broadly associated with actin-rich membrane
projections, including microvilli and lamellipodia
(Berryman et al., 1993
). A role
for ERM proteins in actin-based morphogenesis is supported by in vitro
observations: downregulation of ERM proteins in cultured cells disrupts
membrane protrusions (Amieva et al.,
1999
), and expression of a constitutively active ERM protein
produces a profusion of microvilli (Oshiro
et al., 1998
). In addition to demonstrated structural roles, ERM
proteins localize important signalling regulators, including EBP50/NHERF, a
regulatory subunit of the sodium-proton pump RhoGDI and others
(Hamada et al., 2001
;
Takahashi et al., 1997
;
Short et al., 1998
).
The single Drosophila ERM gene, Moesin
(McCartney and Fehon, 1996
),
facilitates genetic studies, and Moesin loss in flies results in
developmental defects including an inability to correctly localize maternal
determinants during oocyte development
(Jankovics et al., 2002
;
Polesello et al., 2002
),
cytoskeletal abnormalities (Polesello et
al., 2002
) and a breakdown of epithelial integrity
(Speck et al., 2003
). Genetic
interactions, notably increased survival of Moe mutant flies in a
Rho-reduced background, have suggested Moesin facilitates epithelial
morphology by antagonizing Rho activity rather than contributing a structural
role (Speck et al., 2003
). The
role of ERM proteins in the orchestration of complex terminal differentiation
is largely unexplored.
Photoreceptor sensory organelles, the outer segments of vertebrate rod and
cone photoreceptors and the rhabdomeres of arthropods, are extravagant
products of a common program of epithelial differentiation: apical membrane
expansion and specialization. During photoreceptor terminal differentiation,
directed membrane traffic enormously amplifies a central domain of the apical
membrane of the cell, and the cytoskeleton folds it into a compact stack rich
in Rhodopsin and associated proteins of the phototransduction cascade. Moesin
knockout mice reveal few defects (Doi et
al., 1999
); however, strong interpretation of this result is
complicated by redundancy with remaining family members Ezrin and Radixin. In
Drosophila, loss of epithelial integrity in Moesin mutants
confounds investigation of the role of the protein in the epithelium-derived
retina; mechanical integrity of the retinal epithelium is a foundation of
photoreceptor morphogenesis. Epithelial integrity is preserved in mosaic eyes
homozygosed for Moesin null alleles later in development and in eyes in which
Moesin is reduced by stage-specific RNAi expression, permitting analysis of
the protein in terminal differentiation. Here we show that Moesin contributes
an essential structural role in Drosophila photoreceptor
morphogenesis.
| Materials and methods |
|---|
|
|
|---|
Molecular biology
Two different constructs encoding Moesin inverted repeats
(IRMoesin) were generated by amplifying the Moesin coding
sequence (GenBank Accession Number L38909) from positions 327-775 bp and
818-1236 bp by polymerase chain reaction (PCR), using primers that introduced
unique restriction sites at the product ends. Each of the DNA fragments were
subcloned, in opposite orientations, into AvrII and NheI
sites of the pWIZ plasmid (a gift from R. Carthew, Northwestern University) to
produce perfect hairpin RNA loops following splicing under the UAS/Gal4
promoter. The pUAST-derived vectors UAS IR-Moe [327-775] and UAS
IR-Moe [818-1236] were introduced into the germline by P-element-mediated
transformation. Independent transformant lines were established and mapped.
Several different UAS IR-Moe [327-775] and UAS IR-Moe
[818-1236] lines were tested for double-stranded RNA interference (RNAi)
activity by crossing to Gal4 drivers and immunostaining with anti-Moesin
antibody.
The full-length UAS Moesin Myc, UAS Moesin GFP and phosphomimetic
UAS T559D Moesin Myc transgenic lines were generated by first
amplifying the full-length Moesin cDNA by PCR to introduce unique
restriction sites at the product ends and then ligating it into pBluescript
(Stratagene, La Jolla, CA). A synthetic mutation primer,
CGTGACAAGTACAAAGATCTCCGCGAGATTCGTAAGGG, was used to mutate
Thr559 to Asp and silently introduce a BglII site. The Myc
epitope tag or green fluorescent protein (GFP) was introduced in-frame at the
C terminus of Moesin by ligation of a 6-Myc repeat from pCS2+MT
(Rupp et al., 1994
) or GFP
from pBD1010 (B. Dickson, Research Institute of Molecular Pathology). Each
sequence was confirmed and subcloned into pUAST. Independent lines, on the
second or third chromosome, were generated with P-element-mediated germline
transformation. All transgenic lines were expressed by Gal4/UAS-targeted
expression (Brand and Perrimon,
1993
).
Temperature shifts
Pupae were maintained at 20°C during non-heat shock conditions. A
thermocycler was used to conduct a series of heat shocks at 37°C for 45
minutes each. Between the temperature shifts to 37°C, the flies rested at
20°C for 3 hours and 15 minutes. UAS Moesin GFP/+; hsGal4/+, UAS
Moesin Myc/+; hsGal4/+ and UAS IR-Moesin/+; hsGal4/+ pupae
received two heat shocks. UAS T559D Moesin Myc/+; hsGal4/+ pupae
received five heat shocks. After the final heat shock, flies recovered at
20°C for 6-8 hours before dissection.
Immunolocalization and western analysis
Immunostaining and F-actin localization were performed with whole-mount
preparations as described (Fan and Ready,
1997
), with the following exceptions noted. After dissection, the
retina was immediately immersed in PLP fixative (10 mM periodate, 75 mM
lysine, 2% paraformaldehyde in 1x PBS) with 0.05% saponin for 20
minutes. Eyes were washed for 10 minutes, three times with 50 mM
NH4Cl in PBS. Moesin was visualized using anti-Moesin antiserum at
1:5000 dilution (D. Keihart, Duke University). For activated Moesin (p-Moesin)
visualization, a rabbit antibody against the Thr phosphorylated Moesin peptide
(C-R553-D-K-T-K-phosphoT-L-R-QI-R563) was generated (Bethyl, Montgomery, TX)
and used at 1:500. To immunolocalize dominant-active Moesin, Myc antibody 9E10
was used at 1:50 dilution. Retinas were incubated overnight in 1:300 diluted
primary for Crumbs (U. Tepass, University of Toronto) visualization. All whole
mounts were examined with a Bio-Rad MRC-1024 confocal microscope using a
60x objective lens. Images were processed using Adobe Photoshop 7.0.
Western analysis of 1-day-old adult whole head extract was performed as
previously described (Satoh et al.,
1997
), with the following modification: anti-Moesin antiserum was
used at 1:20,000 dilution. Transmission electron microscopy was carried out as
described (Fan and Ready,
1997
).
| Results |
|---|
|
|
|---|
|
In order to visualize both active phosphorylated and dormant non-phosphorylated Moesin, we used Gal4/UAS-targeted expression of full-length wild-type Myc- and GFP-tagged Moesin. In fixed (Fig. 2A) and live cells (Fig. 2B), both tagged proteins distribute throughout the cytoplasm (Fig. 2A; asterisks) and concentrate at the apical membrane. Cytoplasmic staining probably represents the soluble, dormant Moesin.
|
Moesin RNAi disorganizes photoreceptor apical membrane/cytoskeleton
As epithelial organization, which defines the context of photoreceptor
differentiation, fails in flies lacking Moesin
(Speck et al., 2003
), we
expressed IR-Moesin, a transgene carrying an inverted repeat sequence
encoding a portion of Moesin to induce RNAi and downregulate Moesin
late in eye development. Epithelial integrity is preserved in these eyes,
permitting dissection of the role of Moesin in photoreceptor differentiation.
The efficiency of UAS IR-Moesin downregulation of Moesin expression
was assayed using immunolocalization. Using the heat shock>Gal4
driver (hs>Gal4) to drive the expression of UAS IR-Moesin
in staged pupae, we found photoreceptor morphogenesis to be most sensitive to
Moesin loss at the time of rhabdomere/stalk resolution, approximately 50% pd.
At this stage, hs>IRMoesin expression completely abolished Moesin
immunodetection in many photoreceptors
(Fig. 3A; arrowheads). The
membrane cytoskeleton, assayed by F-actin staining, is disorganized in
photoreceptors lacking Moesin. Rhabdomeres of these eyes typically have
reduced, irregular microvillar fields (Fig.
3B).
|
Genetic loss of Moesin likewise disrupts rhabdomere morphogenesis
As an alternate strategy to remove zygotic Moesin later in development, we
generated eye clones homozygous for either of two Moesin alleles,
MoePL54 and MoeX5, shown to be null or
strong hypomorphs (Polesello et al.,
2002
). In pupal MoePL54 mosaic eyes,
containing a mixture of Moesin-positive cells and cells with severely reduced
Moesin, rhabdomeres of photoreceptors with immuno-undetectable Moesin show
severely disrupted apical membranes (Fig.
4A; arrowheads). Assayed with rhodamine-phalloidin, the rhabdomere
microvillar array in Moe- cells is irregular and the RTW
is replaced with abnormal F-actin accumulations. In MoeX5
mosaic eyes, cells lacking Moesin are rarely observed, but ommatidia
containing reduced numbers of photoreceptors are common, suggesting that the
missing cells died or were otherwise lost from the developing retinal
epithelium (Fig. 4B;
asterisks).
|
Dominant-active Moesin inhibits apical membrane differentiation
To examine the role of Moesin activation in photoreceptor morphogenesis, we
generated a transgenic line expressing a constitutively active phosphomimetic
mutation, UAS T559D Moesin Myc
(Oshiro et al., 1998
), under
Gal4/UAS control. When hs>T559D Moesin Myc is expressed during
apical morphogenesis, a profusion of irregular microvilli dominates the apical
surface (Fig. 5B). This result
parallels observations in cell culture
(Gautreau et al., 2000
;
Oshiro et al., 1998
), where
expression of T559D Moesin results in hyper-formation of irregular
microvilli. Other cellular structures, including the adherens junctions
(Fig. 5B; arrows), appear to be
intact. Using confocal immunofluorescence, T559D Moesin Myc localizes to the
entire photoreceptor plasma membrane and concentrates at the apical membrane
(Fig. 5D). The failure of
basolateral Moesin to generate microvilli suggests that additional,
apically-limited proteins are needed to initiate rhabdomere microvilli. T559D
Moesin severely disrupts the actin cytoskeleton
(Fig. 5E), and Crumbs, which
should resolve to the stalk, remains distributed across the entire apical
surface (Fig. 5C). Failure of
Crumbs to re-localize is a harbinger of the loss of stalk/rhabdomere
distinction in photoreceptors expressing dominant-active Moesin. We speculate
that dynamic turnover and regulation of the protein is important for
morphogenesis, and the unregulated binding of dominant-active Moesin `freezes'
the apical membrane (Coscoy et al.,
2002
), compromising its reorganization.
|
| Discussion |
|---|
|
|
|---|
The developmental cues that restrict Moesin to the rhabdomere primordium at
the onset of overt morphogenesis are not known. At this stage, photoreceptor
apices contact each other in a stereotyped pattern of apical cell-cell
contacts within a trapped apical pocket that will later open to form the IRS,
suggesting that apical contacts may localize future rhabdomeres. In other
systems, ERM proteins are recruited to plasma membranes and activated there by
PtdIns(4,5)P2-binding and phosphorylation of a C-terminal
threonine (Hirao et al., 1996
;
Matsui et al., 1998). Rhabdomeres are rich in
PtdIns(4,5)P2, and Rhodopsin-activated cleavage of
PtdIns(4,5)P2 by the phospholipase C NorpA is the
substrate for Drosophila phototransduction
(Hardie et al., 2001
). A
Moesin-organized nexus of phosphoinositide and actin organizing proteins at
the rhabdomere base may represent an economical dual use of the system for
structure and physiology.
The restriction of Moesin to the rhabdomere base and its loss-of-function
phenotypes suggests that Moesin links microvillar cytoplasmic ends to the
underlying actin cytoskeleton, the rhabdomere terminal web (RTW). The full
molecular makeup of the Moesin-organized photoreceptor cytoskeleton and the
nature of the forces it organizes during morphogenesis remain to be
determined, but the catenary-like deformation of the rhabdomere base as
developing microvilli elongate suggests the membrane cytoskeleton contributes
a sub-apical constraint, a tensile sheet that contains the expanding
photosensitive membrane in an orderly microvillar stack. In other systems,
Moesin-organized protein scaffolds recruit potent regulators of membrane
architecture and function, such as the small GTPase regulators RhoGDI
(Hamada et al., 2001
), RabGAPs
and RhoGAPs (Reczek and Bretscher,
2001
). It is plausible that the ability of Moesin to bind F-actin
and its regulators may contribute to the establishment of the RTW. Rhabdomere
membrane is in dynamic exchange across the rhabdomere base with endosomes of
the photoreceptor cytoplasm (Bahner et al.,
2002
), and it is notable that ERM proteins bind to regulators of
membrane recycling (Rochdi and Parent,
2003
). Moesin may participate in the membrane exchange that
supports a dynamic sensory membrane.
Recent observation that the lethality of flies homozygous for
MoeG0323, considered a protein null, could be rescued in
Rho-reduced flies was interpreted as showing that Moesin facilitates
epithelial morphology not by providing an essential structural function, but
rather by antagonizing activity of the small GTPase Rho
(Speck et al., 2003
). This
conclusion rests on MoeG0323 being a protein null. Our
observations that Rho-reduced MoeG0323 produces Moesin
detectable by western analysis and shows photoreceptor Moesin immunostaining
indistinguishable from wild type suggest alternate interpretations. One
possibility is that the P-element insertion in the 5' untranslated
region of MoeG0323 downregulates embryonic and larval
Moesin, but can be over-ridden later in development in Rho-reduced animals.
Such interpretation, while not ruling out a role for Moesin in Rho regulation,
is compatible with present and previous evidence for a structural role for
Moesin.
Given the fundamental parallels between Drosophila and vertebrate photoreceptors, it is interesting to consider whether the ERM-organized membrane cytoskeleton will play a similar role in human photoreceptor development and disease.
Note added in proof
Observations using photoreceptors from the leopard frog Rana
implicate Moesin in rod outer segment biogenesis
(Deretic et al., 2004
).
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Amieva, M. R., Litman, P., Huang, L. Q., Ichimaru, E. and
Furthmayr, H. (1999). Disruption of dynamic cell surface
architecture of NIH3T3 fibroblasts by the N-terminal domains of moesin and
ezrin: in vivo imaging with GFP fusion proteins. J. Cell
Sci. 112,111
-125.[Abstract]
Arikawa, K., Hicks, J. L. and Williams, D. S.
(1990). Identification of Actin-Filaments in the Rhabdomeral
Microvilli of Drosophila Photoreceptors. J. Cell Biol.
110,1993
-1998.
Bahner, M., Frechter, S., Da Silva, N., Minke, B., Paulsen, R.
and Huber, A. (2002). Light-regulated subcellular
translocation of Drosophila TRPL channels induces long-term adaptation and
modifies the light-induced current. Neuron
34, 83-93.[CrossRef][Medline]
Berryman, M., Franck, Z. and Bretscher, A.
(1993). Ezrin is concentrated in the apical microvilli of a wide
variety of epithelial-cells whereas moesin is found primarily in
endothelial-cells. J. Cell Sci.
105,1025
-1043.[Abstract]
Brand, A. H. and Perrimon, N. (1993). Targeted
gene-expression as a means of altering cell fates and generating dominant
phenotypes. Development
118,401
-415.[Abstract]
Bretscher, A., Reczek, D. and Berryman, M.
(1997). Ezrin: a protein requiring conformational activation to
link microfilaments to the plasma membrane in the assembly of cell surface
structures. J. Cell Sci.
110,3011
-3018.[Abstract]
Bretscher, A., Edwards, K. and Fehon, R. G.
(2002). ERM proteins and merlin: integrators at the cell cortex.
Nat. Rev. Mol. Cell Biol.
3, 586-599.[CrossRef][Medline]
Chang, H. Y. and Ready, D. F. (2000). Rescue of
photoreceptor degeneration in rhodopsin-null Drosophila mutants by activated
Rac1. Science 290,1978
-1980.
Coscoy, S., Waharte, F., Gautreau, A., Martin, M., Louvard, D.,
Mangeat, P., Arpin, M. and Amblard, F. (2002). Molecular
analysis of microscopic ezrin dynamics by two-photon FRAP. Proc.
Natl. Acad. Sci. USA 99,12813
-12818.
Deretic, D., Traverso, V., Parkins, N., Jackson, F., Rodriguez
de Turco, E. B. and Ransom. N. (2004). Phosphoinositides,
ezrin/moesin, and rac1 regulate fusion of rhodopsin transport carriers in
retinal photoreceptors. Mol. Biol. Cell
15,359
-370.
Doi, Y., Itoh, M., Yonemura, S., Ishihara, S., Takano, H., Noda,
T. and Tsukita, S. (1999). Normal development of mice and
unimpaired cell adhesion cell motility actin-based cytoskeleton without
compensatory upregulation of ezrin or radixin in moesin gene knockout.
J. Biol. Chem. 274,2315
-2321.
Fan, S. S. and Ready, D. F. (1997). Glued
participates in distinct microtubule-based activities in Drosophila eye
development. Development
124,1497
-1507.[Abstract]
Gautreau, A., Louvard, D. and Arpin, M. (2000).
Morphogenic effects of ezrin require a phosphorylation-induced transition from
oligomers to monomers at the plasma membrane. J. Cell
Biol. 150,193
-203.
Golic, M. M., Rong, Y. S., Petersen, R. B., Lindquist, S. L. and
Golic, K. G. (1997). FLP-mediated DNA mobilization to
specific target sites in Drosophila chromosomes. Nucl. Acids
Res. 25,3665
-3671.
Hamada, K., Seto, A., Shimizu, T., Takeshi, M. B., Takai, Y.,
Tsukita, S. and Hakoshima, T. (2001). Crystallization and
preliminary crystallographic studies of RhoGDI in complex with the radixin
FERM domain. Acta Crystallogr. Section D-Biol.
Crystallogr. 57,889
-890.
Hardie, R. C., Raghu, P., Moore, S., Juusola, M., Baines, R. A.
and Sweeney, S. T. (2001). Calcium influx via TRP channels is
required to maintain PIP2 levels in Drosophila photoreceptors.
Neuron 30,149
-159.[CrossRef][Medline]
Hirao, M., Sato, N., Kondo, T., Yonemura, S., Monden, M.,
Sasaki, T., Takai, Y. and Tsukita, S. (1996). Regulation
mechanism of ERM (ezrin/radixin/moesin) protein/plasma membrane association:
possible involvement of phosphatidylinositol turnover and Rho-dependent
signaling pathway. J. Cell Biol.
135, 37-51.
Izaddoost, S., Nam, S. C., Bhat, M. A., Bellen, H. J. and Choi,
K. W. (2002). Drosophila Crumbs is a positional cue in
photoreceptor adherens junctions and rhabdomeres.
Nature 416,178
-182.[CrossRef][Medline]
Jankovics, F., Sinka, R., Lukacsovich, T. and Erdelyi, M.
(2002). MOESIN crosslinks actin and cell membrane in Drosophila
oocytes and is required for OSKAR anchoring. Curr.
Biol. 12,2060
-2065.[CrossRef][Medline]
Maeda, M., Doi, Y., Yonemura, S., Amano, M., Kaibuchi, K. and
Tsukita, S. (1998). Rho-kinase phosphorylates COOH-terminal
threonines of ezrin/radixin/moesin (ERM) proteins and regulates their
head-to-tail association. J. Cell Biol.
140,647
-657.
McCartney, B. M. and Fehon, R. G. (1996).
Distinct cellular and subcellular patterns of expression imply distinct
functions for the Drosophila homologues of moesin and the neurofibromatosis 2
tumor suppressor, merlin. J. Cell Biol.
133,843
-852.
Medina, E., Williams, J., Klipfell, E., Zarnescu, D., Thomas, G.
and Le Bivic, A. (2002). Crumbs interacts with moesin and
beta(Heavy)-spectrin in the apical membrane skeleton of Drosophila.
J. Cell Biol. 158,941
-951.
Oshiro, N., Fukata, Y. and Kaibuchi, K. (1998).
Phosphorylation of moesin by Rho-associated kinase (Rho-kinase) plays a
crucial role in the formation of microvilli-like structures. J.
Biol. Chem. 273,34663
-34666.
Pearson, M. A., Reczek, D., Bretscher, A. and Karplus, P. A.
(2000). Structure of the ERM protein moesin reveals the FERM
domain fold masked by an extended actin binding tail domain.
Cell 101,259
-270.[CrossRef][Medline]
Pellikka, M., Tanentzapf, G., Pinto, M., Smith, C., McGlade, C.
J., Ready, D. F. and Tepass, U. (2002). Crumbs, the
Drosophila homologue of human CRB1/RP12, is essential for photoreceptor
morphogenesis. Nature
416,143
-149.[CrossRef][Medline]
Polesello, C., Delon, I., Valenti, P., Ferrer, P. and Payre,
F. (2002). Dmoesin controls actin-based cell shape and
polarity during Drosophila melanogaster oogenesis. Nat. Cell
Biol. 4,782
-789.[CrossRef][Medline]
Reczek, D. and Bretscher, A. (2001).
Identification of EPI64, a TBC/rabGAP domain-containing microvillar protein
that binds to the first PDZ domain of EBP50 and E3KARP. J. Cell
Biol. 153,191
-205.
Rochdi, M. D. and Parent, J. L. (2003). G
alpha(q)-coupled receptor internalization specifically induced by G alpha(q)
signaling - regulation by EBP50. J. Biol. Chem.
278,17827
-17837.
Rupp, R. A. W., Snider, L. and Weintraub, H.
(1994). Xenopus-embryos regulate the nuclear-localization of
Xmyod. Genes Dev. 8,1311
-1323.
Satoh, A. K., Tokunaga, F., Kawamura, S. and Ozaki, K.
(1997). In situ inhibition of vesicle transport and protein
processing in the dominant negative Rab1 mutant of Drosophila. J.
Cell Sci. 110,2943
-2953.[Abstract]
Short, D. B., Trotter, K. W., Reczek, D., Kreda, S. M.,
Bretscher, A., Boucher, R. C., Stutts, M. J. and Milgram, S. L.
(1998). An apical PDZ protein anchors the cystic fibrosis
transmembrane conductance regulator to the cytoskeleton. J. Biol.
Chem. 273,19797
-19801.
Speck, O., Hughes, S. C., Noren, N. K., Kulikauskas, R. M. and
Fehon, R. G. (2003). Moesin functions antagonistically to the
Rho pathway to maintain epithelial integrity. Nature
421, 83-87.[CrossRef][Medline]
Takahashi, K., Sasaki, T., Mammoto, A., Takaishi, K., Kameyama,
T., Tsukita, S. and Takai, Y. (1997). Direct interaction of
the Rho GDP dissociation inhibitor with ezrin/radixin/moesin initiates the
activation of the Rho small G protein. J. Biol. Chem.
272,23371
-23375.
This article has been cited by other articles:
![]() |
N. A. Bulgakova and E. Knust The Crumbs complex: from epithelial-cell polarity to retinal degeneration J. Cell Sci., August 1, 2009; 122(15): 2587 - 2596. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Bulgakova, O. Kempkens, and E. Knust Multiple domains of Stardust differentially mediate localisation of the Crumbs-Stardust complex during photoreceptor development in Drosophila J. Cell Sci., June 15, 2008; 121(12): 2018 - 2026. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Carreno, I. Kouranti, E. S. Glusman, M. T. Fuller, A. Echard, and F. Payre Moesin and its activating kinase Slik are required for cortical stability and microtubule organization in mitotic cells J. Cell Biol., February 25, 2008; 180(4): 739 - 746. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. K. Cole, M. Curto, A. W. Chan, and A. I. McClatchey Localization to the Cortical Cytoskeleton Is Necessary for Nf2/Merlin-Dependent Epidermal Growth Factor Receptor Silencing Mol. Cell. Biol., February 15, 2008; 28(4): 1274 - 1284. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. X. Li, A. K. Satoh, and D. F. Ready Myosin V, Rab11, and dRip11 direct apical secretion and cellular morphogenesis in developing Drosophila photoreceptors J. Cell Biol., May 21, 2007; 177(4): 659 - 669. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Hughes and R. G. Fehon Phosphorylation and activity of the tumor suppressor Merlin and the ERM protein Moesin are coordinately regulated by the Slik kinase J. Cell Biol., October 23, 2006; 175(2): 305 - 313. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Richard, R. Roepman, W. M. Aartsen, A. G.S.H. van Rossum, A. I. den Hollander, E. Knust, J. Wijnholds, and F. P.M. Cremers Towards understanding CRUMBS function in retinal dystrophies Hum. Mol. Genet., October 15, 2006; 15(suppl_2): R235 - R243. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D'Alterio, D. D.D. Tran, M. W.Y. A. Yeung, M. S.H. Hwang, M. A. Li, C. J. Arana, V. K. Mulligan, M. Kubesh, P. Sharma, M. Chase, et al. Drosophila melanogaster Cad99C, the orthologue of human Usher cadherin PCDH15, regulates the length of microvilli J. Cell Biol., November 7, 2005; 171(3): 549 - 558. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Chorna-Ornan, V. Tzarfaty, G. Ankri-Eliahoo, T. Joel-Almagor, N. E. Meyer, A. Huber, F. Payre, and B. Minke Light-regulated interaction of Dmoesin with TRP and TRPL channels is required for maintenance of photoreceptors J. Cell Biol., October 10, 2005; 171(1): 143 - 152. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Laviolette, P. Nunes, J.-B. Peyre, T. Aigaki, and B. A. Stewart A Genetic Screen for Suppressors of Drosophila NSF2 Neuromuscular Junction Overgrowth Genetics, June 1, 2005; 170(2): 779 - 792. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Beronja, P. Laprise, O. Papoulas, M. Pellikka, J. Sisson, and U. Tepass Essential function of Drosophila Sec6 in apical exocytosis of epithelial photoreceptor cells J. Cell Biol., May 23, 2005; 169(4): 635 - 646. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Satoh, J. E. O'Tousa, K. Ozaki, and D. F. Ready Rab11 mediates post-Golgi trafficking of rhodopsin to the photosensitive apical membrane of Drosophila photoreceptors Development, April 1, 2005; 132(7): 1487 - 1497. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Hipfner, N. Keller, and S. M. Cohen Slik Sterile-20 kinase regulates Moesin activity to promote epithelial integrity during tissue growth Genes & Dev., September 15, 2004; 18(18): 2243 - 2248. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||