|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 21 January 2004
doi: 10.1242/dev.00983
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1 Laboratoire d'Embryologie Moléculaire et Expérimentale, UMR CNRS
8080, Bâtiment 445, Université Paris XI, 91405 Orsay,
France
2 Universität Göttingen, Institut für Biochemie und Molekulare
Zellbiologie, Abteilung Entwicklungsbiochemie, Justus von Liebig Weg 11, 37077
Göttingen, Germany.
3 Department of Biochemistry, Faculty of Science, University of Yaoundé
I, PO Box 812, Yaoundé, Cameroon
Author for correspondence (e-mail:
muriel.perron{at}emex.u-psud.fr)
Accepted 12 November 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Retina, RNA binding proteins, Morpholinos, Proneural genes, Xenopus
| Introduction |
|---|
|
|
|---|
Interactions among neurogenic, proneural and differentiation genes have
been extensively studied during primary neurogenesis in Xenopus
allowing the establishment of a genetic cascade
(Ferreiro et al., 1993
;
Turner and Weintraub, 1994
;
Bellefroid et al., 1996
;
Ma et al., 1996
;
Chitnis and Kintner, 1996
;
Perron et al., 1999b
). These
interactions encompass mainly transcriptional regulation. However, this
genetic network probably requires other levels of gene regulation. For
instance, it has recently been found that XNeuroD function during primary
neurogenesis and retinogenesis can be inhibited by glycogen synthase kinase
3ß (Marcus et al., 1998
;
Moore et al., 2002
). This
post-translational phosphorylation regulation is crucial for the proper
function of XNeuroD (Moore et al.,
2002
). Post-transcriptional regulation at the mRNA level,
involving RNA binding proteins, is also known to play a key role in gene
regulation (Burd and Dreyfuss,
1994
; Perrone-Bizzozero and
Bolognani, 2002
). Once mRNAs are transcribed, RNA-binding proteins
can control all subsequent maturation steps from splicing and translation, to
mRNA transport and stability (Harford and
Morris, 1997
). According to the motif contained in RNA-binding
proteins, one can distinguish several families. The largest family of
RNA-binding proteins is characterised by the presence of RNA recognition
motifs (RRM), domains composed of 90-100 amino acids that are only moderately
conserved with two consensus sequences (an octamer and a hexamer sequence
called RNP1 and RNP2, respectively). The number of RRMs per protein varies
from one to four (Burd and Dreyfuss,
1994
). Recent advances in the analysis of several RNA-binding
proteins during development have increased the perspectives in this
developmental biology field.
In the nervous system, a large number of genes are regulated
post-transcriptionally via the interaction of their mRNAs with specific
RNA-binding proteins. At present, we know several RNA-binding proteins
involved in the development and plasticity of the central nervous system
(CNS). However, little is known about their precise role and their RNA
targets. During neurogenesis for example, the Staufen protein mediates
prospero mRNA localisation, which is important for neuroblast
asymmetric division in early Drosophila embryogenesis
(Matsuzaki et al., 1998
). In
mammals, the two homologues of Staufen (Stau1 and Stau2) are involved in mRNA
transport in dendrites, and they also interact with ribosomes, suggesting an
additional role in translation regulation. However, vertebrate RNA targets of
Stau1 and Stau2 have not yet been identified
(Duchaine et al., 2002
;
Kiebler and DesGroseillers,
2000
). Another conserved RNA-binding protein family is the Musashi
family. In mammals, two members, Musashi1 (Msi1) and Musashi2 (Msi2), are
expressed in neural precursor cells. Antisense ablation experiments suggest
that Msi1 and Msi2 are cooperatively involved in the proliferation and
maintenance of CNS stem cell population
(Sakakibara et al., 2002
).
Concerning the targets of these genes, Msi1 represses the translation of Numb,
an antagonist of Notch (Okabe et al.,
2001
), and it has recently been suggested that Msi1 also mediates
the post-transcriptional regulation of the microtubule-associated protein Tau
(Cuadrado et al., 2002
). The
ELAV/Hu proteins belong to a RNA-binding protein family largely conserved
across species. In vertebrates, most members are neuron specific, and have
been shown to be essential for nervous system development and function through
the regulation of the stability of their mRNA targets, including GAP43, Tau or
MYCN (Beckel-Mitchener et al.,
2002
; Aranda-Abreu et al.,
1999
; Manohar et al.,
2002
; Perrone-Bizzozero and
Bolognani, 2002
). These examples emphasise the important role of
post-transcriptional factors during neurogenesis.
With the aim of advancing our knowledge of the genetic network involved in
retinal cell fate determination, we have characterised a novel RNA-binding
protein and we have studied its function during retinogenesis. We present the
cloning and spatio-temporal expression of Xseb4R, which encodes a
putative RNA-binding protein containing a single RRM. A related gene,
Xseb4, has been previously isolated in Xenopus
(Fetka et al., 2000
). While
Xseb4 is mainly expressed in muscles, Xseb4R is strongly
expressed in neural tissues. We show here that overexpression of
Xseb4R during primary neurogenesis or in the retina has a proneural
effect. Blocking Xseb4R function using morpholino oligonucleotides
leads to the opposite effect. Using classical overexpression experiments in
the early Xenopus embryo, we demonstrate that Xseb4R is
responsive to neurogenin, NeuroD and the Notch/Delta signal
transcription cascade. In the Xenopus nervous system, several
RNA-binding proteins have been identified previously but their functions
remain elusive (Good et al.,
1993
; Gerber et al.,
1999
; Perron et al.,
1999a
). Our present data suggest that the RNA-binding protein
XSEB4R has a proneural function during Xenopus neurogenesis.
| Materials and methods |
|---|
|
|
|---|
Oligonucleotides and mRNA
Two antisense morpholino oligonucleotides (Mo) against Xseb4R were
designed (sequences complementary to AUG are underlined), Mo1
(GTGCATGGTCACAGGCAAATTCACC) and Mo2 (starting 2 nucleotides after
AUG; AAAGTTGTGTCTTTTTGCACGGTGT), as well as a Mo against GFP cloned into the
pCS2 plasmid (TCCTTTACTCATGGTGGATCCTGCA). The standard control
morpholino (cMo: CCTCTTACCTCAGTTACAATTTATA) was used as a control (Genetools).
Two kinds of Mo have been used: crude Mo (Mo1 and cMo) for blastomere
injections and Special Delivery Mo (Mo1, Mo2, MoGFP and cMo), where the
non-ionic crude morpholinos are paired to a complementary `carrier' DNA in
order to be transfected (Morcos,
2001
; Ohnuma et al.,
2002
).
Plasmid construction
The full-length Xseb4R cDNA was cloned into the pCMV vector, and
the open reading frame (ORF) subcloned into the pCS2 vector. The flag-tagged
version was engineered by subcloning the ORF into the pCS2-Flag vector.
Another construct, called Xseb4R-5'UTR, has been subcloned into
pCS2. This construct contains the ORF as well as the region of the 5'UTR
complementary to Xseb4R Mo1. Xseb4R-GR was generated by
subcloning the ORF into pCS2-GR, a vector initially generated by inserting the
GR coding sequence into the XhoI and XbaI sites within the
multiple cloning sites of the pCS2 vector.
In vitro RNA synthesis and microinjection
Capped Xseb4R, Xngn1 (a gift from C. Kintner), XneuroD (a
gift from E. Bellefroid), XNotch ICD (a gift from E. Bellefroid),
Xseb4 (a gift from R. Rupp) and NLS lacZ RNAs were prepared
from CS2 plasmids after Not1 linearisation using mMessage mMachine
kit (Ambion). RNAs were injected in a volume of 5 nl, at a concentration of 50
pg/nl (when not notified), into a single blastomere of embryos at the two-cell
stage. 5-20 ng of Mo1 or control Mo were injected into a single blastomere of
embryos at the two-cell stage. lacZ mRNA was co-injected as a marker.
Histochemical staining for ß-galactosidase activity was performed to
visualise the distribution of the co-injected lacZ mRNA. Embryos were
collected at the neurula stage and subjected to in situ hybridisation as
described below. Xseb4R-GR-injected embryos were continuously
treated, or not, from the stages indicated in the results with 10 µM, final
concentration, of dexamethasone.
RT-PCR
The Qiagen Rneasy mini kit was used for RNA isolation from oocytes or
embryos of different developmental stages. All RNA preparations were treated
with DNase I (Qiagen) and checked with 32 cycles of histone H4-specific PCR
(Niehrs et al., 1994
) for DNA
contamination. RT-PCR was carried out using the Gene Amp RNA PCR kit
(Perkin-Elmer). The following primers, annealing temperatures and cycle
numbers were used:
histone H4, forward (F) 5'-CGGGATAACATTCAGGGTATCACT-3', reverse (R) 5'-ATCCATGGCGGTAACTGTCTTCCT-3', 58°C, 25 cycles; and
Xseb4R, (F) 5'-GGAACCTGCAGAGCGCATTTACTA-3', (R) 5'-GTCAGGCTGGAGCTGTTGAGGCTG-3', 60°C, 33 cycles.
PCR products were separated on 2% agarose gels.
In situ hybridisation
Digoxigenin (DIG)-labeled antisense RNA probes were generated for
Xseb4R according to the protocol of the manufacturer (Roche). For
analysis of expression in the whole embryo during development, in situ
hybridisation was performed as previously reported
(Souopgui et al., 2002
). For
analysis of expression in the retina, whole-mount in situ hybridisation was
performed as described previously
(Shimamura et al., 1994
),
apart from that embryos were bleached
(Broadbent and Read, 1999
) just
before the proteinase K step. After NBT/BCIP (Roche) staining, embryos were
then vibratome sectioned (50 µm).
BrdU staining
BrdU was injected intra-abdominally, and the animals were allowed to
recover for 2-8 hours post-injection. BrdU was detected using the BrdU
labeling kit (Roche) after a 45-minute treatment in 2N HCl. For double
staining, the mRNA was first detected by whole-mount in situ hybridisation (as
described above). Embryos were then cryostat sectioned and BrdU
immuno-stained.
Immunohistochemistry
Immunohistochemistry was performed on 4% paraformaldehyde-fixed tissues.
Cryostat sections (12 µm thick) were incubated with primary antibodies,
anti-Islet1 (a gift from S. Thor), anti-Flag (Stratagene), anti-CD2 (Serotec)
or anti-BrdU (Roche), and visualised using anti-mouse fluorescent secondary
antibodies (Alexa, Molecular Probes). To visualise the nuclei, sections were
incubated for 5 minutes in Hoechst solution (10 µg/ml) and washed three
times in PBS.
In vivo lipofection
DNA was transfected into the presumptive region of the retina of stage 18
embryos, as previously described (Holt et
al., 1990
; Ohnuma et al.,
2002
). Mo (10 ng) were similarly transfected. Embryos were fixed
at stage 41 and cryostat sectioned (12 µm). GFP-positive cells were counted
and cell types were identified based upon their laminar position and
morphology, as previously described
(Dorsky et al., 1995
).
Anti-XSEB4R polyclonal antibody
Polyclonal antibodies against XSEB4R have been raised by Eurogentec. This
antibody is directed against the N-terminal peptide of XSEB4R: HTVQKDTTFT.
Mo microinjection, embryo extracts and western blotting
Capped synthetic Xseb4R mRNA containing the part of the
5'UTR against which Mo1 is directed was prepared from pCS2 plasmids
after Not1 linearisation using mMessage mMachine kit (Ambion). 500 pg
of this RNA and 5 ng of Mo (Mo1 or Control Mo) were injected into both
blastomeres of embryos at the two-cell stage. Embryos were harvested at stage
10, frozen in liquid nitrogen and stored at -80°C until further analysis.
For preparation of extracts, frozen embryos were homogenised in 10 µl of
extraction buffer (50 mM ß-glycerophosphate, 20 mM EGTA, 15 mM
MgCl2, 1 mM DTT, pH 7.3) with proteases inhibitor cocktail
(complete Mini, Roche), centrifuged for 15 minutes, and the supernatants
collected. Proteins were then separated on 4% stacking and 10% resolving
SDS-polyacrylamide gels (PAGE), as described by Laemmli
(Laemmli, 1970
). The separated
polypeptides were electrophoretically transferred from gels to nitrocellulose
membranes and processed for immunoblotting. Blots were then incubated for two
hours with the primary antibody against XSEB4R, diluted 1:100 in 10% dried
skimmed milk in Tris-buffered saline-Tween buffer [TBST: 1.37 M NaCl, 0.2 M
Tris (pH 7.5), 1% Tween-20]. The peroxidase conjugated anti-rabbit (Vector)
was used as secondary antibody at a dilution of 1:5000 in 5% dried skimmed
milk in TBST buffer, for a two hour incubation. Blots were developed using the
chemoluminescence kit (Amersham) and the reactivity was visualised on
hyperfilm ECL (Amersham).
Apoptosis detection
Apoptotic cells were detected by TUNEL methods using the `In situ cell
death detection kit, TMR red' (Roche) on 12 µm cryostat sections of stage
34-41 lipofected embryos.
| Results |
|---|
|
|
|---|
|
|
Expression of Xseb4R in the developing neural retina
To better study Xseb4R expression during retinal development, we
examined sectioned embryos after whole-mount in situ hybridisation and
analysed more carefully its expression in the developing eye. At stages 28 and
32, when most cells in the optic vesicle are proliferating, Xseb4R
expression is distributed throughout the neural retina
(Fig. 3A,B). From stage 34
onwards, Xseb4R expression is no longer observed in the central
retina, where neurons start to differentiate. It rather becomes restricted to
the margins, where retinoblasts continue to proliferate, and to the lens
(Fig. 3C). At stage 40, when
all cells in the central retina are postmitotic, Xseb4R expression is
observed in the ciliary marginal zone (CMZ), the only region of the retina
where retinogenesis is still occurring
(Fig. 3D). Xseb4R
expression is, however, not detected in the most peripheral region of the CMZ
(Fig. 3D), where stem cells are
present (Dorsky et al.,
1995
).
|
As a RNA-binding protein can play a role in the nucleus, in the cytoplasm,
or in both, we wanted to determine the subcellular localisation of XSEB4R
protein. With this aim, we constructed a Flag epitope-tagged form of XSEB4R
(XSEB4R-FLAG). We co-transfected this construct into retinoblasts at stage 18
using the in vivo lipofection technique
(Holt et al., 1990
). We then
analysed its subcellular localisation by immunostaining with an anti-Flag
antibody in the retina. We found that XSEB4R-FLAG is concentrated in the
cytoplasm of retinoblasts (cells where the endogenous gene is expressed, see
above), whereas only a faint staining is detected in the nucleus
(n=177 examined cells; Fig.
3H,J). The subcellular localisation of XSEB4R-FLAG thus suggests
that XSEB4R is involved in RNA metabolism regulation at a cytoplasmic
level.
Targeted expression of Xseb4R in retinal progenitor cells promotes early differentiation
During retinal neurogenesis, the different cell types of the retina are
born in a sequence that is conserved across species. Retinal ganglion cells
are born first, bipolar cells and Müller glial cells last
(Holt et al., 1988
). As
Xseb4R is expressed coincidentally with bHLH genes involved in
retinoblast determination and differentiation, it may also play an important
role in regulating the determination/differentiation of these cells. To test
this hypothesis, we misexpressed Xseb4R in the developing retina by
in vivo lipofection of Xseb4R DNA into the optic vesicles of stage 18
embryos. GFP DNA was co-transfected, allowing identification of transfected
cells in stage 41 retina, when most cells in the central retina are
postmitotic and fully differentiated (Holt
et al., 1988
). The analysis of retinal sections transfected with
Xseb4R and GFP shows that GFP-positive cells are present mainly in
the ganglion cell layer and in the photoreceptor layer, while very few
positive cells are formed in the inner nuclear layer
(Fig. 4B). This is very
different from a control retina transfected only with GFP, where inner nuclear
layer cells are the most represented cells
(Fig. 4A).
|
Another hypothesis is that cells supposed to be in this layer have changed
their cellular fate in favor of ganglion or photoreceptor cells. To analyse
this hypothesis quantitatively, we counted the different types of cells
transfected with Xseb4R. We indeed found that overexpression of
Xseb4R leads to a significant increase of ganglion cells and
photoreceptors at the expense of amacrine, bipolar and Müller cells
(Fig. 4C). We confirmed that
Xseb4R transfected cells observed in the ganglion cell layer are
indeed differentiated ganglion cells by staining with an anti-islet1 antibody
(a ganglion cell marker, data not shown). We found that the number of
horizontal cells also had a tendency to decrease but this effect was rarely
significant (probably due to the low number of horizontal cells) and highly
variable from one experiment to another. Nevertheless, our results suggest
that overexpression of Xseb4R leads to a proneural-like effect,
pushing progenitor cells to differentiate prematurely as ganglion or
photoreceptor cells at the expense of late born cells (bipolar and Müller
cells). We found exactly the same phenotype when we overexpressed
Xseb4R-Flag (Fig. 4C),
which demonstrates that the FLAG epitope does not alter the function of the
XSEB4R protein, which strengthens the subcellular localisation of XSEB4R-FLAG
(see above). Xath3 is a bHLH gene that leads to a very similar effect
when lipofected in the retina (Perron et
al., 1999b
). To compare the strength of their effects, we
lipofected side-by-side Xath3 and Xseb4R in the same batch
of embryos. Xath3 and Xseb4R both increase photoreceptors
and ganglion cells by the same magnitude (data not shown). The XSEB4R
homologue, XSEB4, shows a high degree of similarity to XSEB4R
(Fig. 1). We therefore wondered
whether the specificity of XSEB4R arises from its expression in neural tissue
(Xseb4 being mostly expressed in muscle) or from protein-functional
differences. We therefore lipofected side-by-side Xseb4R and
Xseb4. We found that these two genes cause the same effects in the
retina (data not shown), suggesting that XSEB4, at least when overexpressed,
can interact with the same targets than XSEB4R.
Experimental set up of in vivo lipofection using morpholino oligonucleotides
To further characterise XSEB4R function during retinogenesis, we tried to
block its function during retinogenesis. We therefore set up a new protocol to
transfect morpholinos (Mo) into retinoblasts in vivo. Mo are antisense
oligonucleotides that block the translation of a target gene with a high
specificity (Ekker and Larson,
2001
; Heasman,
2002
). Recently we have shown that Mo can be efficiently
lipofected in retinoblasts and that they do not interfere with retinogenesis
under a certain threshold (Ohnuma et al.,
2002
). In order to determine whether lipofected Mo could indeed
block the translation of a target gene, we first tested this technique with Mo
directed against the mRNA encoding GFP (GFP Mo). We therefore colipofected GFP
Mo, or a standard control Mo, plus a GFP plasmid and then analysed the
intensity of the GFP fluorescence in the retina. To prevent any subjectivity
in the analysis, we added a filter that decreased the fluorescence light of
the microscope, implying that low fluorescent cells would be below the
detectable threshold. As a positive control, we also co-transfected a plasmid
encoding the CD2 protein. CD2 is a membrane protein
(Brown et al., 1987
) for which
a very good antibody is available. We then analysed GFP fluorescence among
lipofected retinas (CD2 positive). If the GFP intensity is low (below the
detectable threshold), then cells would be only CD2 positive, whereas if the
GFP intensity is normal or high, cells would be both CD2 and CFP positive. We
found that GFP intensity in retinas transfected with GFP plus GFP Mo is
strongly diminished compared with control retinas transfected with GFP plus a
control Mo (Fig. 5A). This
experiment thus shows that lipofected Mo can specifically and effectively
reduce translation of their target genes in such lipofection experiments, and
can therefore be used to block the function of a given gene in the retina.
|
tubulin (Fig.
5B). This result shows that Xseb4R Mo1 indeed
specifically and efficiently blocks the translation of Xseb4R
mRNA.
In order to obtain a knock down of Xseb4R during retinogenesis, we
used two different Mo directed against Xseb4R, namely Xseb4R
Mo1 and Xseb4R Mo2. Some authors have reported that some Mo can have
unspecific effects at a certain threshold concentration that is Mo dependent
(Heasman, 2002
). These effects
may complicate the study of a not yet characterised gene because it is
impossible to distinguish between an unknown loss-of-function phenotype and an
unspecific effect. We therefore used two Mo directed against two different
regions of Xseb4R mRNA sequences (see Materials and methods) and
compared their effects. We have previously studied the optimum concentration
of a control Mo that does not lead to any toxic effect in the retina
(Ohnuma et al., 2002
). We
therefore targeted a subcritical concentration of Xseb4R Mo1 or
Xseb4R Mo2 into the developing retina by in vivo lipofection of optic
vesicles in stage 18 embryos together with GFP DNA as a tracer
(Fig. 5C). Control embryos were
co-lipofected with GFP DNA and a standard control Mo. Transfected
retinal cells were counted on stage 41 embryos. Consistent with our
overexpression data, the two Xseb4R Mo lead to the same phenotype,
characterised by a significant increase of Müller cells at the expense of
ganglion cells (Fig. 5C),
indicating a change of cell fate specification in which the latest born cells
of the retina are promoted at the expense of the earliest born cell type. To
rule out the possibility that the decrease of ganglion cells was due to
apoptosis, we performed a TUNEL assay at stages 34 and 38, and counted the
number of apoptotic cells. At stage 34, we found an average of 3.2 apoptotic
cells per control retina (n=37 retinas) and 2.9 apoptotic cells per
retina transfected with Xseb4R Mo1 (n=40 retinas). At stage
38, we found that 25% (n=539 cells in 19 retinas) of apoptotic cells
in the retina reside in the ganglion cell layer compared with 24%
(n=461 cells in 17 retinas) in retinas transfected with Xseb4R
Mo1. Therefore, this suggests that there is no significant increase in
apoptosis following Xseb4R Mo1 transfection in cells in the ganglion
cell layer.
Overexpression of Xseb4R during primary neurogenesis promotes neuronal differentiation
We then wondered whether Xseb4R could also have a proneural-like
effect during primary neurogenesis. We therefore injected transcripts encoding
XSEB4R unilaterally into two-cell stage embryos, using lacZ mRNA as a
tracer. The embryos were collected at stage 15 and the expression of
N-tubulin, a neuronal-specific marker, was analysed by whole-mount in
situ hybridisation. Surprisingly, overexpression of high concentrations of
Xseb4R RNA (>100 pg) inhibits N-tubulin expression
(Fig. 6B; 100%, n=85
embryos). However, to the contrary, low dose of Xseb4R RNA (50 pg)
promoted the formation of ectopic N-tubulin-positive neuroepithelial
cells in the lateral ectoderm (74%, n=35 embryos;
Fig. 6C). The lateral band of
N-tubulin is indeed expanded laterally. Ectopic
N-tubulin-positive cells were never observed in control
lacZ-injected embryos (Fig.
6A).
|
When 100 pg of Xseb4R-GR transcripts were injected into one or two animal blastomers of 4- to 8-cell stage embryos, and then treated with dexamethasone at developmental stages between 9.5 and 10, a high number (80%, n=34/42 embryos) of the injected embryos still showed a significant reduction of N-tubulin expression (Fig. 6D). However, a high proportion (53%, n=29/55 embryos) of the injected embryos induced at a developmental stage of between 10.5 and 11 showed a significant increase of N-tubulin-positive cells within the territory of primary neurogenesis (Fig. 6E), whereas no increase was observed in the control (n=52) (Fig. 6G). This result strongly suggests that when activated between stage 10.5 and 11, Xseb4R is able to upregulate the process of neuronal differentiation. However, a low proportion of the injected embryos showed no phenotype (10/55, 18%) or showed a reduction (16/55, 29%) of N-tubulin expression (data not shown), indicating that some of the dexamethasone-treated embryos were not at the right competence to signal the proneural activity of XSEB4R.
Reduced function of Xseb4R during primary neurogenesis inhibits neurogenesis
To gain more insight into the role of Xseb4R during primary
neurogenesis, we decided to analyse the effects of its knock down and to
compare them with our overexpression data. Various amounts of Xseb4R
Mo1 were injected into one cell of a two-cell stage embryo. The embryos were
collected at stage 15 and the expression of N-tubulin was analysed by
whole-mount in situ hybridisation. Overexpression of the lowest dose, 5 ng of
Xseb4R Mo1, results in a phenotype that is not significantly
different from that observed in embryos injected with a control Mo
(Fig. 6J). However, 10 or 20 ng
of Xseb4R Mo1 significantly inhibits N-tubulin expression
(Fig. 6I,J). Taken together,
these results suggest that Xseb4R plays an important role in primary
neurogenesis
Xseb4R acts downstream of XNgnr1 and XNeuroD during primary neurogenesis and is regulated by lateral inhibition
As we reported above, Xseb4R is expressed in the CMZ of the
retina, as well as during primary neurogenesis in the region where many
regulators of retinogenesis and primary neurogenesis (such as proneural,
neurogenic and differentiation genes) are also expressed. In addition, our
functional studies during retinogenesis and primary neurogenesis suggest that
Xseb4R is involved in neuronal differentiation. Xseb4R
expression is therefore likely to be responsive to proneural and neurogenic
signalling pathways. We addressed this question directly in vivo by analysing
the transcriptional regulation of Xseb4R in response to the activated
proneural and neurogenic pathways. mRNAs encoding XNgnr1 or its downstream
target, XNeuroD, which also encodes a transcriptional regulator, were
injected into one of the two blastomeres of two-cell stage embryos.
lacZ mRNA was co-injected as a tracer. Embryos were fixed at neurula
stage and stained by X-gal treatment for probe distribution control. Results
obtained by whole-mount in situ hybridisation show that Xseb4R
expression is ectopically activated by XNgnr1 (100%, n=135),
suggesting that this gene functions downstream of the neuronal determination
bHLH factor (Fig. 7A,B).
Similar results were obtained with XNeuroD (78%, n=86;
Fig. 7C,D). We then injected
100 pg of Xseb4R-GR transcripts into one of the blastomeres of 4-cell
stage embryos, treated the embryos with dexamethasone between stage 10.5 and
11, and analysed the expression of XNgnr1 and XNeuroD. Under
these conditions, although N-tubulin expression is upregulated (see
above), no ectopic expression of XNgnr1 or XNeuroD was
observed (data not shown). Altogether these results indicate that
Xseb4R functions downstream of these bHLH factors.
|
| Discussion |
|---|
|
|
|---|
XSEB4R is a novel RNA-binding protein
Xseb4R encodes a putative RNA-binding protein containing a single
RRM. Some RRM-containing proteins also contain other RNA-binding domains. For
example, Vg1-RBP/vera has two RRMs as well as four KH domains (reviewed by
Yaniv and Yisraeli, 2002
).
However, in the XSEB4R protein sequence, besides the RRM, we have not detected
any other consensus sequences revealing the presence of another known domain.
The C-terminal two-thirds of XSEB4R is somewhat enriched with proline
residues, known to be involved in protein-protein interactions (reviewed by
Williamson, 1994
). A single
RRM is known to be sufficient to bind RNA
(Scherly et al., 1989
), but
better target specificity has been demonstrated when several RRMs are present
(Kuhn and Pieler, 1996
). These
data suggest that XSEB4R could act through a multi-protein complex, conferring
a higher specificity. The two additional conserved domains, observed in the
C-terminal half of the vertebrate SEB4 protein sequence, could be involved in
the formation of this protein complex.
RNA-binding proteins can regulate the expression of their mRNA targets at
different steps of mRNA processing and translation
(Harford and Morris, 1997
). We
have shown that an epitope-tagged XSEB4R protein is mainly cytoplasmic in
retinal progenitors. We therefore propose that this protein could regulate the
transport, the stability or the translation of its mRNA targets in the
cytoplasm.
Xseb4R is expressed in neural progenitor cells
We found that Xseb4R is strongly expressed in the developing
nervous system. As we have not detected any expression in cranial ganglia,
Xseb4R expression in the nervous system seems to be restricted to the
CNS, at least during early neurogenesis. However, its expression is not
restricted to the nervous system. Xseb4R expression is multiphasic
and arises in (1) the mesoderm during gastrulation, (2) the neuroectoderm
during neurulation, and (3) different organs of the endoderm during
organogenesis. Expression of the related Xenopus gene Xseb4,
as Xseb4R, is not restricted to a single tissue. Xseb4 is
indeed mainly expressed in muscle but also in the lens
(Fetka et al., 2000
). These
genes seem therefore to be involved in different developmental processes.
In the retina, Xseb4R is expressed in retinoblasts of the
developing optic vesicle. To compare its expression with that of other genes
involved in retinogenesis, we took advantage of the specific properties of the
CMZ. According to the expression of various genes and to cell division
activity, the CMZ has been divided into four different regions from the
peripheral to the central retina (Perron
et al., 1998
). Proneural and differentiation genes are not
expressed in the first zone of the CMZ, which contains retinal stem cells, but
in proliferating retinoblasts and some postmitotic neurons
(Perron et al., 1998
). We
showed that Xseb4R is also expressed in the CMZ, in both
proliferating retinoblasts and postmitotic neurons, and is excluded from the
most peripheral region. This expression correlates nicely with the expression
of Xseb4R in the subventricular zone of the neural tube during
primary neurogenesis, where neurons are in the transition step between
proliferation and differentiation. Some differentiation genes, such as
XNeuroD or Xath3, are also expressed in a subset of neurons
in the central retina (Perron et al.,
1998
). Xseb4R expression, however, is restricted to the
CMZ in the mature retina, like some proneural genes such as Xash1,
Xash3 and XNgnr1, or the atonal-like gene
Xath5. The expression of neurogenic genes belonging to the
Notch/Delta signalling cascade is also similarly restricted to the CMZ. The
expression of Xseb4R in this region of the CMZ together with several
proneural and neurogenic genes suggests that it is involved in crucial steps
of retinogenesis, where precursor cells become determined and differentiate
into a particular type of retinal neuron or glial cell.
Xseb4R is involved in neurogenesis during both primary neurogenesis and retinal development
In Xenopus, several strategies to reveal a loss-of-function effect
have been used. For example, fusion constructs between the DNA-binding domain
of a transcription factor and an activator domain (VP16), or a repressor
domain (Engrailed), have been used extensively (e.g.
Mariani and Harland, 1998
).
Ectopic expression of dominant-negative variants is another alternative. This
is often the case for transmembrane receptors (e.g.
McFarlane et al., 1996
).
Researchers working on RNA-binding proteins belonging to the ELAV family have
constructed dominant-negative versions of these proteins. This was possible
because ELAV-type proteins contain three RRMs
(Robinow et al., 1988
). It has
indeed been proposed that truncated constructs, missing one or two RRMs,
behave as dominant-negative constructs
(Akamatsu et al., 1999
;
Kasashima et al., 1999
;
Anderson et al., 2000
).
However, because XSEB4R only contains one RRM we could not use such a
strategy.
Mo have recently been used in developmental studies in a wide range of
model organisms to block the translation of a target mRNA
(Ekker and Larson, 2001
;
Heasman, 2002
). So far, in
Xenopus, Mo have been used in blastomere injection experiments. In
order to target a single tissue where we expect a loss-of-function phenotype,
we set up a protocol to lipofect Mo in vivo into specific regions
(Ohnuma et al., 2002
). In this
paper, we demonstrate the efficiency of this Mo lipofection strategy in the
retina. Our results with Xseb4R Mo suggest that this gene is required
for ganglion cell production. Whether Xseb4R specifically promotes
ganglion cells or simply promotes neurogenesis remains to be determined.
Indeed, because ganglion cells are the first cells to be born in the retina,
one cannot distinguish between these two hypotheses. Nevertheless, it is
important to note that the Xseb4R knockdown phenotype reflects the
opposite phenotype, as obtained in the gain-of-function experiments. Indeed
when we overexpress Xseb4R in retinoblasts, they tend to
differentiate precociously. It has indeed been shown previously that when
precursors are forced to adopt an early fate, an increase in ganglion and cone
photoreceptor is observed (Dorsky et al.,
1997
). When they are forced to differentiate slightly later an
increase in the number of cone and rod photoreceptors is observed
(Dorsky et al., 1997
).
Although overexpression of Xseb4R induces a severe phenotype,
significantly affecting almost all cell types, the Xseb4R knockdown
phenotype is less severe, as photoreceptor cells, amacrine and bipolar cells
are not affected. This suggests that the Mo strategy does not lead to a
complete loss of function, but rather reduces the amount of XSEB4R protein in
vivo. Alternatively, this could be due to a redundant function of another
RNA-binding protein partly compensating for the absence of XSEB4R.
Nevertheless, our knockdown experiment, together with our gain-of-function
experiment, strongly suggest that Xseb4R promotes neurogenesis during
retinal development.
So far, mainly transcription factors have been found to have such an effect
in retinogenesis. Indeed, overexpression of Xath3 in the retina leads
to exactly the same phenotype as Xseb4R overexpression (this study)
(Perron et al., 1999b
). This
paper thus provides the first example of an RNA-binding protein displaying
proneural properties in the retina.
During primary neurogenesis, we found that Xseb4R could also have
a proneural-like effect, i.e. activation of N-tubulin expression when
overexpressed, only at a particular dose or at a particular time during
development. Such discrepancy in Xseb4R expression pattern
(Notch/Delta-like pattern) and resulting proneural-like function has already
been observed with the Hes6 gene
(Koyano-Nakagawa et al.,
2000
). Furthermore, functional characteristics of XBF1, an
anterior neural plate-specific winged helix transcription factor, just like
the data that we report on Xseb4R overexpression, revealed ectopic
N-tubulin expression at low doses and inhibition of this same marker
at high doses (Hardcastle and Papalopulu,
2000
). These differential effects of XBF1 were found to correlate
with its role in cell proliferation. In the context of our studies, we did not
know which early functions could be mediated by Xseb4R. However,
because we saw gastrulation defects when a high dose of Xseb4R was
injected, one hypothesis is that it interferes with early development,
preventing us from analysing its specific effect during neurogenesis. By using
an inducible construct we managed to overcome this problem and to analyse the
effect of Xseb4R on early neurogenesis. We indeed found that when
activated towards the end of gastrulation, i.e. between stage 10.5 and 11,
just like with low doses of Xseb4R, Xseb4R-GR promotes ectopic
neurogenesis as well. This effect is in accordance with the Xseb4R
knockdown effect, which inhibits neuronal differentiation. Therefore, these
results suggest that during primary neurogenesis Xseb4R has, as in
the retina, proneural properties.
Xseb4R is regulated by proneural genes
As a result of Xseb4R expression in the CMZ and of our functional
analysis, we wanted to identify genes belonging to the genetic cascade
involved in neurogenesis that could regulate Xseb4R expression. We
found that the proneural gene XNgnr1 is able to induce strong ectopic
expression of Xseb4R in the whole ectoderm. We have also shown that
the atonal-like gene XNeuroD (a differentiation gene) also
induces ectopic expression of Xseb4R. In addition, our analysis
reveals that Notch/Delta signalling negatively regulates Xseb4R
expression. This is similar to the inhibition found for several bHLH proneural
genes, such as XNgnr1 (Chitnis
and Kintner, 1996
). Altogether, these results suggest that
Xseb4R is a component of the genetic cascade involved in
neurogenesis. It would be interesting now to characterise genes that function
downstream of Xseb4R during neurogenesis and that may be
post-transcriptionally regulated by this cytoplasmic RNA-binding protein.
It has recently been reported that Xenopus NeuroD is regulated
post-translationally by the kinase GSK3ß
(Moore et al., 2002
). This
observation, together with ours, illustrates the fact that
post-transcriptional and post-translational regulators may have a crucial role
in neurogenesis. These regulatory mechanisms, in contrast to transcriptional
gene regulation, have been poorly studied so far during vertebrate
neurogenesis.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Akamatsu, W., Okano, H. J., Osumi, N., Inoue, T., Nakamura, S.,
Sakakibara, S., Miura, M., Matsuo, N., Darnell, R. B. and Okano, H.
(1999). Mammalian ELAV-like neuronal RNA-binding proteins HuB and
HuC promote neuronal development in both the central and the peripheral
nervous systems. Proc. Natl. Acad. Sci. USA
96,9885
-9890.
Anderson, K. D., Morin, M. A., Beckel-Mitchener, A., Mobarak, C. D., Neve, R. L., Furneaux, H. M., Burry, R. and Perrone-Bizzozero, N. I. (2000). Overexpression of HuD, but not of its truncated form HuD I+II, promotes GAP-43 gene expression and neurite outgrowth in PC12 cells in the absence of nerve growth factor. J. Neurochem. 75,1103 -1114.[CrossRef][Medline]
Aranda-Abreu, G. E., Behar, L., Chung, S., Furneaux, H. and
Ginzburg, I. (1999). Embryonic lethal abnormal vision-like
RNA-binding proteins regulate neurite outgrowth and tau expression in PC12
cells. J. Neurosci. 19,6907
-6917.
Beckel-Mitchener, A. C., Miera, A., Keller, R. and
Perrone-Bizzozero, N. I. (2002). Poly(A) tail
length-dependent stabilization of GAP-43 mRNA by the RNA-binding protein HuD.
J. Biol. Chem. 277,27996
-28002.
Bellefroid, E. J., Bourguignon, C., Hollemann, T., Ma, Q., Anderson, D. J., Kintner, C. and Pieler, T. (1996). X-MyT1, a Xenopus C2HC-type zinc finger protein with a regulatory function in neuronal differentiation. Cell 87,1191 -1202.[CrossRef][Medline]
Bertrand, N., Castro, D. S. and Guillemot, F. (2002). Proneural genes and the specification of neural cell types. Nat. Rev. Neurosci. 3, 517-530.[CrossRef][Medline]
Broadbent, J. and Read, E. M. (1999). Whole-mount in situ hybridization of Xenopus and zebrafish embryos. Methods Mol. Biol. 127,57 -67.[CrossRef][Medline]
Brown, M. H., Krissansen, G. W., Totty, N. F., Sewell, W. A. and Crumpton, M. J. (1987). Purification and N-terminal amino acid sequence of the human T lymphocyte CD2 (T11) surface antigen. Eur. J. Immunol. 17,15 -20.[Medline]
Brown, N. L., Patel, S., Brzezinski, J. and Glaser, T.
(2001). Math5 is required for retinal ganglion cell and optic
nerve formation. Development
128,2497
-2508.
Burd, C. G. and Dreyfuss, G. (1994). Conserved
structures and diversity of functions of RNA-binding proteins.
Science 265,615
-621.
Cepko, C. L. (1999). The roles of intrinsic and extrinsic cues and bHLH genes in the determination of retinal cell fates. Curr. Opin. Neurobiol. 9, 37-46.[CrossRef][Medline]
Chitnis, A. and Kintner, C. (1996). Sensitivity of proneural genes to lateral inhibition affects the pattern of primary neurons in Xenopus embryos. Development 122,2295 -2301.[Abstract]
Chitnis, A., Henrique, D., Lewis, J., Ish-Horowicz, D. and Kintner, C. (1995). Primary neurogenesis in Xenopus embryos regulated by a homologue of the Drosophila neurogenic gene Delta. Nature 375,761 -766.[CrossRef][Medline]
Coffman, C., Harris, W. and Kintner, C. (1990).
Xotch, the Xenopus homolog of Drosophila notch.
Science 249,1438
-1441.
Cuadrado, A., Garcia-Fernandez, L. F., Imai, T., Okano, H. and Munoz, A. (2002). Regulation of tau RNA maturation by thyroid hormone is mediated by the neural RNA-binding protein musashi-1. Mol. Cell. Neurosci. 20,198 -210.[CrossRef][Medline]
Dorsky, R. I., Rapaport, D. H. and Harris, W. A. (1995). Xotch inhibits cell differentiation in the Xenopus retina. Neuron 14,487 -496.[CrossRef][Medline]
Dorsky, R. I., Chang, W. S., Rapaport, D. H. and Harris, W. A. (1997). Regulation of neuronal diversity in the Xenopus retina by Delta signalling. Nature 385, 67-70.[CrossRef][Medline]
Duchaine, T. F., Hemraj, I., Furic, L., Deitinghoff, A.,
Kiebler, M. A. and DesGroseillers, L. (2002). Staufen2
isoforms localize to the somatodendritic domain of neurons and interact with
different organelles. J. Cell Sci.
115,3285
-3295.
Ekker, S. C. and Larson, J. D. (2001). Morphant technology in model developmental systems. Genesis 30, 89-93.[CrossRef][Medline]
Ferreiro, B., Skoglund, P., Bailey, A., Dorsky, R. and Harris, W. A. (1993). XASH1, a Xenopus homolog of achaete-scute: a proneural gene in anterior regions of the vertebrate CNS. Mech. Dev. 40,25 -36.[CrossRef][Medline]
Fetka, I., Radeghieri, A. and Bouwmeester, T. (2000). Expression of the RNA recognition motif-containing protein SEB-4 during Xenopus embryonic development. Mech. Dev. 94,283 -286.[CrossRef][Medline]
Gerber, W. V., Yatskievych, T. A., Antin, P. B., Correia, K. M., Conlon, R. A. and Krieg, P. A. (1999). The RNA-binding protein gene, hermes, is expressed at high levels in the developing heart. Mech. Dev. 80,77 -86.[CrossRef][Medline]
Good, P. J., Rebbert, M. L. and Dawid, I. B.
(1993). Three new members of the RNP protein family in Xenopus.
Nucl. Acids Res. 21,999
-1006.
Hardcastle, Z. and Papalopulu, N. (2000). Distinct effects of XBF-1 in regulating the cell cycle inhibitor p27(XIC1) and imparting a neural fate. Development. 127,1303 -1314.[Abstract]
Harford, J. B. and Morris, D. R. (1997). mRNA metabolism and post-transcriptional gene regulation. Bethesda, MD: Wiley-Liss.
Heasman, J. (2002). Morpholino oligos: making sense of antisense? Dev. Biol. 243,209 -214.[CrossRef][Medline]
Holt, C. E., Bertsch, T. W., Ellis, H. M. and Harris, W. A. (1988). Cellular determination in the Xenopus retina is independent of lineage and birth date. Neuron 1, 15-26.[CrossRef][Medline]
Holt, C. E., Garlick, N. and Cornel, E. (1990). Lipofection of cDNAs in the embryonic vertebrate central nervous system. Neuron 4,203 -214.[CrossRef][Medline]
Inoue, T., Hojo, M., Bessho, Y., Tano, Y., Lee, J. E. and Kageyama, R. (2002). Math3 and NeuroD regulate amacrine cell fate specification in the retina. Development 129,831 -842.
Kanekar, S., Perron, M., Dorsky, R., Harris, W. A., Jan, L. Y., Jan, Y. N. and Vetter, M. L. (1997). Xath5 participates in a network of bHLH genes in the developing Xenopus retina. Neuron 19,981 -994.[CrossRef][Medline]
Kasashima, K., Terashima, K., Yamamoto, K., Sakashita, E. and Sakamoto, H. (1999). Cytoplasmic localization is required for the mammalian ELAV-like protein HuD to induce neuronal differentiation. Genes Cells 4,667 -683.[Abstract]
Kay, J. N., Finger-Baier, K. C., Roeser, T., Staub, W. and Baier, H. (2001). Retinal ganglion cell genesis requires lakritz, a Zebrafish atonal homolog. Neuron 30,725 -736.[CrossRef][Medline]
Kiebler, M. A. and DesGroseillers, L. (2000). Molecular insights into mRNA transport and local translation in the mammalian nervous system. Neuron 25, 19-28.[CrossRef][Medline]
Koyano-Nakagawa, N., Wettstein, D. and Kintner, C. (1999). Activation of Xenopus genes required for lateral inhibition and neuronal differentiation during primary neurogenesis. Mol. Cell. Neurosci. 14,327 -339.[CrossRef][Medline]
Koyano-Nakagawa, N., Kim J., Anderson, D. and Kintner, C. (2000). Hes6 acts in a positive feedback loop with the neurogenins to promote neuronal differentiation. Development, 127,4203 -4216.[Abstract]
Kuhn, U. and Pieler, T. (1996). Xenopus poly(A) binding protein: functional domains in RNA binding and protein-protein interaction. J. Mol. Biol. 256, 20-30.[CrossRef][Medline]
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227,680 -685.[CrossRef][Medline]
Lamar, E., Kintner, C. and Goulding, M. (2001). Identification of NKL, a novel Gli-Kruppel zinc-finger protein that promotes neuronal differentiation. Development 128,1335 -1346.[Abstract]
Ma, Q., Kintner, C. and Anderson, D. J. (1996). Identification of neurogenin, a vertebrate neuronal determination gene. Cell 87,43 -52.[CrossRef][Medline]
Manohar, C. F., Short, M. L., Nguyen, A., Nguyen, N. N.,
Chagnovich, D., Yang, Q. and Cohn, S. L. (2002). HuD, a
neuronal-specific RNA-binding protein, increases the in vivo stability of MYCN
RNA. J. Biol. Chem. 277,1967
-1973.
Marcus, E. A., Kintner, C. and Harris, W. (1998). The role of GSK3beta in regulating neuronal differentiation in Xenopus laevis. Mol. Cell. Neurosci. 12,269 -280.[CrossRef][Medline]
Mariani, F. V. and Harland, R. M. (1998). XBF-2 is a transcriptional repressor that converts ectoderm into neural tissue. Development 125,5019 -5031.[Abstract]
Matsuzaki, F., Ohshiro, T., Ikeshima-Kataoka, H. and Izumi, H. (1998). miranda localizes staufen and prospero asymmetrically in mitotic neuroblasts and epithelial cells in early Drosophila embryogenesis. Development 125,4089 -4098.[Abstract]
McFarlane, S., Cornel, E., Amaya, E. and Holt, C. E. (1996). Inhibition of FGF receptor activity in retinal ganglion cell axons causes errors in target recognition. Neuron 17,245 -254.[CrossRef][Medline]
Moore, K. B., Schneider, M. L. and Vetter, M. L. (2002). Posttranslational mechanisms control the timing of bHLH function and regulate retinal cell fate. Neuron 34,183 -195.[CrossRef][Medline]
Morcos, P. A. (2001). Achieving efficient delivery of morpholino oligos in cultured cells. Genesis 30,94 -102.[CrossRef][Medline]
Morrow, E. M., Furukawa, T., Lee, J. E. and Cepko, C. L. (1999). NeuroD regulates multiple functions in the developing neural retina in rodent. Development 126, 23-36.[Abstract]
Niehrs, C. and Pollet, N. (1999). Synexpression groups in eukaryotes. Nature 402,483 -487.[CrossRef][Medline]
Niehrs, C., Steinbeisser, H. and De Robertis, E. M.
(1994). Mesodermal patterning by a gradient of the vertebrate
homeobox gene goosecoid. Science
263,817
-820.
Ohnuma, S., Mann, F., Boy, S., Perron, M. and Harris, W. A. (2002). Lipofection strategy for the study of Xenopus retinal development. Methods 28,411 -419.[CrossRef][Medline]
Okabe, M., Imai, T., Kurusu, M., Hiromi, Y. and Okano, H. (2001). Translational repression determines a neuronal potential in Drosophila asymmetric cell division. Nature 411, 94-98.[CrossRef][Medline]
Perron, M. and Harris, W. A. (2000). Determination of vertebrate retinal progenitor cell fate by the Notch pathway and basic helix-loop-helix transcription factors. Cell. Mol. Life Sci. 57,215 -223.[CrossRef][Medline]
Perron, M., Kanekar, S., Vetter, M. L. and Harris, W. A. (1998). The genetic sequence of retinal development in the ciliary margin of the Xenopus eye. Dev. Biol. 199,185 -200.[CrossRef][Medline]
Perron, M., Furrer, M. P., Wegnez, M. and Theodore, L. (1999a). Misexpression of the RNA-binding protein ELRB in Xenopus presumptive neurectoderm induces proliferation arrest and programmed cell death. Int. J. Dev. Biol. 43,295 -303.[Medline]
Perron, M., Opdecamp, K., Butler, K., Harris, W. A. and
Bellefroid, E. J. (1999b). X-ngnr-1 and Xath3 promote ectopic
expression of sensory neuron markers in the neurula ectoderm and have distinct
inducing properties in the retina. Proc. Natl. Acad. Sci.
USA 96,14996
-15001.
Perrone-Bizzozero, N. and Bolognani, F. (2002). Role of HuD and other RNA-binding proteins in neural development and plasticity. J. Neurosci. Res. 68,121 -126.[CrossRef][Medline]
Robinow, S., Campos, A. R., Yao, K. M. and White, K.
(1988). The elav gene product of Drosophila, required in neurons,
has three RNP consensus motifs. Science
242,1570
-1572.
Sakakibara, S., Nakamura, Y., Yoshida, T., Shibata, S., Koike,
M., Takano, H., Ueda, S., Uchiyama, Y., Noda, T. and Okano, H.
(2002). RNA-binding protein Musashi family: roles for CNS stem
cells and a subpopulation of ependymal cells revealed by targeted disruption
and antisense ablation. Proc. Natl. Acad. Sci. USA
99,15194
-15199.
Scherly, D., Boelens, W., van Venrooij, W. J., Dathan, N. A., Hamm, J. and Mattaj, I. W. (1989). Identification of the RNA binding segment of human U1 A protein and definition of its binding site on U1 snRNA. EMBO J. 8,4163 -4170.[Medline]
Shimamura, K., Hirano, S., McMahon, A. P. and Takeichi, M. (1994). Wnt-1-dependent regulation of local E-cadherin and alpha N-catenin expression in the embryonic mouse brain. Development 120,2225 -2234.[Abstract]
Souopgui, J., Solter, M. and Pieler, T. (2002). XPak3 promotes cell cycle withdrawal during primary neurogenesis in Xenopus laevis. EMBO J. 21,6429 -6439.[CrossRef][Medline]
Turner, D. L. and Weintraub, H. (1994).
Expression of achaete-scute homolog 3 in Xenopus embryos converts ectodermal
cells to a neural fate. Genes Dev.
8,1434
-1447.
Vetter, M. L. and Brown, N. L. (2001). The role of basic helix-loop-helix genes in vertebrate retinogenesis. Semin. Cell Dev. Biol. 12,491 -498.[CrossRef][Medline]
Wetts, R., Serbedzija, G. N. and Fraser, S. E. (1989). Cell lineage analysis reveals multipotent precursors in the ciliary margin of the frog retina. Dev. Biol. 136,254 -263.[CrossRef][Medline]
Williamson, M. P. (1994). The structure and function of proline-rich regions in proteins. Biochem. J. 297,249 -260.
Yaniv, K. and Yisraeli, J. K. (2002). The involvement of a conserved family of RNA binding proteins in embryonic development and carcinogenesis. Gene 287, 49-54.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
J. Souopgui, B. Rust,, J. Vanhomwegen, J. Heasman, K. A. Henningfeld, E. Bellefroid, and T. Pieler The RNA-binding protein XSeb4R: a positive regulator of VegT mRNA stability and translation that is required for germ layer formation in Xenopus Genes & Dev., September 1, 2008; 22(17): 2347 - 2352. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Solter, M. Locker, S. Boy, V. Taelman, E. J. Bellefroid, M. Perron, and T. Pieler Characterization and function of the bHLH-O protein XHes2: insight into the mechanisms controlling retinal cell fate decision Development, October 15, 2006; 133(20): 4097 - 4108. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Anyanful, K. Ono, R. C. Johnsen, H. Ly, V. Jensen, D. L. Baillie, and S. Ono The RNA-binding protein SUP-12 controls muscle-specific splicing of the ADF/cofilin pre-mRNA in C. elegans J. Cell Biol., November 22, 2004; 167(4): 639 - 647. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||