|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online February 2, 2004
doi: 10.1242/10.1242/dev.00981

Institute of Neuroscience, 1254 University of Oregon, Eugene, OR 97403, USA
Author for correspondence (e-mail:
eisen{at}uoneuro.uoregon.edu)
Accepted 12 November 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Somites, Motoneurons, MiP, CaP, Zebrafish, Spinal cord, Trilobite, Knypek, No tail, Spadetail, Fused somites, You-too, After eight, b380, b567
| Introduction |
|---|
|
|
|---|
In zebrafish, as in other vertebrates, Hedgehog signals from the embryonic
midline induce MNs in the ventral neural tube on both sides of the floor plate
(Eisen, 1999
;
Lewis and Eisen, 2001
). In all
vertebrates examined so far, additional signals from paraxial mesoderm then
specify distinct subpopulations of MNs that occupy specific motor columns at
particular anteroposterior (AP) axial levels
(Eisen, 1999
;
Ensini et al., 1998
;
Liu et al., 2001
). For
example, lateral motor column MNs are generated only at limb levels and
visceral MNs are generated at thoracic levels.
Embryonic zebrafish have individually identifiable MNs, facilitating
analysis of mechanisms that pattern neurons at the level of single cells. In
addition to distinct motor columns at particular AP axial levels
(Eisen, 1994
), zebrafish also
have a more fine-grained, segmentally reiterated pattern of different PMN
subtypes along the spinal cord AP axis. Such a fine-grained, reiterated
pattern of distinct MN subtypes has not yet been described in other
vertebrates, probably because there are many more MNs, and individual cells
cannot be recognized. Zebrafish have three different PMN subtypes: rostral
primary (RoP), middle primary (MiP) and caudal primary (CaP). One PMN of each
subtype forms per spinal hemisegment, with the exception that about half the
hemisegments initially have two CaP-like PMNs, one of which is called variably
present (VaP) and usually dies (Lewis and
Eisen, 2003
). Each PMN subtype is uniquely identifiable by soma
position relative to overlying somites and by axon trajectory. For example,
MiP and RoP somata are adjacent to overlying somite boundaries and CaP somata
are adjacent to overlying somite middles (e.g.
Fig. 1E,J). CaP axons project
into ventral myotome, MiP axons project into dorsal myotome and RoP axons
project into medial myotome (e.g. Fig.
1T,Z). Although many aspects of PMN development have been
characterized (Lewis and Eisen,
2003
), it is still unclear how these different subtypes are
specified.
|
The tight spatial correlation between the reiterated pattern of PMNs and
the overlying somites suggests that signals from paraxial mesoderm might
specify different PMN subtypes. Consistent with this idea, transplantation
experiments have shown that environmental signals can specify zebrafish PMN
subtypes (Appel et al., 1995
;
Eisen, 1991
). For example,
when MiP is transplanted 2-3 hours before axogenesis to the position where CaP
normally develops, the transplanted cell forms a CaP-like axon and initiates
expression of islet2. However, when MiP is transplanted in the same
way just 1 hour before axogenesis, it remains committed to its original fate,
extends a MiP-like axon and does not express islet2
(Appel et al., 1995
;
Eisen, 1991
). Furthermore, PMN
specification and development is disturbed in spadetail
(spt) mutants, which have a dramatic reduction of trunk paraxial
mesoderm (Bisgrove et al.,
1997
; Eisen and Pike,
1991
; Inoue et al.,
1994
; Tokumoto et al.,
1995
); when somite segmentation is disturbed by heat shock, the
position and axonal morphology of PMNs are also disturbed
(Kimmel et al., 1988
;
Roy et al., 1999
).
Together these observations suggest that signals from paraxial mesoderm may specify PMN subtypes. To test this hypothesis, we investigated PMN subtype specification in several zebrafish mutants that affect paraxial mesoderm development in different ways. We concentrated on MiP and CaP specification because these PMNs can be identified both molecularly and by axon trajectory. Our findings demonstrate that signals from paraxial mesoderm are required to specify MiPs and CaPs, and they suggest that additional signals from the somites are also required to fine-tune or maintain correct spatial organization of PMN subtypes.
| Materials and methods |
|---|
|
|
|---|
Mutant alleles used in this study
Df(LG12)dlx3bb380 (hereafter referred
to as Dfb380) is a deficiency on linkage group 12 that
removes 21-24 cM that includes dlx3b, dlx4b, sox9a, irbp, rbp4 and
dkk1 (Fritz et al.,
1996
; Liu et al.,
2003
). Df(LG05)her1b567
(hereafter referred to as Dfb567) is a deficiency on
linkage group 5 that removes up to 22 cM that includes her1, her7,
ndr3 and a number of ESTs (Henry et
al., 2002
). Other lines used were: after
eighttr233 (aei);
fused-somiteste314 (fss);
you-tooty17 (yot)
(van Eeden et al., 1996
);
no tailb195 (ntl)
(Halpern et al., 1993
);
spadetailb104 (spt)
(Ho and Kane, 1990
);
trilobitem209 (tri)
(Hammerschmidt et al., 1996
);
knypekb639 (kny)
(Topczewski et al., 2001
);
cyclopsb16 (cyc)
(Hatta et al., 1991
); and
floating headn1 (flh)
(Talbot et al., 1995
).
PMN subtype assays
All analyses were carried out on PMNs in the trunk except that PMNs in the
tail were analysed where noted in the text. Whenever possible, we assayed CaP
and MiP identity using both axon trajectory (znp1 antibody staining) at 26-30
hpf and gene expression (islet1 and islet2) at 17-19 hpf,
when MiPs, which are located directly under somite boundaries express
islet1 (Fig. 1E) and
CaPs, which are located under somite middles express islet2
(Fig. 1J). In all cases we
examined at least seven embryos in detail using a compound microscope, and in
several cases we analysed both whole mounts and serial cross-sections.
islet1 + islet2 double in situ RNA hybridization did not
provide strong enough signals to assess gene expression unequivocally.
Therefore, to determine the distribution of islet1-expressing and
islet2-expressing PMNs, we conducted in situ RNA hybridization for
each gene alone as well as Islet antibody staining followed by islet2
in situ RNA hybridization (Fig.
1). The Islet antibody recognizes both Islet1 and Islet2.
Therefore, PMNs recognized by both Islet antibody and islet2
riboprobe express islet2 and hence are CaPs, whereas PMNs recognized
by Islet antibody alone only express Islet1 and are MiPs
(Fig. 1O). In some mutants most
or all PMNs expressed islet2; comparison with islet1 in situ
RNA hybridization suggested that many of them also expressed islet1.
Therefore, these PMNs had a hybrid identity. In these cases we examined how
many PMNs expressed islet1 by Islet antibody staining followed by
islet1 in situ RNA hybridization; PMNs labeled by antibody alone
express only Islet2, whereas PMNs labeled by antibody and islet1
riboprobe express islet1 (Fig.
1Y). We were able to identify cells that expressed only
islet1, only islet2, or both islet1 and
islet2 unequivocally using this combination of markers.
In situ RNA hybridization and antibody staining
In situ RNA hybridization was performed as previously described
(Concordet et al., 1996
).
her1 probe was synthesized as described by Müller (Müller,
1996), cs131 probe was synthesized as described by Durbin et al.
(Durbin et al., 2000
), and
islet1 and islet2 probes were synthesized as described by
Appel et al. (Appel et al.,
1995
). Islet antibodies originally isolated by the Jessell
Laboratory were obtained from the Developmental Studies Hybridoma Bank
developed under the auspices of the NICHD and maintained by the University of
Iowa, Department of Biological Sciences, Iowa City, IA 52242. Antibody 39.4D5
was used alone at a final concentration of 1/200 or a 1:1 mixture of 39.4D5
and 40.2D6 was used; in the latter case, both antibodies were used at a final
concentration of 1/300. In cases in which Islet antibody staining and
islet1 or islet2 in situ RNA hybridization were performed on
the same embryos, antibody staining was carried out first. Embryos were fixed
for 5-6 hours at 4°C in 4% PFA in PBS, permeabilized by washing with PBS +
0.5% Triton for several hours and distilled H2O for 30 minutes and
blocked in a serum-free block solution [2% BSA; 1xPBS; 5-10% DMSO; 0.2%
Triton plus RNAse inhibitor (20-40 units/ml)] for 1 hour. Embryos were then
incubated with Islet antibody in fresh serum-free block overnight at 4°C.
Antibody staining was developed using the Sternberger Clonal PAP system and
detected using a Vector Laboratories DAB kit. The same serum-free block was
used for secondary and tertiary antibodies. Embryos were then fixed for 15-20
minutes in 4% PFA in PBS and processed for in situ RNA hybridization.
Axon trajectories were assessed as described by Eisen et al.
(Eisen et al., 1989
) using
znp1 monoclonal antibody (Trevarrow et
al., 1990
), the Sternberger Clonal PAP system and Vector
Laboratories DAB kit. In all cases, CaP axons were clearly visible both in
whole mount and in cross-section. In some mutants, MiP axons were easier to
identify in cross-section.
Specimens were analysed using a Zeiss Axioplan microscope and photographed with Kodak Ektachrome 64T or 164T film. Images were scanned on a Nikon LS-1000 35mm film scanner and processed using Adobe Photoshop software.
Morpholino injections
Morpholino antisense oligonucleotides (MOs) were obtained from Gene Tools.
About 5 nl of a MO mix (ntl MO 1 mg/ml; spt MO #1 0.75
mg/ml; spt MO #2 0.075 mg/ml) was injected into one- to two-cell
wild-type embryos. This concentration reliably phenocopied ntl;spt
mutants. The MO sequences were: ntl MO, GACTTGAGGCAGGCATATTTCCGAT
(see also Nasevicius and Ekker,
2000
); spt MO #1, AGCCTGCATTATTTAGCCTTCTCTA; and
spt MO #2, GATGTCCTCTAAAAGAAAATGTCAG.
Transplantation
For all blastula stage transplants and some somite transplants we used
ntl;spt MO-injected embryos as hosts. We confirmed that MO-injected
embryos phenocopy ntl;spt mutants by examining their morphology,
islet1 and islet2 expression patterns and
tropomyosin expression (to confirm absence of somitic mesoderm).
Blastula stage transplants
Wild-type donor embryos were injected with a mixture of 2.5% 3 kDa
fluorescein dextran and 2.5% 3 kDa rhodamine dextran in 0.2M KCl at the one-
to two-cell stage. Host embryos were injected with a mixture of ntl
and spt MOs at the one- to two-cell stage. Fluorescently labeled,
wild-type cells were transplanted into the margin of ntl;spt
MO-injected embryos between blastula and 30% epiboly stages
(Fig. 6A); embryos were
analysed and fixed at 18-22 somites.
|
Intracellular labels
Individual PMNs were labeled in live embryos
(Eisen et al., 1989
).
| Results |
|---|
|
|
|---|
|
|
Because CaPs normally have turned off islet1 expression by the time they extend axons, our results suggest that in tri;kny mutants most PMNs have a hybrid identity with respect to gene expression but a CaP-like identity based on axon trajectory. This is consistent with our hypothesis that signals from somites specify MiPs and CaPs. The simplest interpretation of our results is that in wild types there are two spatially separated signals: one that specifies MiPs and one that specifies CaPs, whereas in tri;kny mutants the narrow somites cause these signals to overlap so all PMNs are exposed to both signals. However, it is also possible that these mutations affect somites and PMNs independently. Therefore, to test further the hypothesis that signals from somites specify MiPs and CaPs, we examined PMN subtype specification in mutants that lack proper somite segmentation.
MiPs and CaPs form in somite segmentation mutants
Several zebrafish mutations disturb somite segmentation and block formation
of at least some somite boundaries (Fritz
et al., 1996
; Henry et al.,
2002
; Liu et al.,
2003
; van Eeden et al., 1996b). In all of these mutants examined
so far, genes that are normally AP restricted within individual somites are
either missing or ubiquitously expressed within the somitic mesoderm
(Durbin et al., 2000
;
Henry et al., 2002
;
Holley et al., 2000
;
Jiang et al., 2000
;
van Eeden et al., 1996
). We
reasoned that if localized signals emanating from somites specify PMN
subtypes, these signals might be missing or mislocalized in these mutants.
Therefore, we examined MiP and CaP specification in several mutants that
affect somite segmentation.
fused somites (fss) and Dfb380
mutants lack all somite boundaries (Liu et
al., 2003
; van Eeden et al.,
1996
) (Table 1).
after eight (aei) mutants resemble fss mutants in
the posterior trunk, but the first eight or so somites form normally and
aei is thought to be involved in a different step in somite formation
than fss (Durbin et al.,
2000
; Holley et al.,
2000
; Jiang et al.,
2000
) (Table1).
Dfb567 mutants form somites with irregular widths and
boundary defects (Henry et al.,
2002
) (Table 1).
Despite their defects in somite boundary formation, fss,
Dfb380, aei and Dfb567 mutants
all form myotome boundaries at later stages, although these are irregular
(Henry et al., 2002
;
van Eeden et al., 1998
)
(K.E.L. and J.S.E., unpublished). We therefore also analysed fused
somites;you-too (fss;yot) mutants because they lack even this
later morphological segmentation of somitic mesoderm
(van Eeden et al., 1998
)
(Table 1).
During our study the fss locus was cloned (see
Table 1) and mapped to the same
linkage group as Dfb380
(Nikaido et al., 2002
). We
performed complementation analysis and found that Dfb380
and fss mutations do not complement, suggesting the
Dfb380 deletion uncovers at least part of the fss
gene or its regulatory sequences and that at least part of the somite
phenotype of Dfb380 is due to loss of fss
function. However, as we describe below, presomitic mesoderm expression of at
least one gene differs between Dfb380 and fss
mutants, suggesting that the somite defect in Dfb380
mutants is more severe than in fss mutants.
We analysed PMN subtype specification in these different mutants and found
that in Dfb567, Dfb380 and
fss;yot mutants islet2-expressing and
islet1-expressing PMNs still form in normal numbers. In addition,
both CaP and MiP axons are present, although they often have some aberrant
branches, and as in yot single mutants, fss;yot mutants have
fewer PMN axons than wild types (Fig.
2) (van Eeden et al.,
1996
). However, the precise spacing and alternation of MiPs and
CaPs is disturbed in all of these mutants, although the severity of this
phenotype varies among embryos and even sometimes between the two sides of the
same embryo. In most cases the alternation of MiPs and CaPs is less regular
than in wild types, the spacing between PMNs varies and PMNs on the two sides
of an embryo are out of register (Fig.
2).
|
One interpretation of these results is that segmentation of somitic
mesoderm is required for fine-tuning or maintaining the spacing and precise
alternation of MiPs and CaPs, but is unnecessary for specifying PMN subtypes.
However, it is also possible that all of these mutants have some remaining
cryptic or early segmentation that is sufficient to specify MiPs and CaPs.
Consistent with the latter possibility cs131, which encodes a cell
cycle arrest protein, is segmentally expressed in presomitic mesoderm of both
aei and fss mutants
(Durbin et al., 2000
), and
her1 is segmentally expressed in presomitic mesoderm of fss
mutants, although it is not segmentally expressed in aei mutants
(Durbin et al., 2000
;
Holley et al., 2000
;
van Eeden et al., 1998
). We
therefore examined expression of cs131 in Dfb567,
Dfb380 and fss;yot mutants, and expression of
her1 in Dfb380 and fss;yot mutants. In
all of these mutants at least one gene is segmentally expressed in presomitic
mesoderm. Dfb380 and fss;yot mutants have
segmental expression of her1 in presomitic mesoderm
(Fig. 3F,G), and
Dfb567 and fss;yot mutants have segmental
expression of cs131 in presomitic mesoderm
(Fig. 3B,D). However, compared
with wild types in which cs131 is also expressed in the posterior of
each somite, cs131 expression is weak and unlocalized in somitic
mesoderm of these mutants (Fig.
3B-D). By contrast, Dfb380 mutants lack the
presomitic mesoderm stripe of cs131, although they still have weak,
unlocalized expression of cs131 in somitic mesoderm
(Fig. 3C). This difference in
cs131 expression in presomitic mesoderm of Dfb380
and fss;yot mutants suggests that the somite phenotype of
Dfb380 mutants is more severe than that of
fss or fss;yot mutants. However, even in
Dfb380 mutants, there is still some early molecular
segmentation of paraxial mesoderm as evidenced by segmental expression of
her1.
|
Mutants that lack paraxial mesoderm form PMNs with hybrid identities
If signals from either presomitic or somitic mesoderm normally specify PMN
subtypes, PMNs should be misspecified in mutants lacking these signals.
spadetail (spt) mutants have a severe reduction of trunk
paraxial mesoderm (both somitic and presomitic) and no tail;spadetail
(ntl;spt) mutants completely lack paraxial mesoderm
(Amacher et al., 2002
;
Ho and Kane, 1990
)
(Table 1). Thus, any signals
from presomitic or somitic mesoderm should be reduced in spt mutants
and completely lacking in ntl;spt mutants.
In ntl;spt mutants, the vast majority of PMNs express both
islet1 and islet2 and thus have a hybrid identity with
respect to gene expression (Fig.
4A-D; Table 2). An
occasional cell expresses just islet1
(Table 2). These cells may be
SMNs that are just initiating islet1 RNA expression or interneurons
that were mistakenly counted as motoneurons because of the misshapen axis in
these embryos. By contrast, no PMNs express only islet2 (0% of PMNs,
n=251; Fig. 4D).
spt mutants have a similar but less severe phenotype
(Fig. 4E-H; Table 2). Most PMNs express
both islet1 and islet2 but there are more
islet1-only expressing cells than in ntl;spt mutants
(Table 2). In addition, very
occasionally in spt mutants (1.4% of PMNs, n=142) a PMN
expresses only islet2. We could not analyse the axon trajectories of
PMNs in ntl;spt mutants, because in the absence of somitic tissue PMN
axons do not exit the spinal cord (see also
Eisen and Pike, 1991
).
|
|
Somites are required for PMN subtype specification
All of the mutants we examined that have a severe somite phenotype provide
strong support for our hypothesis that signals from paraxial mesoderm pattern
PMN subtype identities. However, it is still formally possible that mutations
in these genes could affect PMNs and somites independently. We tested this
possibility by using transplantation methods to create genetically mosaic
embryos to ask whether normal PMN subtype identity requires ntl and
spt function in the CNS or in somites. First, we addressed whether
wild-type CNS restored normal subtype identities to ntl;spt mutant
PMNs. We transplanted large numbers of fluorescently labeled, wild-type donor
cells into ntl;spt MO-injected host embryos at blastula stage
(Fig. 6A) and analysed PMN gene
expression in eight embryos that lacked somites but in which most trunk spinal
cord was derived from wild-type donor cells. In every case, all of the PMNs
expressed islet2; thus they remained misspecified
(Fig. 6B-D). We further
analysed four of these embryos in cross-section and confirmed that all PMNs
that developed from wild-type donor cells (n>40) expressed
islet2 (Fig. 6C,D).
These results suggest that wild-type spinal cord cells are insufficient for
correct PMN subtype specification in the absence of paraxial mesoderm,
consistent with our hypothesis that MiP and CaP subtypes are specified by
signals extrinsic to the spinal cord.
Next we addressed whether wild-type somites could restore normal PMN
subtype specification in ntl;spt mutants. We transplanted
fluorescently labeled whole somites from wild-type donor embryos at the 7-10
somite stage into similarly staged ntl;spt mutant or ntl;spt
MO-injected hosts (Fig. 6E). We
carried out this experiment on three separate occasions and each time we
restored PMN subtype specification in the region of the somite transplant in
at least one embryo. We divided our results into two categories: restoration
over two segments (two groups of islet1-expressing cells separated by
islet2-expressing cells) and restoration over more than two segments
(restoration of more than two groups of islet1-expressing cells
separated by islet2-expressing cells;
Fig. 6F;
Table 3). Some transplanted
embryos had no restoration of PMN subtype specification. There are a number of
technical reasons why this may have been the case: we may have damaged the
somites during transplantation, inserted the somites too far from the neural
tube, or these host embryos may have been older and PMN fates less labile
(Eisen, 1991
;
Appel et al., 1995
). We also
processed 28 control embryos: two with transplants in the head, two in which
the transplanted somites fell off and 24 ntl;spt mutant or
MO-injected embryos without transplants processed in parallel to the
transplanted embryos.
|
| Discussion |
|---|
|
|
|---|
Signals from paraxial mesoderm specify MiPs and CaPs
Our evidence that signals from paraxial mesoderm are required for correct
specification of MiPs and CaPs is threefold. First, our analysis of
tri;kny mutants shows a correlation between very narrow somites and
misspecified PMNs. Second, our analysis of ntl;spt and spt
mutants shows a correlation between loss of paraxial mesoderm (presomitic
mesoderm and somites) and mis-specification of PMNs. Third, our
transplantation experiments demonstrate that mis-specification of PMN subtypes
in ntl;spt mutants is caused by lack of paraxial mesoderm.
Our analysis of PMNs in spt mutants is consistent with previously
published data. Inoue et al. (Inoue et
al., 1994
) reported an increase in islet1-expressing MNs
in spt mutants at 24 hpf and Bisgrove et al.
(Bisgrove et al., 1997
)
reported an increase in islet2-expressing PMNs at 18 hpf. Both of
these observations are consistent with our findings that most PMNs in
spt mutants express both islet1 and islet2 at 18-20
hpf. However, Tokumoto et al. (Tokumoto et
al., 1995
) reported a reduction in the number of
islet2-expressing MNs in spt mutants slightly later, at 24
hpf. This is surprising, given our results and those of Bisgrove et al.
(Bisgrove et al., 1997
).
However, it is possible that SMNs, some of which also express islet2
by 24 hpf, are reduced or delayed, or that some PMNs are dying, resulting in a
reduction in islet2-expressing MNs at this later stage.
Why are tri;kny and ntl;spt mutant phenotypes so similar?
tri;kny mutants form PMNs with a hybrid identity as assayed by
islet gene expression. The simplest interpretation of this result is
that there are two signals from the paraxial mesoderm, one that induces or
maintains islet1 expression in MiPs and one that induces
islet2 expression in CaPs. In wild-type embryos, these signals are
spatially distinct so that each PMN experiences only one of them. By contrast,
in tri;kny mutants these signals are so close together that they
overlap and all PMNs experience both signals and respond by expressing both
islet genes. The idea of inducing signals is supported by experiments
showing that individual MiPs transplanted to the CaP position turn on
expression of islet2. These experiments suggest that localized
signals normally induce islet2 expression in CaPs
(Appel et al., 1995
;
Eisen, 1991
), and also
demonstrate that PMNs that do not normally experience this
islet2-inducing signal still have the ability to respond to it.
In the light of these results, it was surprising to find that in ntl;spt mutants that lack all paraxial mesoderm-derived signals, PMNs also express both islet1 and islet2. The simplest interpretation of this result is that there are two signals from paraxial mesoderm: one that normally represses islet2 expression in MiPs and one that normally represses islet1 expression in CaPs. This simple model, with two repressive signals, is inconsistent with the simple model suggested by the tri;kny double mutant and PMN transplantation results, which postulated two inducing signals. This suggests to us that the signalling that specifies CaP and MiP subtypes may involve both repressive and inductive signals, and hence be more complicated than either of these simple models. Thus, although our results demonstrate that signals from paraxial mesoderm are required for PMN subtype specification, it is still unclear exactly how these signals act. Further studies will be needed to identify these signals and the mechanisms by which they specify distinct PMN subtypes.
CaP axon trajectory may be dominant in PMNs that express both islet1 and islet2
In tri;kny mutants most PMNs express both islet1 and
islet2 but have a CaP axon trajectory, suggesting that CaP identity
is dominant over MiP identity. tri;kny mutants do have rare PMNs with
a MiP-like axon trajectory that probably correspond to the occasional PMNs
that express only islet1. However, an intriguing possibility that
remains to be tested is that, as suggested from studies in mouse,
over-occupation of a particular axon pathway may cause an occasional axon to
be `shunted' to an alternative target
(Sharma et al., 2000
).
We offer three possible interpretations of why PMNs in tri;kny
mutants have CaP-like axons despite their hybrid subtype identity as indicated
by gene expression. First, somite-derived signals necessary for MiP axon
pathfinding may be lacking in tri;kny mutants. This seems unlikely as
the occasional MiP-like axon still forms, and all of the genes examined so far
are expressed normally in the somites of these mutants
(Henry et al., 2000
) (K.E.L.
and J.S.E., unpublished). Second, CaP-specifying signals may be dominant over
MiP-specifying signals and even though PMNs in tri;kny mutants
express both islet1 and islet2, they may otherwise
molecularly resemble CaPs more than MiPs. This possibility can be assessed
when additional molecular markers for PMN subtypes are identified. A third
related possibility is that expression of islet2 may specify a
CaP-like axon trajectory in PMNs, irrespective of other islet genes
the cell expresses. We favor this possibility, because it is consistent with
studies showing that reducing Islet2 function changes CaPs into VeLD spinal
interneurons (Segawa et al.,
2001
).
Somite segmentation is required for correct spatial organization of MiPs and CaPs
To our initial surprise, both MiPs and CaPs were specified in normal
numbers in mutants with disturbed somite boundaries and AP somite patterning.
This suggests that neither of these aspects of paraxial mesoderm segmentation
are required to specify different PMN subtypes, although we cannot rule out
the possibility that there are as yet unidentified genes expressed segmentally
in the somites of these mutants. Interestingly, although MiPs and CaPs formed
in all of these mutants, in most cases their spatial organization was
disturbed. The precise alternation and spacing of different PMN subtypes was
lost and PMNs on the two sides of an embryo were out of register. This shows
that PMN subtype specification and PMN spatial organization are separable
aspects of PMN patterning and it suggests that these somite segmentation
mutants are missing signals that normally fine-tune or maintain the precise
spatial organization of different PMN subtypes. One mechanism by which these
signals may act is by controlling the cell adhesion properties of particular
PMNs and/or neighboring cells. In this model the normal, precise, alternating
pattern of MiPs and CaPs would be fine-tuned or maintained by cell adhesion
and this mechanism would be disturbed or lacking in the somite segmentation
mutants. This would explain why transplanted PMNs sometimes migrate back to
their original spinal cord positions relative to overlying somites
(Eisen, 1991
). In addition, if
these cell adhesion properties develop after CaPs are first specified, it
would explain why the initial spatial organization of CaPs is not as regular
as at later stages (Appel et al.,
1995
).
What are the signals for PMN subtype specification and when do they act?
When we started our analyses, one large class of genes that were obvious
candidates for specifying PMN subtype identities were genes that are normally
expressed in an AP-restricted pattern in somites. However, all of these genes
that have been examined so far are either not expressed, or are mislocalized
in somite segmentation mutants (Durbin et
al., 2000
; Henry et al.,
2002
; Holley et al.,
2000
; Jiang et al.,
2000
; van Eeden et al.,
1996
). Yet both MiPs and CaPs form in normal numbers in these
mutants. This strongly suggests that none of these genes are required for
specifying PMN subtypes.
The signals that normally specify MiPs and CaPs might emanate from
presomitic mesoderm. Consistent with this possibility, although the somite
segmentation mutants we examined affect different aspects of paraxial mesoderm
segmentation, in every case at least one gene is still segmentally expressed
in presomitic mesoderm. If the signals that specify PMN subtypes come from
presomitic mesoderm, MiPs and CaPs would be specified before we can currently
identify them molecularly. However, if PMN subtypes are specified this early,
additional, somite-derived signals would be required to explain how PMNs
transplanted at mid-somitogenesis stages can adopt a new, position-specific
PMN subtype identity (Appel et al.,
1995
; Eisen, 1991
)
and transplanted somites can restore specification of PMN subtype identities
in ntl;spt mutants. These later signals might normally only fine-tune
the spatial organization of MiPs and CaPs, in which case they are presumably
missing in the somite segmentation mutants.
An alternative possibility is that signals that specify MiPs and CaPs
emanate from the somites. In this case, there must be some cryptic aspect of
segmentation that persists in the somitic mesoderm in somite segmentation
mutants that is sufficient to specify MiPs and CaPs. Consistent with this
possibility, vertebrae form with almost normal periodicity in these mutants,
and most of the mutants form irregular myotome boundaries at later
developmental stages (van Eeden et al.,
1996
; van Eeden et al.,
1998
). Distinguishing between these two alternatives will require
the identification of additional genes involved in segmentation and in PMN
subtype specification.
FGFs are another class of signals that might be candidates for specifying
PMN subtype identities. FGF signalling is crucial for somite segmentation
(Dubrulle and Pourquie, 2002
)
and correct timing of neural differentiation
(Diez del Corral et al., 2002
),
and has also been implicated in AP patterning of MNs in chick
(Liu et al., 2001
). In
zebrafish, fgf8 is expressed in the posterior presomitic mesoderm and
in the anterior region of newly formed somites
(Reifers et al., 1998
).
fgf17 is also expressed at the anterior margin of somites after about
the eight-somite stage (Reifers et al.,
2000
). However, our preliminary data show that, although somite
boundaries are variably disturbed in embryos with reduced FGF8 signalling,
MiPs and CaPs are specified normally in ace (fgf8) mutants,
embryos injected with fgf8 MOs and ace mutants injected with
an fgf17 MO. However, in some of these embryos, PMN spacing is
irregular and PMNs on the two sides of an embryo are out of register in a
manner reminiscent of somite segmentation mutants (K.E.L. and J.S.E.,
unpublished). Our treatments have probably not entirely abolished FGF
signalling. Thus, we have not ruled out the possibility that FGFs participate
in PMN subtype specification, although this may be difficult to assess because
embryos become highly necrotic when fgf8 levels are severely reduced
(Draper et al., 2001
) (K.E.L.
and J.S.E., unpublished).
In conclusion, our data provide strong evidence that signals from paraxial mesoderm are required to specify and spatially organise distinct PMN subtypes in a segmentally reiterated pattern along the AP axis. It will be exciting in the future to learn the nature of the signals involved in these processes and when and how they act during PMN subtype specification.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Amacher, S. L., Draper, B. W., Summers, B. R. and Kimmel, C.
B. (2002). The zebrafish T-box genes no tail and
spadetail are required for development of trunk and tail mesoderm and
medial floor plate. Development
129,3311
-3323.
Appel, B. and Eisen, J. (1998). Regulation of
neuronal specification in the zebrafish spinal cord by Delta
function. Development
125,371
-380.[Abstract]
Appel, B., Korzh, V., Glasgow, E., Thor, S., Edlund, T., Dawid,
I. B. and Eisen, J. S. (1995). Motoneuron fate specification
revealed by patterned LIM homeobox gene expression in embryonic zebrafish.
Development 121,4117
-4125.[Abstract]
Appel, B., Givan, L. A. and Eisen, J. S.
(2001). Delta-Notch signaling and lateral inhibition in zebrafish
spinal cord development. BMC Dev. Biol.
1, 13.[CrossRef][Medline]
Beattie, C. and Eisen, J. (1997). Notochord
alters the permissiveness of myotome for pathfinding by an identified
motoneuron in embryonic zebrafish. Development
124,713
-720.[Abstract]
Bisgrove, B., Raible, D., Walter, V., Eisen, J. and Grunwald,
D. (1997). Expression of c-ret in the zebrafish embryo:
potential roles in motoneuronal development. J.
Neurobiol. 33,749
-768.[CrossRef][Medline]
Concordet, J. P., Lewis, K. E., Moore, J. W., Goodrich, L. V.,
Johnson, R. L., Scott, M. P. and Ingham, P. W. (1996).
Spatial regulation of a zebrafish patched homologue reflects the roles of
sonic hedgehog and protein kinase A in neural tube and somite patterning.
Development 122,2835
-2846.[Abstract]
Diez del Corral, R., Breitkreuz, D. N. and Storey, K. G.
(2002). Onset of neuronal differentiation is regulated by
paraxial mesoderm and requires attenuation of FGF signalling.
Development 129,1681
-1691.
Draper, B. W., Morcos, P. A. and Kimmel, C. B.
(2001). Inhibition of zebrafish fgf8 pre-mRNA splicing with
morpholino oligos: A quantifiable method for gene knockdown.
Genesis 30,154
-156.[CrossRef][Medline]
Dubrulle, J. and Pourquie, O. (2002). From head
to tail: links between the segmentation clock and antero-posterior patterning
of the embryo. Curr. Opin. Genet. Dev.
12,519
-523.[CrossRef][Medline]
Durbin, L., Sordino, P., Barrios, A., Gering, M., Thisse, C.,
Thisse, B., Brennan, C., Green, A., Wilson, S. and Holder, N.
(2000). Anterior-posterior patterning of somites is required
within segments for somite boundary formation in developing zebrafish.
Development 127,1703
-1713.[Abstract]
Eisen, J. S. (1991). Determination of primary
motoneuron identity in developing zebrafish embryos.
Science 252,569
-572.
Eisen, J. S. (1994). Development of
motoneuronal phenotype. Ann. Rev. Neurosci.
17, 1-30.[Medline]
Eisen, J. S. (1999). Patterning motoneurons in
the vertebrate nervous system. Trends Neurosci.
22,321
-326.[CrossRef][Medline]
Eisen, J. S. and Pike, S. H. (1991). The
spt-1 mutation alters the segmental arrangement and axonal
development of identified neurons in the spinal cord of the embryonic
zebrafish. Neuron 6,767
-776.[CrossRef][Medline]
Eisen, J. S., Pike, S. H. and Debu, B. (1989).
The growth cones of identified motoneurons in embryonic zebrafish select
appropriate pathways in the absence of specific cellular interactions.
Neuron 2,1097
-1104.[CrossRef][Medline]
Ensini, M., Tsuchida, T. N., Belting, H.-G. and Jessell, T.
M. (1998). The control of rostrocaudal pattern in the
developing spinal cord: specification of motor neuron subtype identity is
initiated by signals from paraxial mesoderm.
Development 125,969
-982.[Abstract]
Fritz, A., Rozowski, M., Walker, C. and Westerfield, M.
(1996). Identification of selected gamma-ray induced deficiencies
in zebrafish using multiplex polymerase chain reaction.
Genetics 144,1735
-1745.[Abstract]
Gray, M., Moens, C. B., Amacher, S. L., Eisen, J. S. and
Beattie, C. E. (2001). Zebrafish deadly seven functions in
neurogenesis. Dev. Biol.
237,306
-323.[CrossRef][Medline]
Griffin, K. J. P., Amacher, S. L., Kimmel, C. B. and Kimelman,
D. (1998). Molecular identification of spadetail:
regulation of zebrafish trunk and tail mesoderm formation by T-box
genes. Development 125,3379
-3388.[Abstract]
Halpern, M. E., Ho, R. K., Walker, C. and Kimmel, C. B.
(1993). Induction of muscle pioneers and floor plate is
distinguished by the zebrafish no tail mutation.
Cell 75,99
-111.[CrossRef][Medline]
Halpern, M., Hatta, K., Amacher, S., Talbot, W., Yan, Y.,
Thisse, B., Thisse, C., Postlethwait, J. and Kimmel, C.
(1997). Genetic interactions in zebrafish midline development.
Dev. Biol. 187,154
-170.[CrossRef][Medline]
Hammerschmidt, M., Pelegri, F., Mullins, M. C., Kane, D. A.,
Brand, M., van Eeden, F. J. M., Furutani-Seiki, M., Granato, M., Haffter, P.,
Heisenberg, C. P. et al. (1996). Mutations affecting
morphogenesis during gastrulation and tail formation in the zebrafish,
Danio rerio. Development
123,143
-151.[Abstract]
Hatta, K., Kimmel, C. B., Ho, R. K. and Walker, C.
(1991). The cyclops mutation blocks specification of the
floor plate of the zebrafish CNS. Nature
350,339
-341.[CrossRef][Medline]
Henry, C. A., Hall, L. A., Hille, M. B., Solinca-Krezel, L. and
Cooper, M. S. (2000). Somites in zebrafish doubly mutant for
knypek and trilobite form without internal mesenchymal cells
or compaction. Curr. Biol.
10,1063
-1066.[CrossRef][Medline]
Henry, C. A., Urban, M. K., Dill, K. K., Merlie, J. P., Page, M.
F., Kimmel, C. B. and Amacher, S. L. (2002). Two linked
hairy/Enhancer of split-related zebrafish genes, her1 and her7, function
together to refine alternating somite boundaries.
Development 129,3693
-3704.
Ho, R. K. and Kane, D. A. (1990).
Cell-autonomous action of zebrafish spt-1 mutation in specific mesodermal
precursors. Nature 348,728
-730.[CrossRef][Medline]
Holley, S. A., Geisler, R. and Nusslein-Volhard, C.
(2000). Control of her1 expression during zebrafish somitogenesis
by a delta-dependent oscillator and an independent wave-front activity.
Genes Dev. 14,1678
-1690.
Inoue, A., Takahashi, M., Hatta, K., Hotta, Y. and Okamoto,
H. (1994). Developmental regulation of islet-1 mRNA
expression during neuronal differentiation in embryonic zebrafish.
Dev. Dyn. 199,1
-11.[Medline]
Jessen, J. R., Topczewski, J., Bingham, S., Sepich, D. S.,
Marlow, F., Chandrasekhar, A. and Solnica-Krezel, L. (2002).
Zebrafish trilobite identifies new roles for Strabismus in gastrulation and
neuronal movements. Nat. Cell Biol.
4, 610-615.[Medline]
Jiang, Y. J., Aerne, B. L., Smithers, L., Haddon, C.,
Ish-Horowicz, D. and Lewis, J. (2000). Notch signalling and
the synchronization of the somite segmentation clock.
Nature 408,475
-479.[CrossRef][Medline]
Karlstrom, R. O., Tyurina, O. V., Kawakami, A., Nishioka, N.,
Talbot, W. S., Sasaki, H. and Schier, A. F. (2003). Genetic
analysis of zebrafish gli1 and gli2 reveals divergent requirements for gli
genes in vertebrate development. Development
130,1549
-1564.
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and
Schilling, T. F. (1995). Stages of embryonic development of
the zebrafish. Dev. Dyn.
203,253
-310.[Medline]
Kimmel, C. B., Sepich, D. S. and Trevarrow, B.
(1988). Development of segmentation in zebrafish.
Development Suppl. 104,197
-207.
Lewis, K. E., Currie, P. D., Roy, S., Schauerte, H., Haffter, P.
and Ingham, P. W. (1999). Control of muscle cell-type
specification in the zebrafish embryo by hedgehog signalling. Dev.
Biol. 216,469
-480.[CrossRef][Medline]
Lewis, K. E. and Eisen, J. S. (2001). Hedgehog
signaling is required for primary motoneuron induction in zebrafish.
Development 128,3485
-3495.
Lewis, K. E. and Eisen, J. S. (2003). From
cells to circuits: development of the zebrafish spinal cord. Prog.
Neurobiol. 69,419
-449.[CrossRef][Medline]
Liu, D., Chu, H., Maves, L., Yan, Y. L., Morcos, P. A.,
Postlethwait, J. H. and Westerfield, M. (2003). Fgf3 and Fgf8
dependent and independent transcription factors are required for otic placode
specification. Development
130,2213
-2224.
Liu, J. P., Laufer, E. and Jessell, T. M.
(2001). Assigning the positional identity of spinal motor
neurons: rostrocaudal patterning of Hox-c expression by FGFs, Gdf11, and
retinoids. Neuron 32,997
-1012.[CrossRef][Medline]
Müller, M., Weizsäcker, E. and Campos-Ortega, J.
A. (1996). Expression domains of a zebrafish homologue of the
Drosophila pair-rule gene hairy correspond to a primordia of
alternating somites. Development
122,2071
-2078.[Abstract]
Nasevicius, A. and Ekker, S. C. (2000).
Effective targeted gene `knockdown' in zebrafish. Nat.
Genet. 26,216
-220.[CrossRef][Medline]
Nikaido, M., Kawakami, A., Sawada, A., Furutani-Seiki, M.,
Takeda, H. and Araki, K. (2002). Tbx24, encoding a T-box
protein, is mutated in the zebrafish somite-segmentation mutant fused somites.
Nat. Genet. 31,195
-199.[CrossRef][Medline]
Odenthal, J., van Eeden, F. J., Haffter, P., Ingham, P. W. and
Nüsslein-Volhard, C., M. R., Toyama, R., Haffter, P. and Dawid, I. B.
(1998). Cyclops encodes a nodal-related factor in
midline signaling. Proc. Natl. Acad. Sci. USA
95,9932
-9937.
Reifers, F., Adams, J., Mason, I., Schulte-Merker, S. and Brand,
M. (2000). Overlapping and distinct functions provided by
fgf17, a new zebrafish member of the Fgf8/17/18 subgroup of Fgfs.
Mech. Dev. 99,39
-49.[CrossRef][Medline]
Reifers, F., Böhli, H., Walsh, E. C., Crossley, P. H.,
Stainier, D. Y. and Brand, M. (1998). Fgf8 is mutated in
zebrafish acerebellar (ace) mutants and is required for maintenance of
midbrain-hindbrain boundary development and somitogenesis.
Development 125,2381
-2395.[Abstract]
Roy, M. N., Prince, V. E. and Ho, R. K. (1999).
Heat shock produces periodic somitic disturbances in the zebrafish embryo.
Mech. Dev. 85,27
-34.[CrossRef][Medline]
Sampath, K., Rubinstein, A. L., Cheng, A. M. S., Liange, J. O.,
Fekany, K., Solnica-Krezel, L., Korzh, V., Halpern, M. E. and Wright, C. V.
E. (1998). Induction of the zebrafish ventral brain and floor
plate requires Cyclops/Nodal signaling.
Nature 395,185
-189.[CrossRef][Medline]
Schulte-Merker, S., van Eeden, F., Halpern, M., Kimmel, C. and
Nüsslein-Vohlard, C. (1994). no tail
(ntl) is the zebrafish homologue of the mouse T (Brachyury)
gene. Development 120,1009
-1015.[Abstract]
Segawa, H., Miyashita, T., Hirate, Y., Higashijima, S., Chino,
N., Uyemura, K., Kikuchi, Y. and Okamoto, H. (2001).
Functional repression of Islet-2 by disruption of complex with Ldb impairs
peripheral axonal outgrowth in embryonic zebrafish.
Neuron 30,423
-436.[CrossRef][Medline]
Sepich, D. S., Myers, D. C., Short, R., Topczewski, J., Marlow,
F. and Solnica-Krezel, L. (2000). Role of the zebrafish
trilobite locus in gastrulation movements of convergence and extension.
Genesis 27,159
-173.[CrossRef][Medline]
Sharma, K., Leonard, A. E., Lettieri, K. and Pfaff, S. L.
(2000). Genetic and epigenetic mechanisms contribute to motor
neuron pathfinding. Nature
406,515
-519.[CrossRef][Medline]
Talbot, W. S., Trevarrow, B., Halpern, M., Melby, A. E., Farr,
G., Postlethwait, J. H., Jowett, T., Kimmel, C. B. and Kimmelman, D.
(1995). A homeobox gene essential for zebrafish notochord
development. Nature 378,150
-157.[CrossRef][Medline]
Tokumoto, M., Gong, Z., Tsubokawa, T., Hew, C. L., Uyemura, K.,
Hotta, Y. and Okamoto, H. (1995). Molecular heterogeneity
among primary motoneurons and within myotomes revealed by the differential
mRNA expression of novel islet-1 homologs in embryonic zebrafish.
Dev. Biol. 171,578
-589.[CrossRef][Medline]
Topczewski, J., Sepich, D. S., Myers, D. C., Walker, C., Amores,
A., Lele, Z., Hammerschmidt, M., Postlethwait, J. H. and Solnica-Krezel,
L. (2001). The zebrafish glypican Knypek controls cell
polarity during gastrulation movements of convergent extension.
Dev. Cell 1,251
-264.[CrossRef][Medline]
Trevarrow, B., Marks, D. L. and Kimmel, C. B.
(1990). Organization of hindbrain segments in the zebrafish
embryo. Neuron 4,669
-679.[CrossRef][Medline]
van Eeden, F. J. M., Granato, M., Schach, U., Brand, M.,
Furutani-Seiki, M., Haffter, P., Hammerschmidt, M., Heisenberg, C. P., Jiang,
Y. J., Kane, D. A. et al. (1996). Mutations affecting somite
formation and patterning in the zebrafish, Danio rerio.
Development 123,153
-164.[Abstract]
van Eeden, F. J. M., Holley, S. A., Haffter, P. and
Nusslein-Volhard, C. (1998). Zerafish segmentation and
pair-rule patterning. Dev. Genet.
23, 65-76.[CrossRef][Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
M. Sato-Maeda, M. Obinata, and W. Shoji Position fine-tuning of caudal primary motoneurons in the zebrafish spinal cord Development, January 15, 2008; 135(2): 323 - 332. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Skromne, D. Thorsen, M. Hale, V. E. Prince, and R. K. Ho Repression of the hindbrain developmental program by Cdx factors is required for the specification of the vertebrate spinal cord Development, June 1, 2007; 134(11): 2147 - 2158. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Hutchinson, S. E. Cheesman, L. A. Hale, J. Q. Boone, and J. S. Eisen Nkx6 proteins specify one zebrafish primary motoneuron subtype by regulating late islet1 expression Development, May 1, 2007; 134(9): 1671 - 1677. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Hutchinson and J. S. Eisen Islet1 and Islet2 have equivalent abilities to promote motoneuron formation and to specify motoneuron subtype identity Development, June 1, 2006; 133(11): 2137 - 2147. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E Lewis How do genes regulate simple behaviours? Understanding how different neurons in the vertebrate spinal cord are genetically specified Phil Trans R Soc B, January 29, 2006; 361(1465): 45 - 66. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Honjo and J. S. Eisen Slow muscle regulates the pattern of trunk neural crest migration in zebrafish Development, October 15, 2005; 132(20): 4461 - 4470. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||