|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online February 2, 2004
doi: 10.1242/10.1242/dev.00982


1 Cell and Animal Biology, The Institute of Life Sciences, The Hebrew University
of Jerusalem, Jerusalem 91904, Israel
2 Roland Center for Neurodegenerative Diseases, The Institute of Life Sciences,
The Hebrew University of Jerusalem, Jerusalem 91904, Israel
Author for correspondence (e-mail:
nbenarie{at}vms.huji.ac.il)
Accepted 12 November 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Rhombic lip, Cerebellum, Cerebellar granule cells, Neurite, Notch, Delta, Jagged, Hes, Knockout, Mouse
| Introduction |
|---|
|
|
|---|
Math1 (Atoh1 - Mouse Genome Informatics) encodes a murine
basic helix-loop-helix (bHLH) transcription activator
(Akazawa et al., 1995
;
Ben-Arie et al., 1996
),
orthologous to the Drosophila atonal. In the developing cerebellum,
Math1 is expressed in mitotic CGC at the rhombic lip and in the outer
EGL (Akazawa et al., 1995
;
Ben-Arie et al., 1997
;
Ben-Arie et al., 2000
;
Ben-Arie et al., 1996
;
Helms et al., 2000
). Genomic
disruption has proven that Math1 is essential for proper development
of CGC, as Math1 null mice lack the EGL
(Ben-Arie et al., 1997
;
Ben-Arie et al., 2000
).
However, overexpression of Math1 resulted in cerebellar abnormalities
without extra neurogenesis (Helms et al.,
2001
; Isaka et al.,
1999
), arguing against a proneural role for Math1 in the
developing nervous system of the mouse.
The Notch signaling pathway is a crucial mechanism for controlling cell
specification and differentiation in both invertebrates and vertebrates
(Artavanis-Tsakonas et al.,
1999
; Beatus and Lendahl,
1998
; de la Pompa et al.,
1997
; Frisen and Lendahl,
2001
; Gaiano and Fishell,
2002
; Justice and Jan,
2002
). Notch signaling components, such as the receptors Notch1
and Notch2, the ligands Delta1 (Dll1 - Mouse Genome Informatics), Dll3, Jag1
and Jag2, the DNA-binding protein interactor Cbf1 (Rbpsuh -
Mouse Genome Informatics), and the effectors Hes1 and Hes5
were found to be expressed in the EGL of neonatal mice
(Irvin et al., 2001
;
Kusumi et al., 2001
;
Solecki et al., 2001
;
Tanaka et al., 1999
).
Moreover, activation of Notch and overexpression of its effector
Hes1, maintained the proliferation of CGC EGL precursors
(Solecki et al., 2001
). Loss
of Notch1 was shown to result in a premature onset of neurogenesis,
which resulted in a reduced number of neurons in the adult cerebellum
(Lutolf et al., 2002
).
Similarly, the importance of Hes1 and Hes3 in cerebellar
development was identified in knockout mice
(Hirata et al., 2001
).
Links between Notch signaling pathway and Math1 were identified in
various tissues. Math1 was shown to be essential for the generation
of inner ear hair cells (Bermingham et
al., 1999
; Chen et al.,
2002
; Kawamoto et al.,
2003
; Shou et al.,
2003
; Zheng and Gao,
2000
). Moreover, activation of Notch via Jag2 was shown
to inhibit expression of Math1 in cochlear progenitor cells, possibly
through the activity of Hes5
(Lanford et al., 2000
).
Indeed, upregulation of Math1 in Hes1 and Hes5
mutant cochleae suggested that Hes genes regulate hair cell differentiation by
antagonizing Math1 expression
(Zine and de Ribaupierre,
2002
). Notch pathway components were similarly found to be
variably expressed in the mouse small intestine
(Schroder and Gossler, 2002
).
Notably, in the small intestine of Math1-null mice, which lack
secretory cells, the expression of Dll3 was halved, while Dll1,
Hes1, Notch1, Notch2, Notch3 and Notch4 expression was
unaffected (Yang et al.,
2001
).
In this study we aimed to deepen our insight into CGC neurogenesis, by taking advantage of Math1-null mice, in which this process is arrested. The development of CGC precursors in Math1-null mice was followed by examination of Math1 promoter activity. Rhombic lip cells were then cultured and analyzed for their survival, specification and differentiation in vitro. Our data show that lack of Math1 did not affect the viability of CGC or their specification. Rather, CGC progenitors were abnormal in their differentiation, as evident molecularly (by the continuous activation of Math1 promoter) and morphologically (by their inability to extend processes in culture). Among all Notch receptors and ligands expressed in the rhombic lip, Notch4 and Dll1 showed the most pronounced downregulation in Math1-null mice. Moreover, by testing two Notch effectors we have discovered that the expression of Hes5, but not Hes1, is Math1 dependent, and that MATH1 can bind directly Hes5, thus demonstrating a novel negative autoregulatory loop of Math1 expression. The feedback mechanism requires an accumulation of MATH1, and therefore provides an explanation for the delayed downregulation of Math1 in cultured cells. Taken together, our data reveal that Math1 controls cerebellar granule cell differentiation as well as its own expression, at least in part, through the Notch signaling pathway.
| Materials and methods |
|---|
|
|
|---|
X-Gal staining
Whole embryos or tissue staining was previously described
(Ben-Arie et al., 2000
). To
stain cultured cells the wells were washed twice in PBS, fixed by 0.05%
gluteraldehyde in PBS for 5 minutes at room temperature, and washed three
times in PBS. Staining was performed at 37°C for about 10 hours, in
solution of 1 mg/ml X-Gal, 5 mM potassium ferricyanide, 5 mM potassium
ferrocyanide and 1 mM MgCl2 in PBS. After postfixation in 4%
paraformaldehyde in PBS, cells were counterstained by Nuclear Fast Red
(Aldrich) and clarified in 75% Glycerol in PBS.
Rhombic lip primary cultures
Culturing of cerebellar granule cells is based on a previously described
procedure (Alder et al., 1996
;
Hatten et al., 1998
). Briefly,
embryos were collected in ice-cold CMF-PBS
(Hatten et al., 1998
), and the
cerebellum isolated under a dissecting microscope by two incisions across the
mesencephalon/metencephalon border and across the fourth ventricle. The
rhombic lip tissue was pealed off with fine forceps, placed in CMF-PBS and
stored on ice. Dissociation was performed by incubation of the tissue in 0.08%
Trypsin (Biological Industries, Beit-Haemek, Israel), 0.02% EGTA, 0.05 mg/ml
DNaseI (Sigma) in CMF-PBS, for 15 minutes at 37°C; which was then
changed to 0.05 mg/ml DNaseI, 0.45% Glucose in ice cold Eagle's basal
medium (BME). The tissue was triturated by passing through a pipettor tip,
centrifuged at 700 g at 4°C for 5 minutes, and pellets
resuspended in 50 µl granule cell medium
(Hatten et al., 1998
)
supplemented by 5% fetal calf serum and 10% horse serum (Biological
Industries, Beit-Haemek, Israel). Cells were diluted to 1200-1300 cell/µl
before plating into Terasaki Micro Plate (#1006-01-3, Robbins, Sunnyvale, CA).
Normally, four or five wells were plated from each embryo
(22x103 cells/well). Cultures were grown in 95% air/5%
CO2 humidified incubator, at 37°C. Half the medium was changed
on the next day after plating and every other day thereafter.
Quantification of ß-galactosidase activity
Liquid assay for the lacZ reporter activity was performed using
the All-in-One Mammalian ß-Galactosidase Assay Kit (Pierce, Rockford,
IL). Cultured rhombic lip cells grown in Terasaki plates were washed with PBS,
lysed by the addition of 29 µl M-PER (Pierce, Rockford, IL) per well and
incubated for 5 minutes. An aliquot of 20 µl was transferred into a 96-well
plate, and 180 µl All-in-One reagent added. Reaction was carried out at
37°C for 6 hours and color development was measured every hour at 405 nm.
A second aliquot of 8 µl was used for protein quantification; using
Protein-Assay Reagent (BioRad, Hercules, CA).
Immunohistochemical analysis of primary cultures
Cultured cells were fixed by 4% paraformaldehyde in PBS for 15 minutes at
room temperature, washed three times with PBS, and blocked by 5% normal goat
serum, 2% BSA, 0.1% Triton X-100 in PBS for 1 hour at room temperature.
Primary antibodies were diluted in blocking buffer and incubated overnight at
4°C, then for 1 hour at room temperature. The antibodies used were: mouse
anti-ß-tubulin (1:10, DSHB, E7), rabbit anti-NF160 (1:100, Sigma, N4142),
mouse anti-phosphorylated neurofilaments (1:5, DSHB, RT97) and mouse anti-NCAM
(1:5, DSHB, 5B8). Cells were washed four times with 0.1% Triton X-100 in PBS;
before the addition of secondary antibodies conjugated to FITC or Biotin
(Sigma), and incubated for 2 hours at room temperature, after which they were
washed three times with PBS. For Biotin-conjugated antibodies
StreptAvidin-TexasRed (Vector Laboratories, Burlingame, CA) was used for
visualization. Counterstaining by DAPI was performed before mounting with 1%
n-propyl-galate (Sigma) in 90% glycerol. Pictures were taken under an
Axioskop2 microscope (Zeiss, Germany), using a DP10 digital camera (Olympus,
Germany). Images were assembled using NIH ImageJ software
(http://rsb.info.nih.gov/nih-image/index.html).
For quantification of processes the cultures were grown for 6 days, fixed, blocked and stained with mouse anti-ß-tubulin as above. Then, cells were washed, incubated for 2 hours at room temperature with a secondary antibody conjugated to peroxidase (Jackson ImmunoResearch, West Grove, PA) and washed. The cells were then lysed by CytoBuster (Novagene, Milwaukee, WI) and the content of each two wells combined. A colorimetric reactions was initiated by the addition of 1mg/ml ABTS (2,2'-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid, diammonium salt)), 0.003% H2O2 (Sigma), 28 mM citric acid and 44 mM Na2HPO4. The O.D (405 nm) was measured every 15 minutes to ensure that the values are within the linear range.
RT-PCR analysis
RNA was extracted as described
(Chirgwin et al., 1979
).
Cultured cells were lysed with 25 µl/well of lysis buffer (4 M guanidine
thiocyanate, 25 mM sodium citrate, 17 mM N-laurylsarcosine) for 5 minutes at
room temperature and kept at -70°C. After genotyping lysates were thawed
and mixed with 1 µl ß-mercaptoethanol, 12.5 µl 2M sodium acetate pH
4.0, 125 µl acidic phenol, 25 µl chloroform-isoamyl alcohol (49:1). The
aqueous phase was extracted twice using chloroform-isoamyl alcohol,
precipitated by isopropanol with glycogen as a carrier, washed by 70% ethanol,
dried, dissolved in 25 µl water, and DNaseI treated using the
DNA-free kit (Ambion, Austin, Texas). Reverse transcription was carried out by
RevertAid H Minus First Strand cDNA Synthesis Kit (Fermentas MBI, Vilnius,
Lithuania).
PCR amplifications were performed using FastStart Taq DNA polymerase (Roche, Germany), 0.2 mM dNTPs, 1.5 mM MgCl2 and 1 µM each primer. The thermocycling parameters for Zic1, Zipro1 and ß-actin (set A) were: 94°C/4 minutes, 40 cycles of 94°C for 30 seconds, 55°C for 30 seconds, 72°C for 30 seconds, and 72°C for 3 minutes; and for Hes1, Hes5 and ß-actin (set B): 94°C for 4 minutes; 34 cycles of 94°C for 30 seconds, 68°C for 120 seconds and 68°C for 5 minutes.
Real-time amplifications were performed on Rotor-Gene machine (Corbett Research, Australia) using 2 mM MgCl2 and x0.3 SYBR I Green. Thermocycling conditions were 94°C for 4 minutes, then 45 cycles of 96°C for 25 seconds, 60°C for 20 seconds, 72°C for 30 seconds; 72°C for 1 minute. Amplification of a single product was verified by melting curves, and the correct product size by gel separation. For quantification, calibration curves were run simultaneously with experimental samples and Ct calculations were performed by the Rotor-Gene software.
The primers used were as follows: Zic1, (F) GGCCAACCCCAAAAAGTC, (R) CGTTAAAATTCGAAGAGAGCG; Zipro1, (F) CCAGACTCCAAAGCGGTTCTGAG, (R) AGTGTCATGGTACCCAAATTG; ß-actin (A), (F) TGTTACCAACTGGGACGACA, (R) TGTTACCAACTGGGACGACA; ß-actin (B), (F) GTGGGCCGCTCTAGGCACCAA, (R) CTCTTTGATGTCACGCACGATTTC; Hes1, (F) AGCTGGAGAGGCTGCCAAGGTTT, (R) ACATGGAGTCCGAAGTGAGCGAG; Hes5, (F) TTAAGCAAGTGACTTCTGCGAAGTTC, (R) GGCCATGTGGACCTTGAGGTGAG; Notch1, (F) AGAGATGTGGGATGCAGGAC, (R) CACACAGGGAACTTCACCCT; Notch2, (F) TGTACCAGATCCCAGAGATGC, (R) GTCAGATGCAGAGTGTGGTGA; Notch3, (F) AATCCTGTAGCTGTTCCCCTC, (R) CTGGGCTAGGTGTTGAGTCAG; Notch4, (F) ATCACAGGATGACTGGCCTC, (R) ACTCGTACGTGTCGCTTCCT; Dll1, (F) CTGAGGTGTAAGATGGAAGCG, (R) CAACTGTCCATAGTGCAATGG; Dll3, (F) CACCAGTAGCTGCCTGAACTC, (R) GTTAGAGCCTTGGAAACCAAG; Dll4, (F) CCTCTAGGCAAGAGTTGGTCC, (R) TAGAAAGGCCAGTGCTTCTGA; Jag1, (F) TGACATGGATAAACACCAGCA, (R) GCAGCCCACTGTCTGCTATAC; Jag2, (F) ATTGTAGCAAGGTATGGTGCG, (R) GCACAGTTGTTGTCCAAATGA.
Electrophoretic mobility shift assay (EMSA)
Full length Math1 and E47 cDNAs were cloned into pGEX-3X and pET28(a)
expression vectors, respectively. MATH1/GST and E47/6xHIS fusion proteins were
purified from IPTG-induced BL21 bacteria by agarose-Glutathione (Sigma, USA)
or Co Talon Affinity Resin (Clontech, USA), respectively.
For EMSA, two oligonucleotides CAGGAGCCCTGCCAGGCAGCTGGTGGCATTCTCCA and
GTGGAGAATGCCACCAGCTGCCTGGCAGGGCTCCTG were annealed and labeled by Klenow
enzyme in the presence of [
-32P]dCTP. A positive control
probe was E1 according to (Akazawa et al.,
1995
). EMSA was carried out as previously described
(Ben-Porath et al., 1999
).
| Results |
|---|
|
|
|---|
As seen in Fig. 1A-D, by
E14.5 CGC precursors occupy the cerebellar rhombic lip, as revealed by
Math1/lacZ activity (lacZ expression under Math1
endogenous control elements). Similar staining pattern in
Math1ß-gal/+ (Fig.
1A,C) and Math1ß-gal/ß-gal
(Fig. 1B,D) indicated that in
Math1-null mice CGC precursors were born and reached a state of
differentiation that required Math1 expression. At E16.5,
Math1ß-gal/+ displayed staining all over the surface
of the developing cerebellum (Fig.
1E), consistent with the formation of EGL by a rostromedial
migration of CGC progenitors from the rhombic lip
(Altman and Bayer, 1997
;
Gilthorpe et al., 2002
;
Hatten and Heintz, 1995
). By
contrast, in Math1ß-gal/ß-gal there were less
Math1/lacZ-positive cells at the cerebellar surface, although the
rhombic lip continued to include surviving progenitors
(Fig. 1F). At both stages, the
rhombic lip was smaller in Math1-null embryos when compared with the
heterozygous littermate. This was in agreement with the previous histological
analysis of sectioned cerebella and proliferation rate measured by BrdU
incorporation (Ben-Arie et al.,
1997
; Ben-Arie et al.,
2000
) and suggested that CGC progenitors were viable even without
Math1 expression. Moreover, examination of the entire brain revealed
no ectopic migration in Math1-null mice, excluding such an
explanation for the lack of EGL.
|
Based on the spatiotemporal expression pattern of Math1/lacZ
(Fig. 1), we chose to examine
CGC precursors at E14.5, as an advanced stage in which the rhombic lip
progenitors are present in both Math1ß-gal/ß-gal
and Math1ß-gal/+, and the abnormal phenotype is only
emerging. A typical example of a dissected rhombic lip from
Math1ß-gal/+ cerebellum, which was subsequently
stained by X-Gal, showed that an enriched source of
Math1/lacZ-expressing cells could be obtained
(Fig. 1G). Isolation of a
totally pure CGC population from individual embryos was impractical, but not
essential, as similar proportions of Math1/lacZ-negative cells were
present in the different cultures compared, regardless of Math1
genotype. As the isolated tissues may contain CGC precursors as well as other
cell types, we use the term `rhombic lip cells'. Further confirmation for the
enrichment of the isolated rhombic lip tissue by CGC was obtained by RT-PCR.
Isolated rhombic lips from Math1ß-gal/+ expressed
lacZ and Math1, as expected
(Fig. 1H). An independent
verification was provided by the expression of Zipro1 (RU49/Zfp38), a
zinc-finger transcription factor specifically expressed in CGC from early
stages (Yang et al., 1996
)
(Fig. 1H).
We followed the expression of Math1/lacZ over time in cultures obtained from individual embryos of the three Math1 genotypes. No notable differences, such as density of cells or increased number of dead cells, were observed in cultures from controls and Math1ß-gal/ß-gal (data not shown). Staining for lacZ after 3 days in culture (Fig. 2A-F) revealed no background in cultures from Math1+/+, although most cells from Math1ß-gal/+ (Fig. 2B,E) and Math1ß-gal/ß-gal (Fig. 2C,F) appeared blue. Comparison of cell density, proportion of stained cells and staining intensity did not imply any major difference between Math1 null and control cells at this stage. Moreover, Math1/lacZ expression indicated that CGC precursors lacking Math1 survived after 3 days in vitro and continuously maintained Math1 promoter activity. Hence, it was concluded that Math1 was not essential for the survival of CGC precursors.
|
To refine this observation, we used a quantitative colorimetric assay for
ß-galactosidase activity in the cultured cells. After 3 days in culture,
Math1/lacZ activity was very similar in
Math1ß-gal/+ and
Math1ß-gal/ß-gal cultures, much above the
background measured in Math1+/+
(Fig. 2M). However, after 6
days in culture a significantly higher level of ß-galactosidase activity
remained in Math1ß-gal/ß-gal cells, in contrast
to the significant reduction of activity in
Math1ß-gal/+ cultures (P<0.001,
t-test). Math1 was shown before to act as a positive
autoregulator (Helms et al.,
2000
), and our data demonstrated for the first time a role for
Math1 also in a negative autoregulation of its own expression.
Specification of CGC is independent of Math1
The absence of an essential transcription factor may change the fate of
neural precursor cells (Guillemot,
1999
; Hassan and Bellen,
2000
). Moreover, culturing of normal neural precursors may lead to
alteration of the cellular identity that may result in a fate switch, by
accelerating differentiation or causing de-differentiation
(Anderson, 2001
). Therefore, we
studied cell fate specification of the rhombic lip cells in
Math1-null mice.
As Math1 is expressed in a limited time window during CGC
development, both accelerated differentiation and de-differentiation of the
progenitors may silence Math1 promoter, resulting in a decreased
Math1/lacZ expression. Therefore, we examined the expression of two
CGC-specific transcription factors Zic1 and Zipro1, which
are expressed in rhombic lip precursors, as well as in mature CGC in the IGL
(Aruga et al., 1994
;
Nagai et al., 1997
;
Yang et al., 1996
). RT-PCR
analysis was performed on cells cultured for 3 and 6 days from all
Math1 genotypes (Fig.
3). Similar levels of Zic1 and Zipro1
transcripts were detected in Math1ß-gal/ß-gal,
when compared with Math1+/+ and
Math1ß-gal/+ littermates at both time points. These
data revealed that the initiation and maintenance of the correct fate of
rhombic lip cells destined to become CGC, was independent of Math1,
and was not lost upon prolonged growth in vitro.
|
Immunofluorescent detection of ß-tubulin, which is known to be
expressed in CGC processes (Alder et al.,
1999
; Helms et al.,
2001
), showed that a large number of processes have developed from
Math1+/+ and Math1ß-gal/+ rhombic
lip cells, when cultured for 6 days, but not in cultures from
Math1ß-gal/ß-gal
(Fig. 4A-C). Quantification of
the processes evaluation was achieved by ß-tubulin staining of similarly
grown cultures followed by a colorimetric assay. The absorbance of control
cultures from Math1+/+ and
Math1ß-gal/+ (n=15) was 0.30 (±0.04),
and was reduced to 0.13 (±0.02) in
Math1ß-gal/ß-gal (n=11), which is
significantly lower (P<0.001, t-test). The difference is
smaller than visualized by immunostaining, as staining of both the soma and
processes were measured. Staining against phosphorylated neurofilaments
(Fig. 4D-F), NF160
(Fig. 4G-I) and NCAM
(Fig. 4J-L) illustrated long
processes in Math1+/+ and
Math1ß-gal/+, but not in
Math1ß-gal/ß-gal. Control nuclear staining by
DAPI showed a uniform cell density in all genotypes
(Fig. 4M-O, and
Fig. 4A-L as counterstaining),
indicating a similar survival of cells after 6 days in culture. The neural
phenotype displayed by only a fraction of the cultured cells was consistent
with previous reports that only some of rhombic lip precursors are competent
to differentiate in vitro (Alder et al.,
1996
).
|
Math1 regulates the expression of Notch receptors, ligands and the Hes5 effector
Accumulating data support the involvement of the Notch signaling pathway in
cerebellar development, and connect Math1 to this pathway in various
organs during embryogenesis. Therefore, we first analyzed the expression of
various receptors (Notch1 to Notch4) and ligands (Dll1,
Dll3, Dll4, Jag1 and Jag2) in the rhombic lip at E14 by
quantitative real-time RT-PCR. We assumed that analyzing the absolute level of
each transcript combined with a comparison of its amount in
Math1+/+ and
Math1ß-gal/ß-gal is indicative of its importance
for CGC development.
Among all Notch receptors tested, the level of Notch2 was the highest, being 145-fold higher than Notch1 and more than 20-fold higher than Notch3-4 (Fig. 5A). A striking difference was detected also for Notch ligands, where the level of Jag1 and to a lower extent Dll1 was the highest among the five ligands tested (Fig. 5A).
|
Seeing that the Notch signaling pathway was related to CGC development, we next examined two Notch effectors Hes1 and Hes5 in E14.5 rhombic lips and primary cultures from Math1+/+ and Math1ß-gal/ß-gal littermates by RT-PCR (Fig. 6). Both Hes1 and Hes5 were found to be expressed in wild-type rhombic lip, with a higher level of the latter. Although the expression of Hes1 and ß-actin was similar in the two genotypes, Hes5 expression was reduced in Math1ß-gal/ß-gal rhombic lip, when compared with Math1+/+ (Fig. 6). Moreover, the decrease in Hes5 expression level in Math1ß-gal/+ was even more pronounced in rhombic lip cells cultured for 3 and 6 days (Fig. 6). The reduction of Hes5 in CGC progenitors from Math1 null suggested a positive control of Math1 over Hes5, but not Hes1, expression, which was not identified previously.
|
|
| Discussion |
|---|
|
|
|---|
Generation and specification of cerebellar granule cell progenitors is Math1-independent
Whole-mount X-Gal staining demonstrated clearly that rhombic lip CGC
precursors were born in Math1ß-gal/ß-gal mice,
but failed to migrate out to form the EGL, consistently with previous studies
(Ben-Arie et al., 1997
;
Ben-Arie et al., 2000
). The
thinner rhombic lip identified by whole-mount staining of Math1-null
mice was in full agreement with previous analyses and the fact that decreased
proliferation was detected by a BrdU incorporation assay
(Ben-Arie et al., 1997
). As we
examined the entire cerebellar region, the absence of ectopic staining in
Math1ß-gal/ß-gal mice excluded the likelihood of
abnormal migration of Math1/lacZ-expressing cells. The possibility
that ectopic cells were not stained, as they did not maintain Math1
promoter activity, is less probable, as the rhombic lip kept staining until
E18.5 in vivo, and the precursors maintained Math1/lacZ expression
for an extended period in vitro.
The fact that rhombic lip CGC precursors activated
Math1/lacZ expression did not provide a definite answer to
the question of the specification status of the progenitors. To address
whether Math1 is needed for proper fate determination we examined the
expression of two more transcription factors, Zipro1 and
Zic1 known to be expressed in CGC and their progeny
(Alder et al., 1999
;
Aruga et al., 1998
;
Aruga et al., 1994
;
Nagai et al., 1997
;
Yang et al., 1999
). The
continuous expression of both genes in the rhombic lip and in cultured
progenitors was shown to be Math1 independent, which lead us to the
conclusion that Math1 was not required for the initial specification
of granule cell progenitors and for the maintenance of granule identity, both
in vivo and in vitro.
The relationship between Math1, Zic1 and Zipro1 is
noteworthy. We show that in Math1-null mice both Zic1 and
Zipro1 were normally expressed in CGC in vivo and in vitro, which may
indicate that they act upstream to Math1. However, this notion is
contradicted by other data. First, Zic1 expression in the developing
neural tube is broad and becomes confined to the rhombic lip only by E12
(Aruga et al., 1994
), whereas
Math1 expression at the neural tube begins at E9
(Akazawa et al., 1995
;
Ben-Arie et al., 1997
;
Ben-Arie et al., 2000
).
Similarly, Zipro1 is expressed also in granule cells of the olfactory
bulb and dentate gyrus, where no Math1 expression was reported
(Yang et al., 1996
). Second,
Zic1 and Zipro1 knockout and overexpression in mice
demonstrated that these genes regulate cerebellar patterning and EGL
proliferation at stages later then those affected by Math1 deletion
(Aruga et al., 1998
;
Yang et al., 1999
). Third,
Zic1 was recently shown to bind an enhancer of Math1 and to
downregulate Math1 expression. However, Zic1 acts through
repression of the positive autoregulation of Math1 itself
(Ebert et al., 2003
), which is
not the major regulatory element of Math1 expression, as the
autoregulation depends on initial activation of Math1 by independent
upstream genes. Taken together, Math1, Zic1 and Zipro1 seem
to affect cerebellar development through parallel, yet crosstalking, signaling
pathways.
Differentiation of CGC precursors is Math1-dependent
Rhombic lip cells from both Math1+/+ and
Math1ß-gal/+ E14 embryos reaggregated in culture, as
expected (Alder et al., 1996
).
However, only after a longer incubation period in vitro (between 3 and 6 days)
did a complex network of processes form, without the addition of supplements
like BMPs of NGF. Immunoreactivity with ß-tubulin, phosphorylated
neurofilaments, NF160, NCAM and the distinct process morphology, confirmed a
progress of the rhombic lip cells towards a neural phenotype. By contrast,
Math1ß-gal/ß-gal cultures developed few
processes and growth cones, and lacked well developed neural extensions.
During normal development in vivo, CGC do not grow extensions until they are
situated in the inner EGL and become competent to start the inward radial
migration to form the IGL (Hatten and
Heintz, 1995
). Therefore, culturing and analysis of the process
outgrowth were not supposed to mimic the in vivo situation, but rather allow
examination of the developmental potential of the progenitors, separating it
from the need to migrate to the EGL, the place at which this morphological
change normally takes place.
Normally, at the rhombic lip stage, CGC undergo proliferation and consequently migrate out of the rhombic lip: two abilities that are affected in Math1-null mice. As both functions mark the progress in the developmental program, which require Math1 for the regulation of its target genes, they can be regarded as Math1-dependent differentiation events. We propose that improper differentiation is the cause for developmental arrest in the rhombic lip. A simplistic view of the lack of EGL may suggest that Math1 was essential for activation of genes, which convey a migratory ability, or that their products are part of the migratory machinery per se. However, as the transcription of those genes is under the control of Math1, directly or indirectly, the lack of migration from the rhombic lip may be regarded as the outcome of improper differentiation of the progenitors. Hence, we suggest that only after Math1 is activated do rhombic lip cells acquire the ability to further differentiate.
Math1 is not essential for the initial activation of its promoter activity, but is necessary for its downregulation
Helms et al. (Helms et al.,
2000
) reported a positive autoregulation of Math1 over
its own expression, through an E-box-containing downstream enhancer, which was
shown to bind Math1. Transgenic mice expressing a Math1/lacZ
reporter, under various control elements flanking Math1 ORF,
recapitulated most of the endogenous Math1 expression. However, the
same transgene was not expressed when the mice were crossed with
Math1-null mice, as no MATH1 was available to activate its enhancer
(Helms et al., 2000
). The fact
that a Math1/lacZ reporter is expressed in
Math1ß-gal/ß-gal mice, which are a completely
null for Math1, established the existence of additional
Math1-independent control elements that activates Math1
expression. Moreover, as we found a continuous expression of
Math1/lacZ in rhombic lip cultured cells, it seemed that the major
control over Math1 expression is MATH1 independent, and that the
positive autoregulation contributes mainly to the refinement of Math1
levels.
During normal cerebellar development Math1 is expressed in granule
cell precursors and in the rhombic lip and outer EGL, and is turned off in
postmitotic cells in the inner EGL (Akazawa
et al., 1995
; Ben-Arie et al.,
2000
; Helms and Johnson,
1998
). However, upstream genes and control mechanisms regulating
the expression of Math1 are not yet fully identified. In the spinal
cord of Gdf7 mutant mice, Math1 expression does not continue
after E10.5, but the addition of GDF7 or BMP7 markedly increased
Math1 expression (Lee et al.,
1998
). Similarly, the dorsal midline cells adjacent to the rhombic
lip express GDF7, BMP6 and BMP7, which were demonstrated to induce Math1,
En1/2, Zic1 and Wnt3a in the ventral mesencephalon/metencephalon
neural tube. The induction of those genes normally confined to dorsal cells
that develop into CGC precursors indicates the ability of BMP factors to
determine the neural subtype fate, and suggests that BMPs regulate
Math1 expression (Alder et al.,
1999
).
Math1 acts via Notch signaling by activating Hes5 transcription during CGC development
The evolutionarily conserved Notch signaling pathway mediates cell-to-cell
communication to regulate cell fate decisions and patterning in both
invertebrates and vertebrates. In the developing nervous system Notch
signaling was classically regarded as a mechanism that keeps cells in an
undifferentiated state. However, recently Notch signaling was found to be
important for differentiation of glial cells and the organization of neuronal
processes (Frisen and Lendahl,
2001
; Justice and Jan,
2002
). To shed light on the role of Notch signaling in CGC
development, and based on the observations that various components of the
pathway are expressed in various stages of cerebellar development, we analyzed
their expression in the rhombic lip. We have found that the Notch2
receptor and Jag1 ligand are the most abundant species, although all
known receptors and ligands tested were expressed. Our findings are in
agreement with previous studies that were mostly concerned with later stages
of cerebellar development (Irvin et al.,
2001
; Kusumi et al.,
2001
; Solecki et al.,
2001
; Tanaka et al.,
1999
). Moreover, we have identified a selective downregulation of
Notch4, Dll1, Dll3, Dll4 and Jag2 in the rhombic lip of
Math1-null mice.
Because in Math1-null mutants the level of Notch receptors and ligands was affected, we examined whether Math1 had a transcriptional control over the Notch effectors Hes1 or Hes5 in the rhombic lip. RT-PCR analysis of Hes1 and Hes5 expression in rhombic lip tissue and in cultured cells after 3 and 6 days demonstrated a continuous downregulation of Hes5, but not of Hes1, in Math1-null mice. EMSA analysis has indicated that MATH1 can bind an E-box-containing sequence flanking Hes5, which suggests a novel control mechanism of Math1 over the transcription of Hes5, which is known to act as Math1 suppressor. Taking the new and established data together, we suggest a possible model linking some of the genes and interactions involved in CGC development (Fig. 8). According to our hypothesis, Hes5 normally downregulates Math1, which in turn further activates Hes5 transcription (directly or indirectly), and thus an increasing suppression of Math1 develops. However, in Math1ß-gal/ß-gal cells, this feedback loop is interrupted, as there is no Math1 gene product to further activate Hes5. Therefore, the level of Hes5 gene product cannot increase, and Math1 promoter remains active, which is in full agreement with our observations. The model also provides an explanation for the delay in the downregulation of Math1 promoter activity, seen in cultured rhombic lip cells from Math1ß-gal/+ mice after 6, but not 3, days in vitro. Accordingly, at E14.5 there is a balance between MATH1 and HES5 levels, in which both the positive and negative regulatory loops take place. However, with time, the level of MATH1 increases due to the positive autoregulation, which finally leads to an increase in the level of HES5 until it reaches the threshold needed to attenuate Math1 transcription. Further experiments are needed in order to establish and verify the interplay between all the genes and proteins presented in the suggested model.
|
Mutual effects between bHLH factors and Hes genes are not limited
to Math1 (reviewed by Guillemot,
1999
; Kageyama et al.,
1997
). Cau et al. (Cau et al.,
2000
) have demonstrated a complex interplay between Hes genes and
Mash1 in the olfactory epithelium. Mash1 was expressed
ectopically in Hes1 mutants, but normally in Hes5 mutants.
By contrast, in Mash1 knockout the expression of Hes1 was
unaffected, while Hes5 level was severely reduced
(Cau et al., 2000
). However,
retroviral overexpression of Hes5 repressed Mash1 expression
in oligodendrocytes precursors (Kondo and
Raff, 2000
). It was therefore proposed that Hes1
represses Mash1, while Mash1 activates Hes5, which
in turn represses Mash1. This mode of action is very similar to the
model we propose for Math1 action.
Interestingly, during recent years Notch signaling has been linked not only
to neural and glial cell fate determination, but also to the control of
process outgrowth (Frisen and Lendahl,
2001
). Upregulation of Notch was shown to inhibit process
extension or even cause their retraction, while repression of Notch signaling
enhanced process outgrowth (Berezovska et
al., 1999
; Franklin et al.,
1999
; Sestan et al.,
1999
). However, in cultured CGC we have noticed that
downregulation of Notch receptors and ligands in Math1-null mice was
accompanied by a reduction in process outgrowth. However, the exact molecular
mechanism underlying the relationship between this downregulation and process
extension should be further examined.
The correlation between the expression of Notch effectors, such as
Hes1 and Hes5, in controlling process outgrowth has been
demonstrated in various experimental systems. Expression of Hes1 in
PC12-E2 cells inhibits NCAM-dependent process outgrowth
(Jessen et al., 2003
), and its
expression inhibits both the intrinsic and NGF-induced process outgrowth of
embryonic day-17 rat hippocampal neurons in culture
(Castella et al., 1999
).
Similarly, constitutive expression of the intracellular domain of
Notch1, which activates Hes1 promoter in SH-SY5Y
neuroblastoma cells, inhibits their spontaneous and induced process outgrowth
(Grynfeld et al., 2000
).
Interestingly, axonal injury of corticospinal and dorsal root ganglion neurons
suppresses Hes gene expression, possibly as part of the initiation of a
regenerative response (Kabos et al.,
2002
). Hence, our data support the hypothesis that Math1
influences process outgrowth, via the Notch pathway, by regulation of
Hes5 expression.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Present address: The Lautenberg Center for General and Tumor Immunology,
Hadassah Medical School, Jerusalem, Israel ![]()
| REFERENCES |
|---|
|
|
|---|
Akazawa, C., Ishibashi, M., Shimizu, C., Nakanishi, S. and
Kageyama, R. (1995). A mammalian helix-loop-helix factor
structurally related to the product of Drosophila proneural gene atonal is a
positive transcriptional regulator expressed in the developing nervous system.
J. Biol. Chem. 270,8730
-8738.
Alder, J., Cho, N. and Hatten, M. (1996).
Embryonic precursor cells from the rhombic lip are specified to a cerebellar
granule neuron identity. Neuron
17,389
-399.[CrossRef][Medline]
Alder, J., Lee, K. J., Jessell, T. M. and Hatten, M. E.
(1999). Generation of cerebellar granule neurons in vivo by
transplantation of BMP-treated neural progenitor cells. Nat.
Neurosci. 2,535
-540.[CrossRef][Medline]
Altman, J. and Bayer, S. A. (1997).
Development of the Cerebellar system In Relation to its Evolution,
Structure, and Functions. Boca Raton, FL: CRC Press.
Anderson, D. J. (2001). Stem cells and pattern
formation in the nervous system: the possible versus the actual.
Neuron 30,19
-35.[CrossRef][Medline]
Artavanis-Tsakonas, S., Rand, M. D. and Lake, R. J.
(1999). Notch signaling: cell fate control and signal integration
in development. Science
284,770
-776.
Aruga, J., Minowa, O., Yaginuma, H., Kuno, J., Nagai, T., Noda,
T. and Mikoshiba, K. (1998). Mouse Zic1 is involved in
cerebellar development. J. Neurosci.
18,284
-293.
Aruga, J., Yokota, N., Hashimoto, M., Furuichi, T., Fukuda, M.
and Mikoshiba, K. (1994). A novel zinc finger protein, zic,
is involved in neurogenesis, especially in the cell lineage of cerebellar
granule cells. J. Neurochem.
63,1880
-1890.[Medline]
Beatus, P. and Lendahl, U. (1998). Notch and
neurogenesis. J. Neurosci. Res.
54,125
-136.[CrossRef][Medline]
Ben-Arie, N., McCall, A. E., Berkman, S., Eichele, G., Bellen,
H. J. and Zoghbi, H. Y. (1996). Evolutionary conservation of
sequence and expression of the bHLH protein Atonal suggests a conserved role
in neurogenesis. Hum. Mol. Genet.
5,1207
-1216.
Ben-Arie, N., Bellen, H. J., Armstrong, D. L., McCall, A. E.,
Gordadze, P. R., Guo, Q., Matzuk, M. M. and Zoghbi, H. Y.
(1997). Math1 is essential for genesis of cerebellar granule
neurons. Nature 390,169
-172.[CrossRef][Medline]
Ben-Arie, N., Hassan, B. A., Bermingham, N. A., Malicki, D. M.,
Armstrong, D., Matzuk, M., Bellen, H. J. and Zoghbi, H. Y.
(2000). Functional conservation of atonal and Math1 in the CNS
and PNS. Development
127,1039
-1048.[Abstract]
Ben-Porath, I., Yanuka, O. and Benvenisty, N.
(1999). The tmp gene, encoding a membrane protein, is a c-Myc
target with a tumorigenic activity. Mol. Cell Biol.
19,3529
-3539.
Berezovska, O., McLean, P., Knowles, R., Frosh, M., Lu, F. M.,
Lux, S. E. and Hyman, B. T. (1999). Notch1 inhibits neurite
outgrowth in postmitotic primary neurons. Neuroscience
93,433
-439.[CrossRef][Medline]
Bermingham, N. A., Hassan, B. A., Price, S. D., Vollrath, M. A.,
Ben-Arie, N., Eatock, R. A., Bellen, H. J., Lysakowski, A. and Zoghbi, H.
Y. (1999). Math1: an essential gene for the generation of
inner ear hair cells. Science
284,1837
-1841.
Castella, P., Wagner, J. A. and Caudy, M.
(1999). Regulation of hippocampal neuronal differentiation by the
basic helix-loop-helix transcription factors HES-1 and MASH-1. J.
Neurosci. Res. 56,229
-240.[CrossRef][Medline]
Cau, E., Gradwohl, G., Casarosa, S., Kageyama, R. and Guillemot,
F. (2000). Hes genes regulate sequential stages of
neurogenesis in the olfactory epithelium. Development
127,2323
-2332.[Abstract]
Chen, P., Johnson, J. E., Zoghbi, H. Y. and Segil, N.
(2002). The role of Math1 in inner ear development: Uncoupling
the establishment of the sensory primordium from hair cell fate determination.
Development 129,2495
-2505.
Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J. and Rutter,
W. J. (1979). Isolation of biologically active ribonucleic
acid from sources enriched in ribonuclease.
Biochemistry 18,5294
-5299.[CrossRef][Medline]
de la Pompa, J., Wakeham, A., Correia, K. M., Samper, E., Brown,
S., Aguilera, R. J., Nakano, T., Honjo, T., Mak, T. W., Rossant, J. et al.
(1997). Conservation of the Notch signalling pathway in mammalian
neurogenesis. Development
124,1139
-1148.[Abstract]
Ebert, P. J., Timmer, J. R., Nakada, Y., Helms, A. W., Parab, P.
B., Liu, Y., Hunsaker, T. L. and Johnson, J. E. (2003). Zic1
represses Math1 expression via interactions with the Math1 enhancer and
modulation of Math1 autoregulation. Development
130,1949
-1959.
Edmondson, J. C., Liem, R. K., Kuster, J. E. and Hatten, M.
E. (1988). Astrotactin: a novel neuronal cell surface antigen
that mediates neuron-astroglial interactions in cerebellar microcultures.
J. Cell Biol. 106,505
-517.
Fishman, R. B. and Hatten, M. E. (1993).
Multiple receptor systems promote CNS neural migration. J.
Neurosci. 13,3485
-3495.[Abstract]
Franklin, J. L., Berechid, B. E., Cutting, F. B., Presente, A.,
Chambers, C. B., Foltz, D. R., Ferreira, A. and Nye, J. S.
(1999). Autonomous and non-autonomous regulation of mammalian
neurite development by Notch1 and Delta1. Curr. Biol.
9,1448
-1457.[CrossRef][Medline]
Frisen, J. and Lendahl, U. (2001). Oh no, Notch
again! BioEssays 23,3
-7.[CrossRef][Medline]
Gaiano, N. and Fishell, G. (2002). The role of
notch in promoting glial and neural stem cell fates. Annu. Rev.
Neurosci. 25,471
-490.[CrossRef][Medline]
Gilthorpe, J. D., Papantoniou, E. K., Chedotal, A., Lumsden, A.
and Wingate, R. J. (2002). The migration of cerebellar
rhombic lip derivatives. Development
129,4719
-4728.
Goldowitz, D. and Hamre, K. (1998). The cells
and molecules that make a cerebellum. Trends Neurosci.
21,375
-382.[CrossRef][Medline]
Grynfeld, A., Pahlman, S. and Axelson, H.
(2000). Induced neuroblastoma cell differentiation, associated
with transient HES-1 activity and reduced HASH-1 expression, is inhibited by
Notch1. Int. J. Cancer
88,401
-410.[CrossRef][Medline]
Guillemot, F. (1999). Vertebrate bHLH genes and
the determination of neuronal fates. Exp. Cell Res.
253,357
-364.[CrossRef][Medline]
Hassan, B. A. and Bellen, H. J. (2000). Doing
the MATH: is the mouse a good model for fly development? Genes
Dev. 14,1852
-1865.
Hatten, M. E., Alder, J., Zimmerman, K. and Heintz, N.
(1997). Genes involved in cerebellar cell specification and
differentiation. Curr. Opin. Neurobiol.
7, 40-47.[CrossRef][Medline]
Hatten, M. E., Gao, W. Q., Morrison, M. E. and Mason, C. A.
(1998). The Cerebellum: Purification and Coculture of Identified
Cell Populations. In Culturing Nerve Cells (ed. G.
Banker and G. Kimberly), pp. 419-460. Cambridge, MA:
The MIT Press.
Hatten, M. E. and Heintz, N. (1995). Mechanisms
of neural patterning and specification in the developing cerebellum.
Annu. Rev. Neurosci. 18,385
-408.[Medline]
Helms, A. W., Abney, A. L., Ben-Arie, N., Zoghbi, H. Y. and
Johnson, J. E. (2000). Autoregulation and multiple enhancers
control Math1 expression in the developing nervous system.
Development 127,1185
-1196.[Abstract]
Helms, A. W., Gowan, K., Abney, A., Savage, T. and Johnson, J.
E. (2001). Overexpression of math1 disrupts the coordination
of neural differentiation in cerebellum development. Mol. Cell.
Neurosci. 17,671
-682.[CrossRef][Medline]
Helms, A. W. and Johnson, J. E. (1998).
Progenitors of dorsal commissural interneurons are defined by MATH1
expression. Development
125,919
-928.[Abstract]
Hirata, H., Tomita, K., Bessho, Y. and Kageyama, R.
(2001). Hes1 and Hes3 regulate maintenance of the isthmic
organizer and development of the mid/hindbrain. EMBO
J. 20,4454
-4466.[CrossRef][Medline]
Irvin, D. K., Zurcher, S. D., Nguyen, T., Weinmaster, G. and
Kornblum, H. I. (2001). Expression patterns of Notch1,
Notch2, and Notch3 suggest multiple functional roles for the Notch-DSL
signaling system during brain development. J. Comp.
Neurol. 436,167
-181.[CrossRef][Medline]
Isaka, F., Ishibashi, M., Taki, W., Hashimoto, N., Nakanishi, S.
and Kageyama, R. (1999). Ectopic expression of the bHLH gene
Math1 disturbs neural development. Eur. J. Neurosci.
11,2582
-2588.[CrossRef][Medline]
Jessen, U., Novitskaya, V., Walmod, P. S., Berezin, V. and Bock,
E. (2003). Neural cell adhesion molecule-mediated neurite
outgrowth is repressed by overexpression of HES-1. J. Neurosci.
Res. 71,1
-6.[CrossRef][Medline]
Justice, N. J. and Jan, Y. N. (2002).
Variations on the Notch pathway in neural development. Curr. Opin.
Neurobiol. 12,64
-70.[CrossRef][Medline]
Kabos, P., Kabosova, A. and Neuman, T. (2002).
Neuronal injury affects expression of helix-loop-helix transcription factors.
NeuroReport 13,2385
-2388.[CrossRef][Medline]
Kageyama, R., Ishibashi, M., Takebayashi, K. and Tomita, K.
(1997). bHLH transcription factors and mammalian neuronal
differentiation. Int. J. Biochem. Cell Biol.
29,1389
-1399.[CrossRef][Medline]
Kawamoto, K., Ishimoto, S., Minoda, R., Brough, D. E. and
Raphael, Y. (2003). Math1 gene transfer generates new
cochlear hair cells in mature guinea pigs in vivo. J.
Neurosci. 23,4395
-4400.
Kondo, T. and Raff, M. (2000). Basic
helix-loop-helix proteins and the timing of oligodendrocyte differentiation.
Development 127,2989
-2998.[Abstract]
Kusumi, K., Dunwoodie, S. L. and Krumlauf, R.
(2001). Dynamic expression patterns of the pudgy/spondylocostal
dysostosis gene Dll3 in the developing nervous system. Mech.
Dev. 100,141
-144.[CrossRef][Medline]
Lanford, P. J., Shailam, R., Norton, C. R., Gridley, T. and
Kelley, M. W. (2000). Expression of Math1 and HES5 in the
cochleae of wildtype and Jag2 mutant mice. J. Assoc. Res.
Otolaryngol. 1,161
-171.[CrossRef][Medline]
Lee, K. J., Mendelsohn, M. and Jessell, T. M.
(1998). Neuronal patterning by BMPs: a requirement for GDF7 in
the generation of a discrete class of commissural interneurons in the mouse
spinal cord. Genes Dev.
12,3394
-3407.
Lutolf, S., Radtke, F., Aguet, M., Suter, U. and Taylor, V.
(2002). Notch1 is required for neuronal and glial differentiation
in the cerebellum. Development
129,373
-385.
Millen, K. J., Millonig, J. H., Wingate, R. J., Alder, J. and
Hatten, M. E. (1999). Neurogenetics of the cerebellar system.
J. Child Neurol. 14,574
-581.
Nagai, T., Aruga, J., Takada, S., Gunther, T., Sporle, R.,
Schughart, K. and Mikoshiba, K. (1997). The expression of the
mouse Zic1, Zic2, and Zic3 gene suggests an essential role for Zic genes in
body pattern formation. Dev. Biol.
182,299
-313.[CrossRef][Medline]
Schroder, N. and Gossler, A. (2002). Expression
of Notch pathway components in fetal and adult mouse small intestine.
Gene Expr. Patterns 2,247
-250.[CrossRef][Medline]
Sestan, N., Artavanis-Tsakonas, S. and Rakic, P.
(1999). Contact-dependent inhibition of cortical neurite growth
mediated by notch signaling. Science
286,741
-746.
Shou, J., Zheng, J. L. and Gao, W. Q. (2003).
Robust generation of new hair cells in the mature mammalian inner ear by
adenoviral expression of Hath1. Mol. Cell. Neurosci.
23,169
-179.[CrossRef][Medline]
Solecki, D. J., Liu, X. L., Tomoda, T., Fang, Y. and Hatten, M.
E. (2001). Activated Notch2 signaling inhibits
differentiation of cerebellar granule neuron precursors by maintaining
proliferation. Neuron
31,557
-568.[CrossRef][Medline]
Tanaka, M., Kadokawa, Y., Hamada, Y. and Marunouchi, T.
(1999). Notch2 expression negatively correlates with glial
differentiation in the postnatal mouse brain. J.
Neurobiol. 41,524
-539.[CrossRef][Medline]
Wang, V. Y. and Zoghbi, H. Y. (2001). Genetic
regulation of cerebellar development. Nat. Rev.
Neurosci. 2,484
-491.[CrossRef][Medline]
Wingate, R. J. (2001). The rhombic lip and
early cerebellar development. Curr. Opin. Neurobiol.
11, 82-88.[CrossRef][Medline]
Yang, Q., Bermingham, N. A., Finegold, M. J. and Zoghbi, H.
Y. (2001). Requirement of Math1 for secretory cell lineage
commitment in the mouse intestine. Science
294,2155
-2158.
Yang, X. W., Zhong, R. and Heintz, N. (1996).
Granule cell specification in the developing mouse brain as defined by
expression of the zinc finger transcription factor RU49.
Development 122,555
-566.[Abstract]
Yang, X. W., Wynder, C., Doughty, M. L. and Heintz, N.
(1999). BAC-mediated gene-dosage analysis reveals a role for
Zipro1 (Ru49/Zfp38) in progenitor cell proliferation in cerebellum and skin.
Nat. Genet. 22,327
-335.[CrossRef][Medline]
Zheng, J. L. and Gao, W. Q. (2000).
Overexpression of Math1 induces robust production of extra hair cells in
postnatal rat inner ears. Nat. Neurosci.
3, 580-586.[CrossRef][Medline]
Zheng, J. L., Shou, J., Guillemot, F., Kageyama, R. and Gao, W.
Q. (2000). Hes1 is a negative regulator of inner ear hair
cell differentiation. Development
127,4551
-4560.[Abstract]
Zine, A., Aubert, A., Qiu, J., Therianos, S., Guillemot, F.,
Kageyama, R. and de Ribaupierre, F. (2001). Hes1 and Hes5
activities are required for the normal development of the hair cells in the
mammalian inner ear. J. Neurosci.
21,4712
-4720.
Zine, A. and de Ribaupierre, F. (2002).
Notch/Notch ligands and Math1 expression patterns in the organ of Corti of
wild-type and Hes1 and Hes5 mutant mice. Hear. Res.
170, 22-31.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
K. J. Briggs, C. G. Eberhart, and D. N. Watkins Just Say No to ATOH: How HIC1 Methylation Might Predispose Medulloblastoma to Lineage Addiction Cancer Res., November 1, 2008; 68(21): 8654 - 8656. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Grimmer and W. A. Weiss BMPs oppose Math1 in cerebellar development and in medulloblastoma Genes & Dev., March 15, 2008; 22(6): 693 - 699. [Full Text] [PDF] |
||||
![]() |
H. Zhao, O. Ayrault, F. Zindy, J.-H. Kim, and M. F. Roussel Post-transcriptional down-regulation of Atoh1/Math1 by bone morphogenic proteins suppresses medulloblastoma development Genes & Dev., March 15, 2008; 22(6): 722 - 727. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Briggs, I. M. Corcoran-Schwartz, W. Zhang, T. Harcke, W. L. Devereux, S. B. Baylin, C. G. Eberhart, and D. N. Watkins Cooperation between the Hic1 and Ptch1 tumor suppressors in medulloblastoma Genes & Dev., March 15, 2008; 22(6): 770 - 785. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. de Bont, R. J. Packer, E. M. Michiels, M. L. d. Boer, and R. Pieters Biological background of pediatric medulloblastoma and ependymoma: A review from a translational research perspective Neuro-oncol, January 1, 2008; 10(6): 1040 - 1060. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhao, K.-M. Kwan, C. M. Mailloux, W.-K. Lee, A. Grinberg, W. Wurst, R. R. Behringer, and H. Westphal LIM-homeodomain proteins Lhx1 and Lhx5, and their cofactor Ldb1, control Purkinje cell differentiation in the developing cerebellum PNAS, August 7, 2007; 104(32): 13182 - 13186. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Farioli-Vecchioli, M. Tanori, L. Micheli, M. Mancuso, L. Leonardi, A. Saran, M. T. Ciotti, E. Ferretti, A. Gulino, S. Pazzaglia, et al. Inhibition of medulloblastoma tumorigenesis by the antiproliferative and pro-differentiative gene PC3 FASEB J, July 1, 2007; 21(9): 2215 - 2225. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Wang, D. Mullikin-Kilpatrick, J. E. Crandall, R. M. Gronostajski, E. D. Litwack, and D. L. Kilpatrick Nuclear Factor I Coordinates Multiple Phases of Cerebellar Granule Cell Development via Regulation of Cell Adhesion Molecules J. Neurosci., June 6, 2007; 27(23): 6115 - 6127. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Pascual, I. Abasolo, A. Mingorance-Le Meur, A. Martinez, J. A. Del Rio, C. V. E. Wright, F. X. Real, and E. Soriano Cerebellar GABAergic progenitors adopt an external granule cell-like phenotype in the absence of Ptf1a transcription factor expression PNAS, March 20, 2007; 104(12): 5193 - 5198. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Qin, L. Wine-Lee, K. J. Ahn, and E. B. Crenshaw III Genetic Analyses Demonstrate That Bone Morphogenetic Protein Signaling Is Required for Embryonic Cerebellar Development J. Neurosci., February 15, 2006; 26(7): 1896 - 1905. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Hutcheson, M. I. Hanson, K. B. Moore, T. T. Le, N. L. Brown, and M. L. Vetter bHLH-dependent and -independent modes of Ath5 gene regulation during retinal development Development, February 15, 2005; 132(4): 829 - 839. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Dauphinot, R. Lyle, I. Rivals, M. T. Dang, R.X. Moldrich, G. Golfier, L. Ettwiller, K. Toyama, J. Rossier, L. Personnaz, et al. The cerebellar transcriptome during postnatal development of the Ts1Cje mouse, a segmental trisomy model for Down syndrome Hum. Mol. Genet., February 1, 2005; 14(3): 373 - 384. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. D. Hawkins and M. Lovett The developmental genetics of auditory hair cells Hum. Mol. Genet., October 1, 2004; 13(suppl_2): R289 - R296. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Canzoniere, S. Farioli-Vecchioli, F. Conti, M. T. Ciotti, A. M. Tata, G. Augusti-Tocco, E. Mattei, M. K. Lakshmana, V. Krizhanovsky, S. A. Reeves, et al. Dual Control of Neurogenesis by PC3 through Cell Cycle Inhibition and Induction of Math1 J. Neurosci., March 31, 2004; 24(13): 3355 - 3369. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||