|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online February 18, 2004
doi: 10.1242/10.1242/dev.00925

1 McGill University, Biology Department, 1205 Docteur Penfield Avenue,
Montréal, Québec H3A 1B1, Canada
2 University of Missouri, Department of Biochemistry, 117 Schweitzer Hall,
Columbia, MO 65211, USA
3 University of Toronto, Department of Botany, 25 Willcocks Street, Toronto,
Ontario M5S 3B2, Canada
Author for correspondence (e-mail:
berleth{at}botany.utoronto.ca)
Accepted 16 October 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Arabidopsis, Auxin response factor interaction, Aux/IAA genes, BODENLOS, Genetic redundancy, MONOPTEROS, NONPHOTOTROPIC HYPOCOTYL 4
| Introduction |
|---|
|
|
|---|
Conserved promoter elements that confer rapid auxin-responsive gene
expression have been identified and employed in the isolation of trans-acting
factors (auxin response factors, ARFs) (reviewed by
Guilfoyle et al., 1998
;
Guilfoyle and Hagen, 2001
;
Hagen and Guilfoyle, 2002
;
Liscum and Reed, 2002
). All
but two ARFs consist of an N-terminal DNA-binding domain (DBD), a central
activation domain (AD) or repression domain (RD) and a C-terminal dimerization
domain (CTD) (reviewed by Guilfoyle and
Hagen, 2001
). Within the CTD, two highly conserved motifs are
present not only in ARF proteins, but also in another large family of nuclear
proteins, the Aux/IAA proteins. Aux/IAA proteins are short lived, and a large
body of evidence suggests that the abundance of Aux/IAA proteins is positively
regulated through the auxin inducibility of their mRNAs and negatively through
auxin-dependent protein degradation
(Dharmasiri and Estelle, 2002
;
Leyser, 2002
). In yeast two
hybrid studies, ARFs and Aux/IAA proteins are capable of forming homo- and
heterotypic interactions through their CTDs, and specific binding of ARF
dimers to palindromic AuxRE target sites has been demonstrated in vitro
(Kim et al., 1997
;
Ulmasov et al., 1997a
;
Ulmasov et al., 1999b
). Given
the complexity of both ARF and Aux/IAA gene families, a very
high number of combinatorial interactions appear possible
(Kim et al., 1997
), but it
remains to be determined which interactions can be experimentally confirmed
and which of those are reflected in auxin responses of Arabidopsis
plants. As ARFs can form dimers in vivo
(Kim et al., 1997
;
Ulmasov et al., 1997a
), ARF
homodimers and certain heterodimers could be biologically relevant. Another
potentially important type of interaction appears to involve the negative
regulation of ARF activity by Aux/IAA proteins
(Gray et al., 2001
;
Tiwari et al., 2001
;
Ulmasov et al., 1997b
). Auxin
has been shown to promote proteasome-mediated degradation of Aux/IAA proteins
(Gray et al., 2001
;
Zenser et al., 2001
;
Zenser et al., 2003
) and could
thereby indirectly regulate ARF activity.
Although there is considerable insight into the molecular biology of
ARF and Aux/IAA genes and their products, the actual
functions of most of these genes in plant growth and development are unknown
(reviewed by Liscum and Reed,
2002
). Functions of most Aux/IAA genes are defined
exclusively by gain-of-function alleles, while loss-of-function alleles are
scarce and phenotypically subtle. Within the ARF gene family, no
gain-of-function alleles have been reported and loss-of-function mutations
have been identified in only three out of 22 genes. Of these three genes,
ETTIN (ETT)/ARF3, is implicated in gynecium development, and encodes
an unusual ARF protein lacking the CTD
(Sessions et al., 1997
;
Nemhauser et al., 2000
) that
functions as a transcriptional repressor in protoplast transfection assays
(Tiwari et al., 2003
). The
remaining two genetically defined ARF genes, MP and
NPH4, encode typical members of the ARF family with conserved DBDs
and CTDs. MP and NPH4 encode proteins that are highly
related in amino acid sequence, especially within their DBDs and CTDs
(Ulmasov et al., 1999b
)
(reviewed by Guilfoyle et al., 2001). These two ARFs contain non-conserved
glutamine-rich middle regions and function as transcriptional activators in
protoplast transfection assays (Ulmasov et
al., 1999a
; Tiwari et al.,
2003
). By sequence similarity, ARF proteins could act in pairwise
interactions, with MP and NPH4 being a likely combination
(Guilfoyle and Hagen, 2001
;
Ulmasov et al., 1999b
).
However, despite their structural similarity, both genes have been implicated
in entirely unrelated auxin responses. While MP has critical
functions in axial cell patterning early in organogenesis
(Berleth and Juergens, 1993
;
Przemeck et al., 1996
),
NPH4 mediates auxin-dependent differential cell expansion mainly in
the mature hypocotyl (Watahiki and
Yamamoto, 1997
; Stowe-Evans et
al., 1998
; Harper et al.,
2000
).
In this study, we were interested in visualizing further biological functions of MP and NPH4 by assessing their interaction properties and by correlating those to genetic data obtained in Arabidopsis plants. To this end, we studied their interaction with ARF and Aux/IAA proteins, their expression profiles in Arabidopsis development, and their capacity to trigger downstream events in a variety of genetic backgrounds. We found that the two gene products selectively interact with themselves and with each other, are expressed in overlapping domains, and regulate downstream processes in similar, but quantitatively distinguishable, ways. Depending on their relative expression level, they may act redundantly or non-redundantly, and seem to be negatively controlled by interaction with Aux/IAA proteins.
| Materials and methods |
|---|
|
|
|---|
Yeast two hybrid assays
Vectors for yeast two hybrid analysis were purchased from BD Biosciences
Clontech (Palo Alto, CA). Interaction analysis and ß-galactosidase assays
were performed as described in the Clontech manual for yeast two hybrid
interactions and screening. At least five individual colonies for each
interaction were chosen for quantitative ß-galactosidase assays. The
C-terminal domains [as defined by Ulmasov et al.
(Ulmasov et al., 1999b
)] of
MP/ARF5 and NPH4/ARF7 and full-length BDL/IAA12 were used as bait proteins
expressed from pAS2-1. Prey proteins were expressed from pACT2 and consisted
of C-terminal domains of ARF1, ARF2, ARF4, ARF5, ARF6, ARF7, ARF8, ARF9 and
ARF11 (Ulmasov et al., 1999b
;
Guilfoyle and Hagen, 2001
) and
full-length BDL/IAA12. Expression of bait and prey proteins in yeast was
confirmed by western blotting using GAL4 AD and BD antibodies (Santa Cruz
Biotechnology, Santa Cruz, CA). ARF CTDs, containing domains III and IV
(Guilfoyle and Hagen, 2001
),
were terminated at the stop codon and initiated at the N-terminal amino acid
position indicated below: ARF1 (544), ARF2 (717), ARF4 (647), ARF5 (778), ARF6
(778), ARF7 (1031), ARF8 (686), ARF9 (504) and ARF11 (485).
Protoplast transfection assays
The G4M(4X)-GUS reporter gene containing four yeast GAL4 DNA binding sites
upstream of a minimal -46 Cauliflower Mosaic Virus (CaMV) 35S promoter has
been described previously (Ulmasov et al.,
1995
; Tiwari et al.,
2003
). ARF effector genes consisted of a yeast GAL4 DBD fused
in-frame with the MP/ARF5 middle activator region (MR) and C-terminal domain
CTD [GAL4DBD-MP/ARF5(MR+CTD)] and the NPH4/ARF7 MR and CTD
[GAL4DBD-NPH4/ARF7(MR+CTD)] (Ulmasov et
al., 1999a
; Tiwari et al.,
2003
). IAA4, IAA9 and BDL/IAA12 effector
constructs encoding full-length Aux/IAA proteins have been described elsewhere
(Tiwari et al., 2001
). All
effector genes were placed under control of the CaMV 35S double enhancer
promoter followed by a translational enhancer from the tobacco mosaic virus
5' leader (Skuzeski et al.,
1990
) and contained a 3' nopaline synthase untranslated
region (Ulmasov et al., 1995
).
Isolation of carrot protoplasts, transfections and GUS activity assays were
performed as described previously (Ulmasov
et al., 1995
; Tiwari et al.,
2003
).
In situ hybridization to tissue sections
DIG-labeled single-stranded RNA probes were generated by in vitro
transcription and hybridized to tissue sections as previously described
(Beeckman et al., 2002
). As
NPH4 probe, a 650 bp fragment from the NPH4 cDNA without
significant homologies to other Arabidopsis sequences in BLAST
searches was amplified using GATGAAAGACCCTTCGAGTAC and ACCATTGTAAAGCTGATTCTG
as primers, subcloned in both orientations into pBluescript (Stratagene) and
transcribed from the T7 promoter. In situ hybridization probes used for
visualizing MP transcripts have been described previously
(Hardtke and Berleth,
1998
).
Plant growth conditions and plant material
Plants on soil were grown under long-day (16 hour) light cycles in growth
chambers (Conviron) at 22°C. For the analysis of seedlings, seeds were
surface-sterilized in 15% commercial bleach, washed in distilled water and
stratified in growth medium at 4°C for 4 days. Light-germinating seeds
were germinated on growth medium (ready-to-use 0.5x Murashige and Skoog
(MS) salt mixture, vitamins, 1.5% sucrose, buffered to pH 5.7, Gibco) at
22°C and placed under continuous fluorescent white light (80 µM
m-2s-1). We refer to days after germination (dag) as
days after exposure of imbibed seeds to light. For germination in the dark,
seeds were plated on the same medium without sucrose and exposed to
fluorescent white light (80 µM m-2 s-1) for 2 hours
to synchronize germination. Subsequently, plates were wrapped in three layers
of aluminum foil and incubated at 25°C.
We refer to the Columbia-0 (Col-0) line as `wild type' in all
experiments. Mutant plants were obtained from K. Yamamoto (nph4-103, -105,
-106) and E. Liscum (nph4-1), from R. Z. Sung (mpG12),
and from G. Juergens, U. Mayer and T. Hamann (bdl). The molecular
lesions in these mutants have been described
(Harper et al., 2000
;
Hardtke and Berleth, 1998
;
Hamann et al., 2002
).
Generation of transgenic lines
To generate plants expressing MP antisense RNA, a fragment of
2 kb (primer sequences: ACAAGGTCATCTCGAGCAGGTT and
TTGGCGAGAGAATTCCTGTGAGTC) was amplified from the MP cDNA (AF037229)
(Hardtke and Berleth, 1998
) by
PCR using Vent DNA polymerase (New England Biolabs). The maximum sequence
similarity to any other Arabidopsis sequence in small (100 bp)
intervals is below 30%. After digestion with XhoI and EcoRI
the fragment was cloned in antisense orientation into the respective sites
adjacent to the CaMV 35S promoter in binary vector pEGAD
(Cutler et al., 2000
).
Arabidopsis Col-0 plants were transformed with this construct
(35S::MPAS) in Agrobacterium tumefaciens strain GV3101pMP90
(Koncz and Schell, 1986
) by
the floral dip method (Clough and Bent,
1998
). Progeny of 28 transformants with
3:1 segregation
ratios of resistance to L-Phosphinotricin (BAR marker) were phenotypically
characterized in the T2 and T3 generation and three lines
(35S::MPAS1-3) with invariant mp-specific inflorescence
defects (Przemeck et al.,
1996
), but residual fertility, were selected for detailed
analysis. Because of the inactivity of the CaMV 35S promoter in early embryos
(Volker et al., 2001
),
transgenic plants have normal appearance at the seedling stage, but resemble
weak mp mutants at all subsequent stages.
The abundance of MP and NPH4 transcripts in
35S::MPAS plants was determined in RNA extracted from the fourth
rosette leaf of T3 plants 14 days after germination using RNeasy Plant Mini
Kit (Qiagen). RT-PCR analysis of total RNA was performed using One Step RT-PCR
Kit (Qiagen). Primers were as follows: MPFL (CCCGGAATTCATGATGGCTTCATTG,
CAATGGTGGAAATAGCTTCTCT); NPH4 (GATGAAAGACCCTTCGAGTAC, ACCATTGTAAAGCTGATTCGT);
and ACT7 (GGTGAGGATATTCAGCCACTTGTCTG, TGTGAGATCCCGACCCGCAAGATC). The
amplification fragment from the ACT7 transcript served as expression
standard and, as the PCR product spans an intron, as a tool to detect possible
amplification of genomic DNA. Linearity of PCR amplification was controlled as
described (Beeckman et al.,
2002
). In two independent experiments per line, MP
transcript levels were reduced to <5% of the wild-type level, while
NPH4 transcript abundance remained unchanged.
35S::NPH4 and 35S::MP transgenic lines: full-length
MP cDNA or regions of it, as well as full-length NPH4 cDNA
were amplified with Pfu DNA polymerase from the respective full-length cDNA
clones isolated from a library (Kieber et
al., 1993
) and control sequenced. Binary plasmids expressing the
cDNA fragments under control of the CaMV 35S promoter were then constructed in
the vector pTCSH1 (Hardtke et al.,
2000
) and transformed into Arabidopsis plants as
described for 35S::MPAS T-DNA above. Transgenic lines for each type
of construct were produced in three independent batches, using three
independently cloned plasmids. The phenotypic range of transgenics for a
particular construct was similar in all cases. All plants were genotyped for
presence of the respective transgene(s) by PCR using a 35S-specific
and a gene-specific oligonucleotide. Between seven and 21 transgenic lines
were obtained for each construct. Stability and reproducibility of phenotypic
traits was established in more than 10 independent 35S::MP and
35S::NPH4 lines. Plants overexpressing NPH4 and MP
full-length or partial cDNA fragments were derived from crosses between
primary transformants. Progeny from two to four crosses between at least two
individual primary transformants of each genotype, derived from independent
transformations, was analyzed for each combination. Relative transcript
abundance in wild type, 35S::MP and 35S::NPH4 lines was
quantified as described (Mattsson et al.,
2003
).
Double mutant analysis
To determine the seedling phenotypes of mp; nph4 double mutants,
plants homozygous for nph4 and heterozygous for mp were
identified in the F2 of a cross of the respective single mutants by the
appearance of nph4-specific leaf traits and by the appearance of
rootless seedlings in their F3 progeny. Homozygosity for nph4-1 was
assessed by PCR (below). In the progenies of these plants, rootless
individuals were observed at frequencies close to 25% and the remaining
seedlings displayed hypocotyl elongation properties indistinguishable from
nph4 homozygous seedlings of the respective nph4 allele. The
rootless F3 individuals were considered mp; nph4 double mutants.
Genotypes of other multiple mutant plants were confirmed by the following PCR assays. Presence of transgene constructs in all genetic combinations was monitored by PCR reactions using a 35S-specific and a gene-specific oligonucleotide. Homozygosity for nph4-1 (in double mutants with mp alleles or in 35S::MPAS lines) was verified by the absence of a wild-type specific amplification product in an analytical PCR using TCCTGCTGAGTTTGTGGTTCCTT and GGGGCTTGCTGATTCTGTTTGTTA as primers in combination with an unrelated control PCR reaction. The genotype at the BDL locus was monitored by PCR amplification of an 800 bp BDL fragment (primers GCTCAAATCTTGTGATGTGAGTG and AGTCCACTAGCTTCTGAGGTTCCC) followed by an analytical, wild-type-specific HaeIII digest.
Characterization of seedling phenotypes and leaf vascular defects
Histological preparation and microscopic inspection of seedlings and leaves
was performed as described (Berleth and
Juergens, 1993
). Mutant seedlings were cleared at 7 dag. Vascular
system features were analyzed in one of the two first rosette leaves (from
more than 20 plants) taken at 14 dag. 35S::MPAS transgenes were
maintained hemizygously in either wild-type or nph4 homozygous
background and plants carrying the transgene were selected by germination on
0.5xMS medium supplemented with 10 µg/ml L-Phosphinotricin prior to
transfer to soil and leaf analysis.
Hypocotyl elongation and cotyledon expansion auxin response assays
Seeds were germinated in the dark as described above. For auxin response
assays the medium was supplemented with 20 µM IAA (Sigma-Aldrich) unless
otherwise indicated. After 5 days at 25°C in the dark, the lengths of
hypocotyls were measured on digitally captured images. Auxin sensitivity in
this assay correlated with phototropic response in all genotypes, but
hypocotyl length could be quantified at higher resolution than hypocotyl
bending. For hemizygously maintained genotypes (35S::MPAS and certain
35S::MP lines), individually measured seedlings were subsequently
grown to maturity and genotyped by adult phenotype traits and the inheritance
of resistance to L-Phosphinotricin. Variability of hypocotyl length on
hormone-free media was not correlated to any of the genotypes in standard
t-tests.
Cotyledon expansion in light germinated seedlings was measured as described
previously (Mattsson et al.,
2003
).
Auxin-induced gene expression
Quantification of auxin-induced gene expression on northern blots was
determined in seedlings 7 days after exposure to light as previously described
(Mattsson et al., 2003
). All
northern hybridizations resulted in single bands. Probe specificity was
ensured by BLAST searches of the Arabidopsis genome sequence.
| Results |
|---|
|
|
|---|
|
ARF-Aux/IAA interaction interferes with activation by MP and NPH4
We next asked whether the similarities of the CTDs in MP and NPH4 imply
that both proteins interact similarly with a given protein of the Aux/IAA
family. A potentially biologically relevant interaction of MP and BODENLOS
(BDL)/IAA12 has previously been demonstrated in yeast two hybrid assays
(Hamann et al., 2002
). As
shown in Fig. 1A, MP and NPH4
interact equivalently with BDL in parallel yeast two hybrid assays.
In an additional set of experiments, we asked whether BDL could interfere
with MP- and NPH4-mediated gene activation in carrot protoplast transfection
assays (Ulmasov et al., 1997b
;
Tiwari et al., 2001
) and, if
so, whether this interference was specifically associated with expression of
BDL or could also be observed upon expression of other
Aux/IAA genes. IAA4 and IAA9 were selected as representative Aux/IAA
repressors along with BDL/IAA12 (see
Tiwari et al., 2001
).
Full-length cDNAs of IAA4, IAA9 and BDL/IAA12 were
co-expressed in carrot protoplasts with chimeric MP and
NPH4, in which the natural DBDs were replaced by the DBD of yeast
GAL4. Downstream gene activation was monitored through the expression of a GUS
reporter gene coupled to UAS, the GAL4 target sequence as described
(Ulmasov et al., 1999a
;
Tiwari et al., 2001
). As shown
in Fig. 1B, expression of both
chimeric MP and NPH4 leads to high reporter gene expression, further enhanced
by the application of 1-naphthalene acetic acid (1-NAA). Consistent with the
results of yeast two hybrid assays, co-expression of BDL/IAA12, a potential
negative regulator of both ARF proteins, results in a dramatic reduction of
reporter gene expression, which is partially restored upon auxin application.
Co-expression of either IAA4 or IAA9, along with either chimeric MP or NPH4,
resulted in a similar level of reporter gene repression as that observed with
BDL/IAA12. We have also tested IAA7, IAA17 and IAA19 with chimeric MP and
observed a similar amount of reporter gene repression as documented in
Fig. 1B with IAA4, IAA9 and
BDL/IAA12 (Tiwari et al.,
2003
) (S.B.T., G.H. and T.J.G., unpublished).
In conclusion, these results indicate negative regulation of both MP and
NPH4 activity by interaction with Aux/IAA co-regulators in carrot suspension
cell protoplasts and support the notion that auxin promotes ARF-dependent gene
activation by reducing the amount of these negative regulators that dimerize
with ARF activators on AuxREs (see also
Tiwari et al., 2001
;
Tiwari et al., 2003
). In the
plant cell protoplast system, little specificity of repression by Aux/IAA
proteins is observed when effector genes encoding Aux/IAA and MP or NPH4 are
co-transfected into prototoplasts (Tiwari
et al., 2003
) (Fig.
1B), suggesting that additional parameters, such as the specific
expression profiles of the interacting proteins, enhance interaction
specificity in the plant (see Discussion). A similar lack of specificity
between Aux/IAA and ARF activator interactions is seen in yeast two hybrid
assays (S.B.T., G.H. and T.J.G., unpublished).
MP and NPH4 expression domains overlap
Both scenarios, the redundant action of NPH4 and MP, e.g. as homodimers, as
well as their heterodimeric interaction in common transcriptional complexes,
depend on overlapping expression domains of both genes. To determine whether
there is overlap between the two expression domains, we visualized MP
and NPH4 mRNA at various stages of Arabidopsis development
by in situ hybridization to tissue sections.
Although the defects in nph4 mutants are restricted to sharply defined stages, NPH4 turned out to be expressed throughout the Arabidopsis life cycle. Already in heart stage embryos, NPH4 transcripts are present in all major tissue types, often somewhat more abundant in cotyledons than in the basal part of the embryo (Fig. 2A). Transcripts of NPH4 are detected throughout the embryo at all subsequent embryonic stages (Fig. 2B,C). Post-embryonically, NPH4 expression remains ubiquitous, but is generally stronger in the small, non-vacuolated cells of young organs. In vegetative leaf primordia, for example, NPH4 expression is strongest in the developing lamina as opposed to weaker expression in the outer layers of the midrib region, which are comprised of larger cells (Fig. 2D). Low-level uniform expression is also observed in the organs of all floral whorls, but there is a distinctly higher expression level in pollen, tapetum and ovules (Fig. 2E).
|
In summary, the expression domains of NPH4 and MP overlap extensively. Both genes are expressed at low levels in nearly identical domains, except that MP is additionally expressed at higher levels specifically in a central region and eventually in the vascular system.
Redundant functions of MP and NPH4
If NPH4 and MP act as homodimers (or in any other kind of transcriptional
complex comprising only one of the two ARF proteins), they may redundantly
regulate target genes. Recognizable abnormalities in nph4 mutants are
restricted to defects in hypocotyl elongation and leaf shape
(Watahiki and Yamamoto, 1997
;
Stowe-Evans et al., 1998
), but
regulatory potential of NPH4 at other stages might be masked by
MP activity. This potential should then become apparent in the
background of reduced MP activity.
To see whether phenotypes of mp; nph4 double mutants are more
severe than those of the corresponding single mutants, the precise
quantification of phenotype strengths is necessary. All mp mutants
are rootless, but a classification scheme based on vascular defects has been
used to quantify residual gene activity in mp mutant alleles
(Berleth and Juergens, 1993
).
This scheme was found to be consistent with the characteristics of molecular
lesions in mutant alleles (Hardtke and
Berleth, 1998
). For example, premature stop codons in the
C-terminal part of the activation domain are associated with a spectrum of
phenotypes, ranging from dicotyledonous seedlings with some ramified vascular
strands to single cotyledonous seedlings with no more than a short midvein
(mpG92 in Fig. 3A),
while stop codons in more N-terminal positions are associated with more
extreme reductions of the vascular system (mpG12, mpT370 in
Fig. 3A).
|
Double mutants comprising strong nph4 and mp alleles displayed further enhanced phenotype spectra (Fig. 3A). Most strikingly, double mutants comprising the phenotypically strongest alleles, nph4-1 and mpG12, failed to initiate the outgrowth of cotyledons or to align vascular cell differentiation (Fig. 3A,B). The entirely homogenous phenotype of the nph4-1; mpG12 double mutant indicates that in the absence of both gene activities the formation of new lateral organs and of continuous vascular strands is no longer possible and that therefore the limited extent of oriented differentiation in the apical region of mp single mutant embryos can be attributed to NPH4 function.
Redundant post-embryonic functions of MP and NPH4
The limited development of mp; nph4 double mutants precludes
direct tests of NPH4 function in cell patterning during
post-embryonic organogenesis. To downregulate MP activity
post-embryonically, we expressed MP antisense RNA under control of
the CaMV 35S promoter (35S::MPAS) in wild-type and nph4
mutant background. All experimental results involving 35S::MPAS lines
are based on observations in three selected lines (35S::MPAS1-3, see
details in Materials and methods).
The basic outline of Arabidopsis rosette and cauline leaf venation comprises a series of secondary vein lobes extending from the (primary) midvein and a system of higher order veins (tertiary and quarternary) within these lobes. In nph4 mutant plants, no significant vein pattern irregularities are observed. By contrast, lines carrying the 35S::MPAS construct have generally fewer higher order veins in rosette leaves. Their cauline leaves are elongated, but have an essentially normal density of higher order venation (Fig. 3C). In the nph4 mutant background, however, secondary vein lobes of all 35S::MPAS lines are drastically reduced in rosette leaves and nearly absent in cauline leaves (Fig. 3C).
In conclusion, the enhancement of 35S::MPAS phenotypes in nph4 mutant background suggests overlapping functions of both genes also in post-embryonic development.
Both NPH4 and MP are required for auxin-regulated cell expansion
In an alternative scenario, NPH4 and MP proteins could form heterodimers,
implying that a downstream process could be equally affected by loss of either
of the two gene activities. We have previously shown that MP is involved in an
auxin-controlled cell expansion process
(Mattsson et al., 2003
). When
light-germinated wild-type seedlings are exposed to auxin, the expansion of
their cotyledons is dramatically reduced
(Fig. 4A). This response to
auxin is not only compromised in mp mutants
(Mattsson et al., 2003
), but
also in nph4 mutants (Fig.
4A), suggesting that both genes are involved in auxin-controlled
cell expansion.
|
Finally, we used gene expression profiles of rapidly auxin-responsive genes
to identify regulatory events that are dependent on both transcription
factors. Both MP and NPH4 have been shown to be required for
auxin-dependent gene regulation in Arabidopsis plants
(Stowe-Evans et al., 1998
;
Mattsson et al., 2003
). As
shown in Fig. 4C, auxin-induced
expression of two primary auxin response genes, IAA2 and
IAA19, crucially depends on both MP and NPH4 gene
activity and could therefore reflect the joint regulation by both ARFs.
Functional divergence of MP and NPH4 proteins
To determine the extent to which both gene products could substitute for
each other irrespective of their relative expression profiles, we expressed
full-length cDNAs of both genes individually under control of the full-length
CaMV 35S promoter, which resulted in transcript levels 30-50 fold higher than
the normal expression levels of each gene (see Materials and methods).
High level expression of each gene normalizes the respective mutant phenotype, verifying the functionality of each of the overexpressed cDNAs. When 35S::NPH4 is expressed in the strong nph4-1 mutant, hypocotyl cell elongation is strongly responsive to auxin and vegetative leaf shape is similar to wild type (Fig. 5A,B). Expression of 35S::MP normalizes the defective vasculature in mp mutant vegetative leaves (data not shown).
|
We conclude that the joint requirement of both NPH4 and MP in the control of hypocotyl elongation in the wild-type auxin response as described above is dependent upon wild-type levels of MP expression. In 35S::MP plants, by contrast, NPH4 does not seem to be required either in the control of hypocotyl elongation or in the control of leaf shape.
Co-overexpression of MP and NPH4 results in synergistic effects
In vivo interactions of transcription factors may become apparent as
synergistic phenotypes of gain-of-function alleles, for example, as a
consequence of the physical association of specific DNA binding and activation
domains. We expressed functional cDNAs of both MP and NPH4
individually and in combination in transgenic plants and assessed their
phenotypes in at least seven independent transformants (for details see
Materials and methods).
Plants carrying the 35S::NPH4 transgene are indistinguishable from
wild-type plants during both vegetative and reproductive stages of development
(Fig. 5C). By contrast,
upregulation of MP in 35S::MP plants is associated with a
number of abnormalities primarily in the inflorescences, which produce fewer,
predominantly sterile flowers and eventually terminate in pin-shaped tips
(Fig. 5C). This observation is
interesting, because 35S::MP plants have been shown to enhance auxin
responses, whereas mp mutants display diminished auxin responses
(Mattsson et al., 2003
). The
fact that both genotypes are associated with pin-shaped inflorescences
suggests that lateral organ formation in the inflorescence meristem requires
differential auxin signaling and is obstructed by constitutively elevated as
well as reduced levels of auxin signaling. Most strikingly, co-overexpression
of both MP and NPH4 invariably results in new, extreme
phenotype traits (16/16 plants derived from crosses between two individual
primary transformants for each construct), which also severely affect
vegetative development (Fig.
5C). In plants co-overexpressing both transgenes, the formation of
rosette leaves is extremely delayed. Rosette leaves have hyponastic leaf
blades and short petioles (Fig.
5C). Both leaf blades and petioles of rosette leaves are often
twisted and very small irregular leaves are formed in older rosettes
(Fig. 5C). Inflorescence
meristems retain normal dimensions but never produce flower primordia, which
results in exclusively pin-shaped inflorescences
(Fig. 5C). Because of the
normal phenotype of 35S::NPH4 plants, the new phenotype cannot be
explained as the superimposition of defects, but as a synergistic enhancement
of the effects associated with the expression of the individual
transgenes.
We mapped the origin of the synergistic interaction of both transgenes by co-overexpressing under control of the CaMV 35S promoter regions of the MP cDNA along with the full-length NPH4 cDNA in transgenic plants (Fig. 5D). Co-overexpression of NPH4 along with a fragment comprising the MP AD and CTD but excluding the DBD (35S::MP288+, amino acids 288-902), results in plants indistinguishable from those overexpressing both full-length products (9/9plants). By contrast, no phenotypic change is associated with the co-overexpression of NPH4 together with a large proportion of the MP-coding region encompassing the DBD and the AD (35S::MP-785, amino acids 1-785) (7/7plants). These results indicate that interaction of the MP-AD with overexpressed NPH4 is essential, while MP DNA binding is dispensible for generating synergistic phenotypic effects in plant growth. (see Fig.1 and Discussion).
MP overexpression suppresses the bdl mutant phenotype
Finally, we addressed the question whether there is genetic evidence in
Arabidopsis plants for the negative interaction between an ARF and an
Aux/IAA protein. Phenotype similarity has been observed between mutants
carrying a gain-of-function mutation in BDL/IAA12, which is expected
to lead to enhanced stability and presumably abundance of the protein product,
and the phenotype of loss-of-function mutations in MP, suggesting
that BDL could negatively regulate MP activity
(Hamann et al., 2002
). If
overabundant BDL product inhibits MP function, this effect might be
suppressed by compensatory MP overexpression. The bdl mutant
is semi-dominant and homozygous mutants invariably display severe defects
during vegetative and inflorescence development. These mutants are often also
rootless and then cannot be grown on soil. To compare all genotypes under
similar growth conditions, we used only homozygous bdl mutants that
had formed roots (see Materials and methods). Rosettes of homozygous
bdl mutants consist of small, curled leaves and are not larger than
20 mm in diameter (number of rosettes greater than 20 mm in size is 0/25).
Inflorescences, if produced at all (12/25), are extremely short and do not
produce fertile flowers (fertile plants: 0/25)
(Fig. 6A). By contrast,
homozygous bdl mutants carrying one or two copies of the
35S::MP transgene are typically of normal morphology, form large
rosettes (number of rosettes greater than 60 mm is 110/129) and are usually
fertile (94/129; Fig. 6B,D).
The latter aspect is particularly interesting, because it demonstrates mutual
suppression of bdl and 35S::MP, as inflorescences of
35S::MP plants in wild-type background are semi-sterile and
phenotypically abnormal (Fig.
6C). The mutual suppression of two gain-of-function genetic
disorders as opposed to the superimposition of their phenotypic defects is
remarkable as it indicates a highly specific antagonistic interaction of both
proteins in a variety of developmental contexts (see Discussion).
|
| Discussion |
|---|
|
|
|---|
MP and NPH4 functions in axial patterning
Auxin signals have been genetically implicated in the formation of the
apicobasal axis of the embryo (reviewed by
Juergens, 2001
;
Paquette and Benfey, 2001
;
Berleth and Chatfield, 2002
),
the organized outgrowth of lateral organs
(Reinhardt et al., 2000
), cell
patterning in the root meristem (reviewed by
Scheres, 2000
) and continuous
vascular differentiation (reviewed by
Sachs, 1991
). These four
patterning processes, to which we refer here as axial patterning, seem to have
a common derivation in defective responses to polar auxin signals and are
collectively disturbed in previously characterized auxin-insensitive embryo
mutants (Hardtke and Berleth,
1998
; Hamann et al.,
1999
; Hobbie et al.,
2000
). The overlap of MP and NPH4 gene functions
in axial patterning is asymmetrical. Both genes have the capacity to relay
auxin signals that are required for proper patterning at early stages of organ
development, but the corresponding regulatory potential of NPH4 is
masked in the presence of MP wild-type activity. The phenotype
distributions in all allelic combinations show that the contributions of the
MP and NPH4 genes to embryo patterning differ
quantitatively, but clearly affect the same process. No new phenotype classes
are observed in double mutants. Instead, the spectra of phenotypes of all
mp mutant alleles are shifted towards more severe distributions, when
analyzed in double mutant combination with nph4 mutants. With the
strong mp; nph4 double mutant, we describe a genotype in which all
four processes are nearly obstructed. Moreover, this genotype is associated
with a remarkably invariant seedling phenotype, indicating that residual axial
patterning and phenotype variability in strong mp mutants is largely
due to NPH4 activity.
The nearly obstructed axial differentiation in mp; nph4 double
mutants leaves very little room for potential further redundant functions of
other ARF genes in embryo axis formation. Their contribution could be
extremely subtle. Alternatively, they could act non-redundantly with
associated strong phenotypes, which for some reason have not been identified
in saturating screens for seedling pattern mutants
(Mayer et al., 1991
). Finally,
the functions of most other ARFs could be restricted to stage-specific
processes rather than affecting general patterning properties of plant
cells.
MP and NPH4 functions in auxin-responsive cell expansion
Although NPH4 acts redundantly with MP in vascular
development, NPH4 has non-redundant functions in other processes,
such as the regulation of auxin-inducible genes or in auxin-controlled
cotyledon and hypocotyl expansion. Interestingly, the fact that MP
cannot substitute for NPH4 activity in these processes does not mean
that MP is not involved in their regulation. Instead, MP and NPH4
similarly regulate a number of auxin-inducible genes and cell expansion
processes. The joint requirement for both MP and NPH4
(Fig. 4), in conjunction with
evidence for physical interaction between the two proteins in yeast cells
(Fig. 1), could reflect their
integration into heteromeric complexes regulating these auxin responses.
It is important to recognize that the evidence for a joint requirement of
MP and NPH4 in the control of cell expansion is entirely
based on loss-of-function data and therefore reflects the genuine activities
of both genes. Observations in gain-of-function genotypes confirm the
potential of MP to function in auxin-controlled cell expansion, but
further show that, when overexpressed, MP acquires the capacity to
autonomously control a process that it normally controls in conjunction with
NPH4. In normal development, therefore, the level of MP
expression must be strictly limited to provide a role for NPH4. As
the ARF gene family seems to be remarkably conserved
(Sato et al., 2001
), it will
be interesting to see whether the same functional relationship between the two
genes is observed in other species. Evolutionary conserved dimerization of MP
and NPH4 in cell expansion responses could make regulatory sense. In a
possible analogy to the recently proposed `potentiation' mechanism
(Tiwari et al., 2003
), MP and
NPH4 could form a heterodimer, in which the obligatory involvement of NPH4
would allow for certain regulatory inputs, while MP could potentiate the auxin
response through its strong, autonomous gene activation properties. Several
observations suggest a strong, autonomous gene activation capacity of MP.
First, MP overexpression leads to enhanced auxin-responsive gene
expression of downstream genes, suggesting that the MP product is the
limiting factor in their regulation
(Mattsson et al., 2003
).
Second, MP overexpression, but not NPH4 overexpression leads
to morphological abnormalities. Third, overexpression of only the MP AD-CTD
along with NPH4 leads to dramatic morphological abnormalities, suggesting that
MP AD, when associated with NPH4 can trigger gene expression that is not
triggered by NPH4 overexpression alone.
Interaction with Aux/IAA genes
ARF activity is believed to be negatively regulated by interaction with
nuclear co-regulators of the Aux/IAA class (reviewed by
Hagen and Guilfoyle, 2002
;
Liscum and Reed, 2002
;
Leyser, 2002
). Mutations in
Aux/IAA genes with marked phenotypes are usually dominant mutations
in the distinct, conserved domain II, and as far as investigated in detail are
associated with increased protein stability and thereby increased abundance of
the gene product (Worley et al.,
2000
; Ouellet et al.,
2001
). Presently, it is not clear to what extent these dominant
mutations reflect the wild-type activities of the respective genes. A domain
II gain-of-function mutation in a single Aux/IAA gene,
BDL/IAA12, has been reported to interfere with pattern formation in
the early embryo (Hamann et al.,
1999
). This may indicate that BDL negatively regulates
MP or genes in the same pathway, and it has recently been
demonstrated that BDL interacts with MP in yeast
(Hamann et al., 2002
).
Experimentally confirmed interaction, however, leaves unresolved the issue of
whether MP and BDL interact antagonistically throughout
development and whether MP is a predominant target of negative
regulation by BDL at all stages. The fact that the elevated
expression of MP combined with the expression of mutant, probably overabundant
BDL protein, leads to a striking restoration of normal morphology documents
that both proteins interact with remarkable precision at several stages during
Arabidopsis development. The restoration of normal morphology in the
seedling, in vegetative development and in the complex organization of the
inflorescence is not what one would normally expect as the result of the
superimposition of two gain-of-function genetic distortions, because it
implies the exact compensation of the abnormal regulatory influences in many
processes, suggesting that the antagonism of both proteins is part of their
normal function.
How can this precise compensatory interaction of MP and
BDL (Fig. 6) be
reconciled with the apparent lack of selectivity in ARF-Aux/IAA interactions
(Fig. 1B)? One possibility is
that the selectivity of interaction in the phenotypically relevant sites in
the plant is higher than in the transient expression system. Alternatively or
additionally, the interaction may in fact not be exclusive. MP may interact
with several Aux/IAA proteins and BDL with several ARF proteins. However, all
interactions would involve only ARF and Aux/IAA genes that
act redundantly during the patterning stages early in organ development. For
example, BDL may negatively interact also with NPH4 in embryo patterning,
which would become apparent only under conditions of reduced MP activity. This
seems to be indeed the case, as mp; bdl double mutants have been
reported to cause an enhancement of the mp phenotype, including the
formation of cotyledon-less seedlings
(Hamann et al., 1999
). These
defects are reminiscent of those in mp; nph4 double mutants,
consistent with a negative regulation of NPH4 by BDL
(Fig. 1). It remains to be seen
how many Aux/IAA proteins are expressed in early organ primordia, but there is
the possibility that many or all of those could interfere with axial
patterning as interchangeable, purely quantitative regulators of MP
and NPH4 activity.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Abel, S. and Theologis, A. (1996). Early genes and auxin action. Plant Physiol. 111, 9-17.[CrossRef][Medline]
Beeckman, T., Przemeck, G. K., Stamatiou, G., Lau, R., Terryn,
N., de Rycke, R., Inze, D. and Berleth, T. (2002). Genetic
complexity of cellulose synthase A gene function in Arabidopsis
embryogenesis. Plant Physiol.
130,1883
-1893.
Berleth, T. and Juergens, G. (1993). The role of the monopteros gene in organising the basal body region of the Arabidopsis embryo. Development 118,575 -587.[Abstract]
Berleth, T. and Chatfield, S. (2002). Pattern formation during embryogenesis. In The Arabidopsis Book (ed. C.R. Somerville and E.M. Meyerowitz). Rockville: American Society of Plant Biologists. http://www.aspb.org/publications/arabidopsis
Clough, S., and Bent, A. (1998). Floral dip: a simplified method for transformation of Arabidopsis. Plant J. 16,735 -743.[CrossRef][Medline]
Cutler, S. R., Ehrhardt, D. W., Griffitts, J. S. and Somerville,
C. R. (2000). Random GFP::cDNA fusions enable visualization
of subcellular structures in cells of Arabidopsis at a high
frequency. Proc. Natl. Acad. Sci. USA
97,3718
-3723.
Davies, P. J. (1995). Plant Hormone Physiology, Biochemistry and Molecular Biology. Dordrecht: Kluwer.
Dharmasiri, S. and Estelle, M. (2002). The role of regulated protein degradation in auxin response. Plant Mol. Biol. 49,401 -409.[CrossRef][Medline]
Estelle, M. (1992). The plant hormone auxin: insight in sight. BioEssays 14,439 -444.[CrossRef][Medline]
Gray, W. M., Kepinski, S., Rouse, D., Leyser, O. and Estelle, M. (2001). Auxin regulates SCF TIR1-dependent degradation of Aux/IAA proteins. Nature 414,271 -276.[CrossRef][Medline]
Guilfoyle, T. J. and Hagen, G. (2001). Auxin response factors. J. Plant Growth Reg. 10,281 -291.[CrossRef]
Guilfoyle, T., Hagen, G., Ulmasov, T. and Murfett, J.
(1998). How does auxin turn on genes? Plant
Physiol. 118,341
-347.
Hagen, G. and Guilfoyle, T. (2002). Auxin-responsive gene expression: genes, promoters and regulatory factors. Plant Mol. Biol. 49,373 -385.[CrossRef][Medline]
Hamann, T., Mayer, U. and Juergens, G. (1999). The auxin-insensitive bodenlos mutation affects primary root formation and apical-basal patterning in the Arabidopsis embryo. Development 126,1387 -1395.[Abstract]
Hamann, T., Benkova, E., Baurle, I., Kientz, M. and Juergens,
G. (2002). The Arabidopsis BODENLOS gene encodes an
auxin response protein inhibiting MONOPTEROS-mediated embryo patterning.
Genes Dev. 16,1610
-1615.
Hardtke, C. S. and Berleth, T. (1998). The Arabidopsis gene MONOPTEROS encodes a transcription factor mediating embryo axis formation and vascular development. EMBO J. 17,1405 -1411.[CrossRef][Medline]
Hardtke, C. S., Gohda, K., Osterlund, M. T., Oyama, T., Okada, K. and Deng, X. W. (2000). HY5 stability and activity in Arabidopsis is regulated by a phosphorylation within its COP1 binding domain. EMBO J. 19,4997 -5006.[CrossRef][Medline]
Harper, R. M., Stowe-Evans, E. L., Luesse, D. R., Muto, H.,
Tatematsu, K., Watahiki, M. K., Yamamoto, K. and Liscum, E.
(2000). The NPH4 locus encodes the auxin response factor
ARF7, a conditional regulator of differential growth in aerial
Arabidopsis tissue. Plant Cell
12,757
-770.
Hobbie, L., McGovern, M., Hurwitz, L. R., Pierro, A., Liu, N. Y., Bandyopadhyay, A. and Estelle, M. (2000). The axr6 mutants of Arabidopsis thaliana define a gene involved in auxin response and early development. Development 127, 23-32.[Abstract]
Juergens, G. (2001). Apical-basal pattern formation in Arabidopsis embryogenesis. EMBO J. 20,3609 -3616.[CrossRef]