|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 18 February 2004
doi: 10.1242/dev.01010
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Biochemistry and Molecular Biology, The University of Texas M.
D. Anderson Cancer Center, Houston, TX 77030, USA
2 Department of Biology and The Laboratory for Functional Genomics, Texas
A&M University, College Station, TX 77843-3285, USA
3 Department of Biomathematics, The University of Texas M. D. Anderson Cancer
Center, Houston, TX 77030, USA
4 Department of Molecular Genetics, The University of Texas M. D. Anderson
Cancer Center, Houston, TX 77030, USA
* Author for correspondence (e-mail: wklein{at}mdanderson.org)
Accepted 27 November 2003
| SUMMARY |
|---|
|
|
|---|
Key words: POU domain transcription factor, Brn3b/Brn-3.2/POU4f2, Mouse embryonic retina, Microarray gene expression profiling
| Introduction |
|---|
|
|
|---|
Despite this wealth of information, fundamental questions concerning POU
domain proteins and their roles in neuronal differentiation have not been
answered. To date there is no clear understanding of the position of
individual POU domain factors in the gene regulatory network operating within
any differentiating neuronal cell type. Although in some cases particular
upstream and downstream genes have been identified
(Bermingham et al., 2002
;
Erkman et al., 2000
;
Mu et al., 2001
;
Wagner et al., 2002
), we have
yet to achieve a clear picture of how POU domain proteins alter the
transcriptional states of neuronal cells. We do not even know the number of
genes in a particular neuronal cell type that depend on an individual POU
factor for their expression. Because the transcriptome of any neuronal cell
type consists of thousands of expressed genes, POU domain factors could be
associated with a wide spectrum of gene expression involving many different
functional gene classes. Alternatively, POU factors could act in more subtle
fashions, causing changes only in a limited number of functional gene classes,
leaving most of the transcriptome unaltered.
We have made use of the retinal ganglion cell (RGC)-specific POU domain
transcription factor Brn3b/Brn-3.2/POU4f2 to address issues of POU domain
protein function in neuronal cells. In the mouse, Brn3b
(Pou4f2 - Mouse Genome Informatics) is first expressed at E11.5 in
newly forming RGCs that have recently exited the cell cycle, and although not
required for the initial specification of RGCs, Brn3b is essential for normal
RGC differentiation, axonal outgrowth and survival
(Erkman et al., 1996
;
Erkman et al., 2000
;
Gan et al., 1999
;
Gan et al., 1996
;
Wang et al., 2000
). Two
related Brn3 factors, Brn3a and Brn3c, also play roles in RGC differentiation
(Wang et al., 2002a
) (S. W.
Wang, unpublished), although only Brn3b-knockout mice produce a
detectable RGC phenotype. Thus, Brn3b can be used to identify sets of genes
that depend on a POU domain transcription factor for their expression.
Several genes whose expression in the retina is affected by the absence of
Brn3b have been previously identified
(Erkman et al., 2000
;
Mu et al., 2001
), but given
the limited scope of these reports, these genes are unlikely to represent the
full spectrum of Brn3b function. We previously described the construction of a
large database of retina ESTs from E14.5 retinas and a pilot microarray
analysis using 864 cDNAs to screen for gene expression alterations in
Brn3b-/- retinas (Mu
et al., 2001
). We continue to expand our database, which currently
contains over 27,000 retina-expressed cDNAs representing
15,000 distinct
genes
(http://odin.mdacc.tmc.edu/RetinalExpress).
We estimate that the RetinalExpress database currently contains 60-70% of the
genes expressed in the E14.5 retina (Mu et
al., 2001
).
The embryonic retina represents a tiny proportion of all the tissues that
form during the life of a mouse. We have argued that retinal genes highly
restricted in their expression will generally be underrepresented in public
databases and on commercially available mouse microarrays
(Mu et al., 2001
). For
example, we have identified numerous genes that are present in the
RetinalExpress database but not in the 15K NIA or 61K RIKEN mouse EST
databases (Mu et al., 2001
).
Thus, RetinalExpress provides a suitable platform to generate high-density
microarrays for use in identifying Brn3b-dependent genes. Below, we describe
the identification of Brn3b-dependent genes by comparing expression profiles
of wild-type and Brn3b-/- retinas using microarrays
containing 18,816 retina-expressed cDNAs. We find that highly restricted sets
of functional gene classes depend on Brn3b for their expression, including
genes that are expressed in non RGCs within the retina. Our results
demonstrate that Brn3b controls a small but crucial fraction of the E14.5
retinal transcriptome.
| Materials and methods |
|---|
|
|
|---|
Fabrication and processing of retina-expressed cDNA microarray slides
cDNA clones were obtained from the sequenced E14.5 retinal cDNA library.
Information on these clones can be found in the RetinalExpress database
(http://odin.mdacc.tmc.edu/RetinalExpress).
Gene identity of the clones was based mostly on Blastx search results. cDNA
inserts from individual clones were amplified in 96-well plates using the T3
and T7 primers as described (Mu et al.,
2001
). The amplified inserts were purified semi-automatically with
the MultiScreen PCR purification system (Millipore) on a Biomek 2000 robotic
workstation. To each sample, 20xSSC was added to a final concentration
of 3x. The microarrays were printed on PL-100C poly-L-lysine glass
slides (CEL Associates) with the OmniGrid microarrayer (Genemachine). A total
of 18,816 clones were printed on two slides, and each clone was printed in
duplicate. The microarray slides were processed by rehydration and
snap-heating, followed by incubation at 80°C for 1.5 hours to crosslink
the DNA to the slide surface. The DNA on the slides was then denatured in a
95°C water bath for 2 minutes, rinsed with ethanol and air dried.
Probe labeling and microarray hybridization
aRNA was labeled by direct incorporation of Cy3- or Cy5-dUTP (Amersham)
through reverse transcription by SSII (Invitrogen) with 2 or 4 µg of aRNA
and 6 µg random primers (Invitrogen) in 30 µl of RT reaction mix (500
µM concentrations of dCTP, dATP and dGTP; 100 µM dTTP, 100 µM
Cy3-dUTP or Cy5-dUTP; 400 U SSII; 1 mM DTT; and 1xRT buffer) at 37°C
for 2 hours. The RT reactions were terminated, and RNA degraded by addition of
1.5 µl of 0.5 N NaOH and 1.5 µl of 20 mM EDTA (pH 8.0) and heating at
70°C for 10 minutes, followed by addition of 1.5 µl of 0.5 N HCl for
neutralization. The Cy3- and Cy5-labeled probes were purified by GFX columns
(Amersham Pharmacia) according to the manufacturer's manual, air dried in a
SpeedVac, and resuspended in 15 µl of microarray hybridization buffer (see
below) and combined.
Microarray hybridization basically followed the TIGR protocol
(Hegde et al., 2000
) with
minor modifications. The slides were first incubated in pre-hybridization
buffer (5xSSC, 0.1% SDS and 1% BSA) at 42°C for 1 hour, followed by
sequential rinsing in milliQ water and isopropanol and air dried. The 30 µl
Cy3- and Cy5-probe mix in 1xhybridization buffer [50% formamide,
5xSSC, 0.1% SDS, 10 µg poly d(A) (Pharmacia) and 10 µg mouse Cot 1
DNA (Invitrogen)] was applied to the microarray slide and covered with
HybriSlips (PGC Scientific). Hybridization reactions were carried out in
Corning hybridization chambers in a water bath at 42°C overnight. The
slides were then washed as follows: 1xSSC, 0.2% SDS at 42°C for 10
minutes; 0.1xSSC, 0.2% SDS at room temperature for 10 minutes; and
0.1xSSC at room temperature for 4 minutes. The slides were air dried and
scanned with a GenPix 4000A scanner (Axon) with PMT settings of 500 to
650.
Microarray data collection and analysis
For each hybridized slide, two 16-bit TIFF images representing the Cy3 and
Cy5 channels were obtained. The median values of Cy3 and Cy5 signals for
individual spots were than obtained with GenPix Pro 4.0 from the TIFF images.
The raw data were Lowess normalized
(Quackenbush, 2002
) and
further analyzed with Genespring 5.0 (Silicon Genetics). For normalization, a
Lowess curve was fit to the log-intensity versus log-ratio plot. Twenty
percent of the data were used to calculate the Lowess fit at each point. This
curve was used to adjust the control value for each measurement. If the
control channel was lower than 10, then 10 was used instead. Significance of
differentially expressed genes was analyzed by Student's t-test with
Genespring 5.1.
To compare gene expression changes between different developmental stages, genes with significant changes in all stages (E14.5, E16.5 and E18.5) were combined and the average values for replicate experiments were used to create a clustering gene tree using GeneSpring 5.1 based on similarity of gene expression patterns, which was determined by using the standard correlation and program defaults for separation ratio and minimum distance.
Real-time PCR and data analysis
Real-time PCR was performed on an iCycler (BioRad). Four micrograms of
total RNA was first reverse transcribed with SSII and oligo dT primer in a
total volume of 20 µl for 2 hours at 42°C. SSII was inactivated by
heating at 75°C for 15 minutes, The cDNA was diluted 10 fold, and 1-5
µl was used for each 50 µl PCR using the iQ SYBR Green Supermix
(BioRad). The primer sequences can be found in the supplemental data (see
Table S1 at
http://dev.biologists.org/supplemental.
The PCR conditions for all genes were as follows: preheating, 95°C for 3
minutes; cycling, 40 cycles of 94°C for 30 seconds and 50°C for 30
seconds; and 72°C for 40 seconds. For each gene, the real-time PCR assay
was performed twice with two different batches of total RNA. The ß-actin
gene served as an RNA input control.
Fold changes of gene expression were calculated based on the cycle
differences between wild-type and Brn3b-/- samples as
compared to the ß-actin control using the following formula:
FC=2
MT-
WT, where FC is fold change,
MT is the
difference of cutoff cycles between the gene of interest and the control gene
(ß-actin) for the Brn3b-/- and
WT is
that for wild type.
In situ hybridization
Purified PCR products containing T3 and T7 primer sequences (see above) for
genes of interest were used as templates, and DIG-labeled antisense RNA probes
were made by in vitro transcription with T7 RNA polymerase (Ambion) and
purified by ethanol precipitation. Heterozygous and
Brn3b-/- embryos were collected at E14.5, fixed with 4%
paraformaldehyde, paraffin-embedded, and sectioned at 6 µm. The sections
were de-waxed and treated with proteinase K. For each gene, sections from
littermates with different genotypes were used, and hybridization was
performed side by side. Efforts were made to use sections from similar section
planes for individual genes. Hybridization incubations were carried out in
hybridization buffer [50% formamide, 5xSSC (pH 4.5-5.0), 1% SDS, 50
µg/ml yeast tRNA, 50 µg/ml heparin] at 65°C overnight, followed by
three 30-minute washes with pre-warmed washing buffer [50% formamide,
1xSSC (pH 4.5-5.0), 1% SDS] at 65°C. The slides were then incubated
with alkaline phosphatase-conjugated anti-DIG antibody (Roche) in 1xMABT
(100 mM maleic acid, 150 mM NaCl, 0.1% Tween 20, pH 7.5), 2% BRB (Roche) and
10% goat serum overnight at room temperature. After being washed five times
(30 minutes each) with MABT buffer and once with NTMT [100 mM Tris-HCl (pH
9.5), 100 mM NaCl, 50 mM MgCl2, 0.1% Tween 20 and 0.048%
levamisole], hybridization signals were visualized by incubating with BM
Purple (Roche) at room temperature for the desired time. The slides were then
counterstained with eosin and photographed.
Electrophoretic mobility shift assay
EMSA with GST-3bPOU was performed as described
(Gruber et al., 1997
). For
supershift, 1 µl of anti-GST antibody (Promega) was added to the binding
reaction. The sequences for the SBRN3 probe were: 5'
GCACACGACCCAATGAATTAATAACCGGGCTG 3' and 5'
GCAGCCCGGTTATTAATTCATTGGGTCGTGTG 3'. The Brn3 consensus competitor
oligonucleotide sequences were: 5' GATCTCTCCTGCATAATTAATTACCCCCGGAT
3' and 5' GATCCGGGGGTAATTAATTATGCAGGAGAGAT 3'.
Cell culture, cell transfection and luciferase assay
HEK 293 cells were cultured in DMEM with 10% FBS at 37°C with 5%
CO2. To generate the luciferase reporter construct, the conserved
sonic hedgehog region in the first intron was amplified by PCR from
mouse genomic DNA and inserted upstream of the minimal rat prolactin promoter
(-36prl) driving firefly luciferase expression
(Trieu et al., 1999
). A mutant
version of this Shh reporter construct was made by PCR, mutating all
the essential nucleotides in the Brn3b-binding site from
ATGAATTAAT to
GCGCGTTGAC. The Brn3b expression
construct was made by placing the Brn3b cDNA under the control of the
CMV promoter. Transfection was carried out in six-well plates using FuGene
(Roche) following the manufacturer's protocol. For each transfection, 10 ng of
reporter plasmid, 1 µg of Brn3b expression plasmid or empty vector, and 1
ng of pRL-CMV (Promega) expressing Renilla luciferase was used. Cells
were harvested 36 hours after transfection, and luciferase activity was
measured by the Dual-Luciferase Reporter Assay System (Promega). The firefly
luciferase activity was normalized to Renilla luciferase
activity.
| Results |
|---|
|
|
|---|
Three pairs of wild-type and Brn3b-/- antisense RNA (aRNA) samples amplified from independent retinal total RNA preparations were labeled by reverse transcription with Cy3 or Cy5 dyes; duplicate experiments were performed for each pair either by exchanging the labeling dye (two pairs) or varying the amount of probe (one pair). In total, six different experiments were performed with replicate microarrays containing 18,816 retina-expressed cDNAs. In all cases, greater than 90% of the spotted cDNAs yielded signals above background. In rare occurrences, dye exchange led to significant differences between wild-type and Brn3b-/- signals but these were discounted. After Lowess normalization with Genespring 5.0, the ratio of wild-type to mutant signal was obtained for each cDNA spot in all six experiments. cDNA clones with ratios or inverse ratios of 1.7 or higher in at least four experiments were considered to represent significant changes in expression as measured by Student's t-test (Table 1). We chose 1.7-fold change as our empirical cut-off because smaller cut-off values greatly increase the number of false-positive clones.
|
The replicate experiments were highly reproducible with only minor
variation from one experiment to the next. This suggested that most of the
genes represented on the microarray and dependent on Brn3b for their normal
levels of expression were identified in the analysis. In addition, because the
cDNAs spotted on the microarray represented
50% of all E14.5
retina-expressed genes, we expect that additional Brn3b-dependent genes will
be identified when more cDNAs are added to the microarray. In fact, we
identified three genes not present on the existing microarrays based on their
relationships to genes found in the present analysis
(Table 1, see below).
A subset of genes showing 1.7 fold or greater differences in expression
levels between wild type and Brn3b-/- retinas were
subjected to real-time PCR analysis. Real-time PCR plots for 14 representative
examples are displayed in Fig.
1, and fold changes for 28 genes are summarized in
Table 1. The ratios ranged from
>80-fold underexpressed in the case of sonic hedgehog
(Shh) to fourfold overexpressed in the case of Dlx1. In
general, the fold changes observed by real-time PCR tended to be larger than
those from the microarray experiments, probably because of the limited dynamic
range of the microarray hybridization
(Livesey et al., 2000
).
|
Brn3b-dependent genes encoding transcription factors
Genes encoding transcription factors that were identified in the microarray
analysis as underexpressed in Brn3b-/- retinal RNA were
Olf1/Ebf1, Brn3a, Irx2, Gli1 and ubiquitous Krupple-like factor.
Transcription factor genes that were overexpressed were Dlx1, Dlx2,
and thyroid receptor-ß (TR-ß). With the exception of the
gene encoding ubiquitous Krupple-like factor, about which very little is
known, the identified genes all have known or postulated roles in the
retina.
Olf-1/Ebf1 belongs to a bHLH transcription factor family that also includes
Olf2/Ebf2 and Olf-3/Ebf3. The genes encoding these factors are expressed in
many post-mitotic neurons during development, including RGCs, suggesting they
have a role in neuronal differentiation
(Dubois and Vincent, 2001
).
However, elucidation of their function has been hindered by the potential
overlap of the three genes (Dubois and
Vincent, 2001
).
Brn3a is likely to be a direct target of Brn3b because brn3a
expression in RGCs immediately follows that of Brn3b and the
Brn3a promoter has Brn3 DNA-binding sites that can stimulate reporter
gene transcription when co-transfected into tissue culture cells with Brn3b
(Trieu et al., 1999
). Although
Brn3a-/- retinas appear to be normal, Brn3a-Brn3b
double knockout mice exhibit a more severe RGC phenotype than do
Brn3b-/- mice, suggesting that Brn3a partially compensates
for the loss of Brn3b (S. W. Wang, unpublished).
Irx2 is one of six members of a mammalian homeobox family related
to the Drosophila genes of the iroquois complex. Another
member, Irx6, which was not included in our array set, has been
previously identified as a Brn3b-dependent gene
(Erkman et al., 2000
). All six
Irx genes are expressed in RGCs during development, but their roles in RGC
differentiation are unclear (Cohen et al.,
2000
; Mummenhoff et al.,
2001
). A recent report suggests that Irx4 is involved in RGC axon
pathfinding within the retina through regulating Slit1 expression
(Jin et al., 2003
). Not all
Irx genes depend on Brn3b for their expression in RGCs; we observed no
alterations in expression of Irx5, a cDNA that was represented on the
retinal cDNA microarray.
Dlx1 and its closely linked relative Dlx2 are homologs of
the Drosophila homeobox gene distal-less, and they function
to downregulate the Notch signaling pathway in neuronal specification and
differentiation of the telencephalon (Yun
et al., 2002
). The strong upregulation of Dlx1 in the
absence of Brn3b prompted us to examine the expression of Dlx2, which
is linked to Dlx1 and may be co-regulated with Dlx1 through
common cis-regulatory elements (Panganiban
and Rubenstein, 2002
). Like Dlx1, we found that
Dlx2 was also overexpressed in Brn3b-/- RNA
(Table 1;
Fig. 1). The Notch pathway is
crucial for patterning the vertebrate retina and negatively regulating RGC
formation (Austin et al., 1995
;
Dorsky et al., 1995
). It is
possible that Brn3b is involved in controlling RGC number by negatively
regulating Dlx1 and Dlx2. If this were true, Dlx1
and Dlx2 expression should be upregulated in
Brn3b-/- RGCs at E14.5. In situ hybridization of sections
from Brn3b+/- and Brn3b-/- E14.5
embryos showed that Dlx1 expression was much higher in
Brn3b-/- retinas than in Brn3b+/-
retinas (Fig. 2B), supporting
the view that Brn3b negatively controls Dlx1 expression. Notably,
Dlx1 expression was higher in progenitor cells as well as RGCs
(Fig. 2B), suggesting that the
action of Brn3b might be indirect (see below).
|
Brn3b-dependent genes encoding proteins associated with neuron integrity and function
Consistent with the axonal defects of Brn3b-/- RGCs, a
battery of neuron-specific cytoskeletal/structural genes were downregulated in
Brn3b-/- retinas (Table
1; Fig. 2C). The
genes encode neurofilament light chain (Nfl), neurofilament middle chain
(Nfm), Tau and persyn. Nfl and Nfm are embryonically expressed proteins that
form neurofilaments with the postnatally expressed neurofilament heavy chain
(Nfh) (Julien, 1999
). Tau is a
neuron-specific microtubule-associated protein
(Garcia and Cleveland, 2001
).
Persyn (also known as synuclein-
) belongs to the synuclein family and
its gene had the most pronounced reduction in expression in the microarray
analysis with a ratio of wild-type to mutant expression of 13.6
(Table 1; Fig. 1,
Fig. 3C). The other two members
of the family, synuclein-
and synuclein-ß, are presynaptic
proteins that have been implicated in synaptic function and Alzheimer's
disease (Lavedan, 1998
),
whereas persyn is localized throughout the cell and appears to associate with
neurofilament proteins. Overexpression of persyn disturbs the integrity of the
neurofilament network (Buchman et al.,
1998
).
|
Only a subset of neuron-specific cytoskeletal/structural proteins were
identified by our analysis despite the presence of many other neuron-specific
genes represented on the microarray. For example, the gene encoding
neurofilament 66 (Nf66, also known as
-internexin) is expressed
specifically in RGCs of the retina
(Levavasseur et al., 1999
),
but Nf66 expression levels were unaffected by the absence of Brn3b
(Fig. 2A). Because
Nf66 expression served as a marker for the presence of RGCs,
comparable levels of Nf66 transcripts in Brn3b heterozygous
and homozygous mutant E14.5 retinas further confirmed that, at this
developmental time, RGC number was not significantly reduced in
Brn3b-/- retinas compared with heterozygous controls
(Fig. 2A).
In addition to genes encoding neuron-specific cytoskeletal/structural
proteins, two genes encoding proteins associated with axon guidance were found
to be dependent on Brn3b for their normal expression: neuropilin 1 and Gap43
(Table 1;
Fig. 1,
Fig. 2C). Although our
retina-expressed cDNA microarray included genes for several classes of axon
guidance ligands and their receptors, only the genes encoding neuropilin 1 and
Gap43 were significantly downregulated in Brn3b-/-
retinas. Neuropilin 1 complexes with plexins to serve as receptors for class
III semaphorins (He et al.,
2002
). Neuropilin 1 has been implicated in RGC axon guidance at
both the optic disc and optic chiasm in Xenopus
(Campbell et al., 2001
). Gap43
also functions in RGC axons at the optic chiasm. Downregulation of the two
axon guidance genes is consistent with the pathfinding defects observed in
Brn3b-null RGC axons (Erkman et
al., 2000
; Wang et al.,
2002a
).
Axon guidance and the establishment of the axonal cytoskeletal network are
two inseparable aspects of axon growth during neuron development. Growing
axons respond to guidance cues by remodeling the cytoskeleton at growth cones
(Grunwald and Klein, 2002
).
Our results suggest that Brn3b plays a central role in both aspects of RGC
axon growth by regulating the expression of a subset of the critical
genes.
Expression of Brn3b persists in RGCs throughout adult life,
suggesting that it might also function to regulate genes involved in RGC
physiologic integrity. This idea was supported by the identification of
several Brn3b-dependent genes involved in physiological processes. These
include genes encoding two neurotransmitter proteins Eaat2/Glut1 and Vmat2
(Table 1;
Fig. 1). Eaat2/Glut1 is a
Na+/K+-dependent glutamate transporter belonging to the
plasma membrane neurotransmitter transporter family, and Vamt2 is a vesicular
monoamine transporter of the vesicular neurotransmitter transporter family
(Masson et al., 1999
). Both
play important roles in synaptic signal transduction.
Three other genes that depended on Brn3b for their normal expression appear
to be associated with RGC function. These genes encode synaptotagmin 4,
synaptotagmin 13 and calpactin (Table
1; Fig. 1, Fig. 2C). Most members of the
synaptotagmin family are calcium sensors for neurotransmitter release at
synapses (O'Connor and Lee,
2002
). However, synaptotagmin 13 lacks the key amino acid residues
required to bind Ca2+ ion (von
Poser and Sudhof, 2001
), while synaptotagmin 4 is mostly localized
within the cell body and growth cones, suggesting that this protein may have
nonsynaptic functions, perhaps in neurite growth
(Ibata et al., 2002
).
Calpactin forms complexes with many proteins at the plasma membrane. Calpactin
is a subunit of annexin II, which functions in neurite growth
(Hamre et al., 1995
), and it
is also an auxiliary protein that associates with two different ion channels
(Girard et al., 2002
;
Okuse et al., 2002
). Calpactin
thus appears to have both differentiation and physiological functions.
We identified several Brn3b-dependent genes whose expression was not
restricted to neuronal cells but nonetheless were likely to participate in
retinal function. Cyclin D1, the only cell cycle gene to be identified in the
microarray analysis, was significantly downregulated in the absence of Brn3b
(Table 1;
Fig. 1, Fig. 2B). Cyclin D1, which
promotes progression through the G1 phase of the cell cycle, is
abundantly expressed in the E14.5 retina, and is required in the retina for
cell proliferation and photoreceptor cell survival
(Dyer and Cepko, 2001
;
Ma et al., 1998
). Cyclin D1
was expressed mostly in progenitor cells in Brn3b heterozygous
retinas at E14.5 and its expression was uniformly reduced in
Brn3b-null retinas (Fig.
2B). This result suggests that Brn3b can influence progenitor cell
proliferation through cyclin D1. As with Dlx1 and Gli1 (see
below), the influence of Brn3b on cyclin D1 expression in non RGCs must be
indirect.
Hermes is an RNA-binding protein that is strongly downregulated in the
absence of Brn3b (Table 1;
Fig. 1,
Fig. 2C). It is expressed in
the developing heart and in RGCs of the retina, but its function is currently
not known (Gerber et al.,
1999
). In RGCs, it may participate in the localization of mRNAs
whose encoded proteins are required for normal neurite growth and
function.
We also identified a number of uncharacterized genes whose normal expression levels depend on Brn3b (Table 1). Although the roles that these genes play in the retina have not yet been elucidated, some of them would be expected to be RGC-specific and have novel retinal functions. For example, we identified a cDNA, Rgcg1, that is identical to the RIKEN mouse cDNA 1810041L15 (Accession Number, XM_205822). The Rgcg1 gene encodes a predicted 15.9 kDa protein with no recognizable motifs, but an orthologous Rgcg1 exists in the human genome. Fig. 3A shows that in wild-type sections, Rgcg1 was expressed specifically in RGCs within the retina and in the olfactory epithelium. In Brn3b-/- sections, expression of Rgcg1 was largely absent in RGCs but was undisturbed in the olfactory epithelium (Fig. 3A). These results identify a new RGC-specific gene and also demonstrate that Brn3b-dependent genes can be expressed outside the retina by mechanisms independent of Brn3b. Below, we discuss further examples of Brn3b-independent expression.
Brn3b-dependent genes encoding secreted signaling molecules
The microarray analysis unexpectedly revealed that the gene encoding
myostatin/Gdf8, a member of the TGF-ß superfamily, was significantly
underrepresented in Brn3b-/- retinal RNA
(Table 1). Furthermore,
real-time PCR showed that myostatin/Gdf8 transcripts were 12-fold reduced in
Brn3b-/- RNA (Table
1; Fig. 1).
Myostatin/Gdf8 is a potent negative regulator of skeletal muscle
differentiation but is also strongly expressed in the CNS
(McPherron et al., 1997
). Our
results suggest that myostatin/Gdf8 may have a function in RGCs. In situ
hybridization showed that myostatin/Gdf8 expression in the retina was
confined to RGCs in Brn3b heterozygous embryos, and that expression
was largely absent in Brn3b-/- retinas
(Fig. 2C). Based on its role in
skeletal muscle, myostatin/Gdf8 could be secreted from RGCs into the
extracellular retinal environment and negatively impact the differentiation of
retinal cell types by preventing progenitor cells from exiting the cell cycle.
Myostatin/Gdf8 might play an analogous role to Gdf11, the close homolog of
myostatin/Gdf8, which functions as a negative feedback signal in neuronal
progenitors of the olfactory epithelium to inhibit the generation of new
neurons (Wu et al., 2003
).
Because Gli1 expression levels were reduced in Brn3b-/- retinas (Table 1; Fig. 4A,B), and Gli1 is a known component of the Shh signaling pathway, we used real-time PCR to determine whether Shh expression was altered in the absence of Brn3b. We found that Shh levels were reduced about 80-fold in Brn3b-/- retinal RNA (Table 1; Fig. 4A). We discuss the significance of this result below but the identification of myostatin/Gdf8 and Shh as Brn3b-dependent genes indicates that Brn3b can exert its function in a cell non-autonomous fashion through the action of secreted signaling molecules.
|
The Shh pathway in the retina is controlled by Brn3b
The hedgehog pathway is conserved in most metazoan organisms and is
involved in diverse roles in pattern formation and cell differentiation during
development (Ingham and McMahon,
2001
). In mice, Shh, the major hedgehog factor, binds to its
receptors patched 1 (Ptch) or patched 2 (Ptch2), which in turn derepress
Smoothend (Smo) to regulate the activity of the effector transcription factors
Gli1, Gli2 and Gli3. During retinal development, Shh is expressed in
RGCs as they commit to their fate (Neumann
and Nuesslein-Volhard, 2000
;
Wang et al., 2002b
;
Zhang and Yang, 2001a
;
Zhang and Yang, 2001b
). Other
members of the pathway, namely, Ptch, Ptch2, Smo, Gli1, Gli2 and
Gli3, are expressed in retinal progenitor cells
(Nakashima et al., 2002
)
(Fig. 4B). In the retina,
Shh is required for the autoregulation of RGC number
(Zhang and Yang, 2001a
) and
retinal patterning (Neumann and
Nuesslein-Volhard, 2000
; Wang
et al., 2002b
). It has also been shown recently that Shh from RGCs
is required for optic disc and stalk neuroepithelial cell development
(Dakubo et al., 2003
). The
observation that Gli1, a direct target of Shh signaling, was
downregulated in progenitor cells of Brn3b-/- retinas
(Fig. 4B), suggested that
Shh expression might also depend on Brn3b. This scenario was
confirmed by real-time PCR (Fig.
4A) and in situ hybridization
(Fig. 4B). As noted above,
Shh expression in wild-type retina was restricted to RGCs, and this
expression was dramatically reduced in Brn3b-/- embryos
(Fig. 4A,B).
We also examined the dependency of other components of the Shh pathway on
Brn3b using real-time PCR. Of those tested, namely, Ptch, Ptch2, Gli2,
Gli3 and Smo, only Ptch2 expression was affected in
Brn3b-/- retinal RNA. That Ptch2 expression was
altered was consistent with a recent report that loss of Shh signaling mostly
affected Ptch2 expression but not expression of Ptch
(Wang et al., 2002b
). As
reported earlier, Smo was expressed in progenitor cells in the
proliferating zone of the E14.5 wild-type retina and that expression was
unaltered in the Brn3b-/- retina
(Fig. 4B). Taken together,
these results suggest that Brn3b controls the Shh pathway in the retina by
regulating the expression of Shh in RGCs, thereby controlling the
expression of downstream target genes like Gli1 in retinal progenitor
cells.
To address whether Shh was directly regulated by Brn3b, we
searched for Brn3 DNA-binding sites within a region of the Shh gene
known to contain transcriptional regulatory sequences capable of driving gene
expression in the retina (Neumann and
Nuesslein-Volhard, 2000
). By comparing the Shh genomic
sequences of four species (mouse, human, zebrafish and Fugu), we found a
potential Brn3 DNA-binding site (SBRN3) in a highly conserved 67 bp region in
the first intron of Shh (Fig.
5A). The Brn3 site was completely conserved in all four species
and differed by only one base pair from the previously reported consensus
Brn3b DNA-binding sequence (Gruber et al.,
1997
). To determine whether Brn3b could bind to SBRN3, we
performed an electrophoretic mobility shift assay (EMSA) with a GST fusion
protein containing the POU domain of Brn3b (GST-3bPOU) and an oligonucleotide
probe encompassing SBRN3 (Fig.
5B). GST-3bPOU formed a specific complex with SBRN3, and formation
of the complex was inhibited by addition of a competitor Brn3b consensus
oligonucleotide or SBRN3 itself, although SBRN3 competition was not as high.
The GST-3bPOU-SBRN3 complex was supershifted by an anti-GST antibody
(Fig. 5B).
|
|
Genes whose expression was significantly altered at E16.5 and E18.5 were compared with those identified at E14.5, yielding a total of 280 cDNA clones representing 195 non-redundant genes or ESTs (see Table S2 at http://dev.biologists.org/supplemental). Four major clusters (A,B,C and D) emerged from the temporal analysis based on altered expression patterns in the absence of Brn3b (Fig. 7, see Table S2 at http://dev.biologists.org/supplemental). Clusters A and C represented genes that were down- or upregulated, respectively, in the absence of Brn3b at E14.5, i.e. the Brn3b-dependent genes that we described in the previous sections. Alterations in the expression of these genes were likely to be directly related to the loss of Brn3b rather than to secondary (and later) effects of aberrant RGC differentiation. Indeed, many of the E14.5-altered genes were likely to be direct Brn3b targets. Fig. 7 shows that similar alterations in the expression of genes in clusters A and B were observed at E16.5 and E18.5, but overall, the fold change appeared to be less pronounced for most of the genes. We found that many genes in clusters A and C were expressed at lower levels at later developmental stages (data not shown) thus attenuating the fold change in the microarray analysis.
|
Genes encoding several transcription factors, including Zn15, Rpf, A-myb (Mybl1 - Mouse Genome Informatics) and Tbx20 were represented in clusters B and D. The late Brn3b dependency on the expression of these genes relative to the much earlier expression of Brn3b reveal a complex and dynamic relationship among transcription factors during retina development. However, the biological significance of the late-onset alterations in gene expression in Brn3b-null retinas must still be established.
| Discussion |
|---|
|
|
|---|
The identification of Brn3b-dependent genes involved in neuron integrity
and function is consistent with the differentiation defects observed in
Brn3b-/- RGCs. However, alterations in the expression of
some key genes in Brn3b-/- retinas could not be explained
when compared with previous reports regarding the function of these genes in
retinal development. For example, although cyclin D1 expression was
significantly reduced in the absence of Brn3b, no cell proliferation or
photoreceptor cell defects were observed in Brn3b-null retinas, as
has been reported for cyclin D1-mutant retinas
(Dyer and Cepko, 2001
).
Similarly, Shh expression was reduced to very low levels in
Brn3b-/- retinas, but neither RGC overproduction nor
retinal disorganization were observed, as would be predicted from Shh
gain- or loss-of-function studies (Neumann
and Nuesslein-Volhard, 2000
;
Wang et al., 2002b
;
Zhang and Yang, 2001a
;
Zhang and Yang, 2001b
). One
possible explanation is that in the absence of Brn3b, residual expression is
sufficient for wild-type activity. Alternatively, Brn3b may regulate molecular
events that have opposing biological effects. Brn3b plays a positive role in
RGC differentiation but it might also inhibit RGC production through
negative-feedback mechanisms involving Shh and myostatin/Gdf8. In addition,
loss of Brn3b might result in compensating changes in the expression of genes
closely related to genes such as cyclin D1, Shh and
myostatin/Gdf8. The phenotype of Brn3b-/- retinas
reflects the net effects of the deregulation of all Brn3b-dependent genes,
which is not necessarily a simple sum of their phenotypes.
A major conclusion from our study is that retinal expression of only a
limited number of genes and functional gene classes was altered in the absence
of Brn3b. Eighty-seven genes were identified with alterations in expression at
E14.5 from a screen of 18,816 retina-expressed cDNAs, which represented an
estimated 12,000 genes (Mu et al.,
2001
). Given that this number of genes corresponds to roughly 50%
of the total E14.5 retinal transcriptome, we predict that no more than
200 expressed genes in the E14.5 retina will be included in the
Brn3b-dependent gene sets.
In general, our analysis did not distinguish between genes that were under
the direct control of Brn3b and genes that depended on Brn3b only indirectly,
through the action of other transcription factors. Clearly, the genes encoding
Dlx1, Gli1 and cyclin D1 were indirectly affected because these genes
are not expressed in RGCs, the only retinal cells that express Brn3b.
Furthermore, many genes that are directly regulated by Brn3b probably have
promoter/enhancer elements that use other transcription factors in addition to
Brn3b, including those transcription factors identified as Brn3b dependent.
The transcriptional activity of Brn3b has not been clearly defined, although
it appears that Brn3b is capable of transcriptional activation or repression,
depending on the cellular and promoter context
(Budhram-Mahadeo et al., 1999
;
Plaza et al., 1999
). When
measured by real-time PCR, up- or downregulation of Brn3b-dependent genes
ranged from twice the value observed in wild-type RNA to more than 40 times,
suggesting that a variety of transcriptional readout mechanisms exist that
rely partly or completely on Brn3b. Positive or negative feedback mechanisms
involving Brn3b-dependent transcription factors would be interrupted in the
absence of Brn3b and this would also affect transcriptional readout. Although
tightly defined in terms of number and functional class, the gene regulatory
events downstream of Brn3b are likely to be exceedingly complex and
interconnected.
Because the expression of several genes encoding transcription factors was
significantly affected by the loss of Brn3b and these regulatory factors would
further alter the expression of other downstream genes, it might be expected
that the gene regulatory network downstream of Brn3b would extend to hundreds
to thousands of genes. That this was not the case suggests that
transcriptional events independent of Brn3b partially compensate for the
alterations in gene expression caused by the absence of Brn3b. In fact, many
of the identified Brn3b-dependent genes encoding transcription factors have
close relatives that are expressed in the retina but are apparently not under
the control of Brn3b, Irx5 for example. These genes could compensate
for the reduction in expression of their Brn3b-dependent relatives. Brn3b
clearly represents an important node in the gene regulatory network that leads
to RGC differentiation because RGCs cannot differentiate normally without it
and most die by P0. By contrast, genes encoding several important classes of
transcription factors that are known to be expressed in RGCs are not essential
for RGC differentiation as determined by lack of retinal phenotypes in
knockout mice. Gene redundancy may explain the lack of observed RGC phenotypes
in many cases, including redundancy in the Olf/Ebf and Irx
gene families (Cohen et al.,
2000
; Dubois and Vincent,
2001
; Mummenhoff et al.,
2001
). Even for Brn3b, significant redundancy exists because more
severe RGC phenotypes are observed in Brn3a-/-;
Brn3b-/- and Brn3b-/-;
Brn3c-/- double knockout mice than in
Brn3b-/- single knockout mice
(Wang et al., 2002a
) (Steven
Wang and W.H.K., unpublished). These results suggest that at least some
Brn3b-dependent genes will be more dramatically affected in the double
knockout retinas because of the partially overlapping functions of Brn3a,
Brn3b and Brn3c.
The expression of many RGC-specific genes was unaffected by the loss of
Brn3b. Some examples include Pax6, Nf66, Snap25, and Scg10.
Pax6, which is expressed in RGCs at E14.5, has been reported to be a
potential target of Brn3b (Plaza et al.,
1999
). Our results suggest that Brn3b is not essential for
Pax6 expression. The results imply that the expression of these genes
must be under the control of RGC transcription factors that function
independently of and parallel to Brn3b. Control of RGC differentiation thus
appears to be highly robust and adaptable, with both compensatory and parallel
pathways at work to complement the action of Brn3b. The Brn3b-dependent gene
sets thus represent a highly definable and unique molecular signature for RGCs
within the E14.5 retina. We envision that other RGC transcription factors will
be defined by their own RGC signatures once they are subjected to similar gene
expression profiling analyses. Ultimately, applying this approach to several
key transcription factors would provide a detailed picture of the entire RGC
gene regulatory network leading from the regulatory genes at the top of the
hierarchy to the terminal downstream genes at the bottom that define the
differentiated cell type. In this regard, Math5 (Atoh7 - Mouse Genome
Informatics), a bHLH transcription factor expressed in retinal progenitor
cells and essential for RGC specification, is positioned genetically upstream
of Brn3b (Brown et al., 1998
;
Brown et al., 2001
;
Wang et al., 2001
).
Math5-dependent genes should therefore include the Brn3b gene sets defined
here, intermediate genes positioned between Math5 and Brn3b,
and other genes associated with the Math5 progenitor cell
population.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Austin, C. P., Feldman, D. E., Ida, J. A., Jr and Cepko, C. L. (1995). Vertebrate retinal ganglion cells are selected from competent progenitors by the action of Notch. Development 121,3637 -3650.[Abstract]
Bermingham, J. R., Jr, Shumas, S., Whisenhunt, T., Sirkowski, E.
E., O'Connell, S., Scherer, S. S. and Rosenfeld, M. G.
(2002). Identification of genes that are downregulated in the
absence of the POU domain transcription factor pou3f1 (Oct-6, Tst-1, SCIP) in
sciatic nerve. J. Neurosci.
22,10217
-10231.
Brown, N. L., Kanekar, S., Vetter, M. L., Tucker, P. K., Gemza, D. L. and Glaser, T. (1998). Math5 encodes a murine basic helix-loop-helix transcription factor expressed during early stages of retinal neurogenesis. Development 125,4821 -4833.[Abstract]
Brown, N. L., Patel, S., Brzezinski, J. and Glaser, T.
(2001). Math5 is required for retinal ganglion cell and optic
nerve formation. Development
128,2497
-2508.
Buchman, V. L., Adu, J., Pinon, L. G., Ninkina, N. N. and Davies, A. M. (1998). Persyn, a member of the synuclein family, influences neurofilament network integrity. Nat. Neurosci. 1,101 -103.[CrossRef][Medline]
Budhram-Mahadeo, V., Ndisang, D., Ward, T., Weber, B. L. and Latchman, D. S. (1999). The Brn-3b POU family transcription factor represses expression of the BRCA-1 anti-oncogene in breast cancer cells. Oncogene 18,6684 -6691.[CrossRef][Medline]
Campbell, D. S., Regan, A. G., Lopez, J. S., Tannahill, D.,
Harris, W. A. and Holt, C. E. (2001). Semaphorin 3A elicits
stage-dependent collapse, turning, and branching in Xenopus retinal growth
cones. J. Neurosci. 21,8538
-8547.
Cohen, D. R., Cheng, C. W., Cheng, S. H. and Hui, C. C. (2000). Expression of two novel mouse Iroquois homeobox genes during neurogenesis. Mech. Dev. 91,317 -321.[CrossRef][Medline]
Dakubo, G. D., Wang, Y. P., Mazerolle, C., Campsall, K.,
McMahon, A. P. and Wallace, V. A. (2003). Retinal ganglion
cell-derived sonic hedgehog signaling is required for optic disc and stalk
neuroepithelial cell development. Development
130,2967
-2980.
Dorsky, R. I., Rapaport, D. H. and Harris, W. A. (1995). Xotch inhibits cell differentiation in the Xenopus retina. Neuron 14,487 -496.[CrossRef][Medline]
Dubois, L. and Vincent, A. (2001). The COE-Collier/Olf1/EBF-transcription factors: structural conservation and diversity of developmental functions. Mech. Dev. 108, 3-12.[CrossRef][Medline]
Dyer, M. A. and Cepko, C. L. (2001). Regulating proliferation during retinal development. Nat. Rev. Neurosci. 2,333 -342.[Medline]
Erkman, L., McEvilly, R. J., Luo, L., Ryan, A. K., Hooshmand, F., O'Connell, S. M., Keithley, E. M., Rapaport, D. H., Ryan, A. F. and Rosenfeld, M. G. (1996). Role of transcription factors Brn-3.1 and Brn-3.2 in auditory and visual system development. Nature 381,603 -606.[CrossRef][Medline]
Erkman, L., Yates, P. A., McLaughlin, T., McEvilly, R. J., Whisenhunt, T., O'Connell, S. M., Krones, A. I., Kirby, M. A., Rapaport, D. H., Bermingham, J. R. et al. (2000). A POU domain transcription factor-dependent program regulates axon pathfinding in the vertebrate visual system. Neuron 28,779 -792.[CrossRef][Medline]
Gan, L., Xiang, M., Zhou, L., Wagner, D. S., Klein, W. H. and
Nathans, J. (1996). POU domain factor Brn-3b is required for
the development of a large set of retinal ganglion cells. Proc.
Natl. Acad. Sci. USA 93,3920
-3925.
Gan, L., Wang, S. W., Huang, Z. and Klein, W. H. (1999). POU domain factor Brn-3b is essential for retinal ganglion cell differentiation and survival but not for initial cell fate specification. Dev. Biol. 210,469 -480.[CrossRef][Medline]
Garcia, M. L. and Cleveland, D. W. (2001). Going new places using an old MAP: tau, microtubules and human neurodegenerative disease. Curr. Opin. Cell Biol. 13, 41-48.[CrossRef][Medline]
Gerber, W. V., Yatskievych, T. A., Antin, P. B., Correia, K. M., Conlon, R. A. and Krieg, P. A. (1999). The RNA-binding protein gene, hermes, is expressed at high levels in the developing heart. Mech. Dev. 80,77 -86.[CrossRef][Medline]
Girard, C., Tinel, N., Terrenoire, C., Romey, G., Lazdunski, M. and Borsotto, M. (2002). p11, an annexin II subunit, an auxiliary protein associated with the background K+ channel, TASK-1. EMBO J. 21,4439 -4448.[CrossRef][Medline]
Gruber, C. A., Rhee, J. M., Gleiberman, A. and Turner, E. E. (1997). POU domain factors of the Brn-3 class recognize functional DNA elements which are distinctive, symmetrical, and highly conserved in evolution. Mol. Cell Biol. 17,2391 -2400.[Abstract]
Grunwald, I. C. and Klein, R. (2002). Axon guidance: receptor complexes and signaling mechanisms. Curr. Opin. Neurobiol. 12,250 -259.[CrossRef][Medline]
Hamre, K. M., Chepenik, K. P. and Goldowitz, D. (1995). The annexins: specific markers of midline structures and sensory neurons in the developing murine central nervous system. J. Comp. Neurol. 352,421 -435.[CrossRef][Medline]
He, Z., Wang, K. C., Koprivica, V., Ming, G. and Song, H. J. (2002). Knowing how to navigate: mechanisms of semaphorin signaling in the nervous system. Sci. STKE,RE1 .
Hegde, P., Qi, R., Abernathy, K., Gay, C., Dharap, S., Gaspard, R., Hughes, J. E., Snesrud, E., Lee, N. and Quackenbush, J. (2000). A concise guide to cDNA microarray analysis. Biotechniques 29,548 -550, 552-554, 556.[Medline]
Ibata, K., Hashikawa, T., Tsuboi, T., Terakawa, S., Liang, F., Mizutani, A., Fukuda, M. and Mikoshiba, K. (2002). Non-polarized distribution of synaptotagmin IV in neurons: evidence that synaptotagmin IV is not a synaptic vesicle protein. Neurosci. Res. 43,401 -406.[CrossRef][Medline]
Ingham, P. W. and McMahon, A. P. (2001).
Hedgehog signaling in animal development: paradigms and principles.
Genes Dev. 15,3059
-3087.
Jin, Z., Zhang, J., Klar, A., Chedotal, A., Rao, Y., Cepko, C.
L. and Bao, Z. Z. (2003). Irx4-mediated regulation of Slit1
expression contributes to the definition of early axonal paths inside the
retina. Development 130,1037
-1048.
Julien, J. P. (1999). Neurofilament functions in health and disease. Curr. Opin. Neurobiol. 9, 554-560.[CrossRef][Medline]
Lavedan, C. (1998). The synuclein family.
Genome Res. 8,871
-880.
Levavasseur, F., Zhu, Q. and Julien, J. P. (1999). No requirement of alpha-internexin for nervous system development and for radial growth of axons. Mol. Brain Res. 69,104 -112.[Medline]
Livesey, F. J., Furukawa, T., Steffen, M. A., Church, G. M. and Cepko, C. L. (2000). Microarray analysis of the transcriptional network controlled by the photoreceptor homeobox gene Crx. Curr. Biol. 10,301 -310.[CrossRef][Medline]
Ma, C., Papermaster, D. and Cepko, C. L.
(1998). A unique pattern of photoreceptor degeneration in cyclin
D1 mutant mice. Proc. Natl. Acad. Sci. USA
95,9938
-9943.
Masson, J., Sagne, C., Hamon, M. and El Mestikawy, S.
(1999). Neurotransmitter transporters in the central nervous
system. Pharmacol. Rev.
51,439
-464.
McEvilly, R. J. and Rosenfeld, M. G. (1999). The role of POU domain proteins in the regulation of mammalian pituitary and nervous system development. Prog. Nucleic Acid Res. Mol. Biol. 63,223 -255.[Medline]
McPherron, A. C., Lawler, A. M. and Lee, S. J. (1997). Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature 387, 83-90.[CrossRef][Medline]
Mu, X., Zhao, S., Pershad, R., Hsieh, T. F., Scarpa, A., Wang,
S. W., White, R. A., Beremand, P. D., Thomas, T. L., Gan, L. et al.
(2001). Gene expression in the developing mouse retina by EST
sequencing and microarray analysis. Nucleic Acids Res.
29,4983
-4993.
Mummenhoff, J., Houweling, A. C., Peters, T., Christoffels, V. M. and Ruther, U. (2001). Expression of Irx6 during mouse morphogenesis. Mech. Dev. 103,193 -195.[CrossRef][Medline]
Nakashima, M., Tanese, N., Ito, M., Auerbach, W., Bai, C., Furukawa, T., Toyono, T., Akamine, A. and Joyner, A. L. (2002). A novel gene, GliH1, with homology to the Gli zinc finger domain not required for mouse development. Mech. Dev. 119, 21.[CrossRef][Medline]
Neumann, C. J. and Nuesslein-Volhard, C.
(2000). Patterning of the zebrafish retina by a wave of sonic
hedgehog activity. Science
289,2137
-2139.
Ng, L., Hurley, J. B., Dierks, B., Srinivas, M., Salto, C., Vennstrom, B., Reh, T. A. and Forrest, D. (2001). A thyroid hormone receptor that is required for the development of green cone photoreceptors. Nat. Genet. 27, 94-98.[Medline]
Ninkina, N., Papachroni, K., Robertson, D. C., Schmidt, O.,
Delaney, L., O'Neill, F., Court, F., Rosenthal, A., Fleetwood-Walker, S. M.,
Davies, A. M. et al. (2003). Neurons expressing the highest
levels of gamma-synuclein are unaffected by targeted inactivation of the gene.
Mol. Cell Biol. 23,8233
-8245.
O'Connor, V. and Lee, A. G. (2002). Synaptic vesicle fusion and synaptotagmin: 2B or not 2B? Nat. Neurosci. 5,823 -824.[CrossRef][Medline]
Okuse, K., Malik-Hall, M., Baker, M. D., Poon, W. Y., Kong, H., Chao, M. V. and Wood, J. N. (2002). Annexin II light chain regulates sensory neuron-specific sodium channel expression. Nature 417,653 -656.[CrossRef][Medline]
Panganiban, G. and Rubenstein, J. L. (2002).
Developmental functions of the Distal-less/Dlx homeobox genes.
Development 129,4371
-4386.
Plaza, S., Hennemann, H., Moroy, T., Saule, S. and Dozier, C. (1999). Evidence that POU factor Brn-3B regulates expression of Pax-6 in neuroretina cells. J. Neurobiol. 41,349 -358.[CrossRef][Medline]
Quackenbush, J. (2002). Microarray data normalization and transformation. Nat. Genet. Suppl.496 -501.
Trieu, M., Rhee, J. M., Fedtsova, N. and Turner, E. E.
(1999). Autoregulatory sequences are revealed by complex
stability screening of the mouse brn-3.0 locus. J.
Neurosci. 19,6549
-6558.
Van Gelder, R. N., von Zastrow, M. E., Yool, A., Dement, W. C.,
Barchas, J. D. and Eberwine, J. H. (1990). Amplified RNA
synthesized from limited quantities of heterogeneous cDNA. Proc.
Natl. Acad. Sci. USA 87,1663
-1667.
von Poser, C. and Sudhof, T. C. (2001). Synaptotagmin 13: structure and expression of a novel synaptotagmin. Eur. J. Cell Biol. 80,41 -47.[CrossRef][Medline]
Wagner, N., Wagner, K. D., Schley, G., Coupland, S. E., Heimann,
H., Grantyn, R. and Scholz, H. (2002). The Wilms' tumor
suppressor Wt1 is associated with the differentiation of retinoblastoma cells.
Cell Growth Differ. 13,297
-305.
Wang, S. W., Gan, L., Martin, S. E. and Klein, W. H. (2000). Abnormal polarization and axon outgrowth in retinal ganglion cells lacking the POU-domain transcription factor Brn-3b. Mol. Cell Neurosci. 16,141 -156.[CrossRef][Medline]
Wang, S. W., Kim, B. S., Ding, K., Wang, H., Sun, D., Johnson,
R. L., Klein, W. H. and Gan, L. (2001). Requirement for math5
in the development of retinal ganglion cells. Genes
Dev. 15,24
-29.
Wang, S. W., Mu, X., Bowers, W. J., Kim, D. S., Plas, D. J., Crair, M. C., Federoff, H. J., Gan, L. and Klein, W. H. (2002a). Brn3b/Brn3c double knockout mice reveal an unsuspected role for Brn3c in retinal ganglion cell axon outgrowth. Development 129,467 -477.
Wang, Y. P., Dakubo, G., Howley, P., Campsall, K. D., Mazarolle, C. J., Shiga, S. A., Lewis, P. M., McMahon, A. P. and Wallace, V. A. (2002b). Development of normal retinal organization depends on Sonic hedgehog signaling from ganglion cells. Nat. Neurosci. 5,831 -832.[Medline]
Wegner, M., Drolet, D. W. and Rosenfeld, M. G. (1993). POU-domain proteins: structure and function of developmental regulators. Curr. Opin. Cell Biol. 5, 488-498.[CrossRef][Medline]
Wu, H. H., Ivkovic, S., Murray, R. C., Jaramillo, S., Lyons, K. M., Johnson, J. E. and Calof, A. L. (2003). Autoregulation of Neurogenesis by GDF11. Neuron 37,197 -207.[CrossRef][Medline]
Xiang, M., Gan, L., Li, D., Zhou, L., Chen, Z. Y., Wagner, D.,
O'Malley, B. W., Jr, Klein, W. and Nathans, J. (1997). Role
of the Brn-3 family of POU-domain genes in the development of the
auditory/vestibular, somatosensory, and visual systems. Cold Spring
Harb. Symp. Quant. Biol. 62,325
-336.
Yun, K., Fischman, S., Johnson, J., de Angelis, M. H.,
Weinmaster, G. and Rubenstein, J. L. (2002). Modulation of
the notch signaling by Mash1 and Dlx1/2 regulates sequential specification and
differentiation of progenitor cell types in the subcortical telencephalon.
Development 129,5029
-5040.
Zhang, X. M. and Yang, X. J. (2001a). Regulation of retinal ganglion cell production by Sonic hedgehog. Development 128,943 -957.[Abstract]
Zhang, X. M. and Yang, X. J. (2001b). Temporal and spatial effects of Sonic hedgehog signaling in chick eye morphogenesis. Dev. Biol. 233,271 -290.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
N. Ninkina, O. Peters, S. Millership, H. Salem, H. van der Putten, and V. L. Buchman {gamma}-Synucleinopathy: neurodegeneration associated with overexpression of the mouse protein Hum. Mol. Genet., May 15, 2009; 18(10): 1779 - 1794. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-A. Mao, S. W. Wang, P. Pan, and W. H. Klein Rewiring the retinal ganglion cell gene regulatory network: Neurod1 promotes retinal ganglion cell fate in the absence of Math5 Development, October 15, 2008; 135(20): 3379 - 3388. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Pan, M. Deng, X. Xie, and L. Gan ISL1 and BRN3B co-regulate the differentiation of murine retinal ganglion cells Development, June 1, 2008; 135(11): 1981 - 1990. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Mu, X. Fu, P. D. Beremand, T. L. Thomas, and W. H. Klein Gene-regulation logic in retinal ganglion cell development: Isl1 defines a critical branch distinct from but overlapping with Pou4f2 PNAS, May 13, 2008; 105(19): 6942 - 6947. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Qiu, H. Jiang, and M. Xiang A Comprehensive Negative Regulatory Program Controlled by Brn3b to Ensure Ganglion Cell Specification from Multipotential Retinal Precursors J. Neurosci., March 26, 2008; 28(13): 3392 - 3403. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-A. Mao, T. Kiyama, P. Pan, Y. Furuta, A.-K. Hadjantonakis, and W. H. Klein Eomesodermin, a target gene of Pou4f2, is required for retinal ganglion cell and optic nerve development in the mouse Development, January 15, 2008; 135(2): 271 - 280. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Soto, E. Oglesby, B. P. Buckingham, J. L. Son, E. D. O. Roberson, M. R. Steele, D. M. Inman, M. L. Vetter, P. J. Horner, and N. Marsh-Armstrong Retinal Ganglion Cells Downregulate Gene Expression and Lose Their Axons within the Optic Nerve Head in a Mouse Glaucoma Model J. Neurosci., January 9, 2008; 28(2): 548 - 561. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. V. Das, J. James, S. Bhattacharya, A. N. Imbalzano, M. L. Antony, G. Hegde, X. Zhao, K. Mallya, F. Ahmad, E. Knudsen, et al. SWI/SNF Chromatin Remodeling ATPase Brm Regulates the Differentiation of Early Retinal Stem Cells/Progenitors by Influencing Brn3b Expression and Notch Signaling J. Biol. Chem., November 30, 2007; 282(48): 35187 - 35201. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Butler and G. Tear Getting axons onto the right path: the role of transcription factors in axon guidance Development, February 1, 2007; 134(3): 439 - 448. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wang, G. D. Dakubo, S. Thurig, C. J. Mazerolle, and V. A. Wallace Retinal ganglion cell-derived sonic hedgehog locally controls proliferation and the timing of RGC development in the embryonic mouse retina Development, November 15, 2005; 132(22): 5103 - 5113. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. T. Nguyen, K. Cho, S. A. Stratton, and M. C. Barton Transcription Factor Interactions and Chromatin Modifications Associated with p53-Mediated, Developmental Repression of the Alpha-Fetoprotein Gene Mol. Cell. Biol., March 15, 2005; 25(6): 2147 - 2157. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Bowman, S.-Y. Yoo, N. P. Dantuma, and H. Y. Zoghbi Neuronal dysfunction in a polyglutamine disease model occurs in the absence of ubiquitin-proteasome system impairment and inversely correlates with the degree of nuclear inclusion formation Hum. Mol. Genet., March 1, 2005; 14(5): 679 - 691. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Pan, Z. Yang, L. Feng, and L. Gan Functional equivalence of Brn3 POU-domain transcription factors in mouse retinal neurogenesis Development, February 15, 2005; 132(4): 703 - 712. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. de Melo, G. Du, M. Fonseca, L.-A. Gillespie, W. J. Turk, J. L. R. Rubenstein, and D. D. Eisenstat Dlx1 and Dlx2 function is necessary for terminal differentiation and survival of late-born retinal ganglion cells in the developing mouse retina Development, January 15, 2005; 132(2): 311 - 322. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Yu, S. He, J. S. Friedman, M. Akimoto, D. Ghosh, A. J. Mears, D. Hicks, and A. Swaroop Altered Expression of Genes of the Bmp/Smad and Wnt/Calcium Signaling Pathways in the Cone-only Nrl-/- Mouse Retina, Revealed by Gene Profiling Using Custom cDNA Microarrays J. Biol. Chem., October 1, 2004; 279(40): 42211 - 42220. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Eng, J. Lanier, N. Fedtsova, and E. E. Turner Coordinated regulation of gene expression by Brn3a in developing sensory ganglia Development, August 15, 2004; 131(16): 3859 - 3870. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Yoshida, A. J. Mears, J. S. Friedman, T. Carter, S. He, E. Oh, Y. Jing, R. Farjo, G. Fleury, C. Barlow, et al. Expression profiling of the developing and mature Nrl-/- mouse retina: identification of retinal disease candidates and transcriptional regulatory targets of Nrl Hum. Mol. Genet., July 15, 2004; 13(14): 1487 - 1503. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||