|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 11 February 2004
doi: 10.1242/dev.01030
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institut für Molekularbiologie OE5250, Medizinische Hochschule, Carl-Neuberg-Str. 1, D-30625 Hannover, Germany
* Author for correspondence (e-mail: gossler.achim{at}mh-hannover.de)
Accepted 10 December 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Notch signalling, Vertebral identity, Somitogenesis, Positional specification, Mouse
| Introduction |
|---|
|
|
|---|
Somite formation and patterning require cell-to-cell communication in the
presomitic mesoderm (psm) mediated by the Notch signalling pathway. Mutations
in genes encoding Notch pathway components in mouse disrupt
compartmentalization of somites, and alignment and maintenance of segment
borders (Conlon et al., 1995
;
del Barco Barrantes et al.,
1999
; Evrard et al.,
1998
; Hrabé de Angelis
et al., 1997
; Kusumi et al.,
1998
; Swiatek et al.,
1994
; Zhang and Gridley,
1998
). Somite formation involves a molecular oscillator termed the
`segmentation clock' that operates in the presomitic mesoderm and manifests
itself by the periodic expression of `cyclic' genes. Expression of cyclic
genes occurs in subsequent waves that sweep through the psm once during the
formation of each somite (Forsberg et al.,
1998
; McGrew et al.,
1998
; Palmeirim et al.,
1997
). The segmentation clock is closely linked to Notch and
Wnt/ß-catenin signalling: cycling genes encode various Notch
pathway components (Aulehla and Johnson,
1999
; Forsberg et al.,
1998
; Jiang et al.,
2000
; Jouve et al.,
2000
; McGrew et al.,
1998
; Palmeirim et al.,
1997
), and the negative regulator of the Wnt pathway
axin2 (Aulehla et al.,
2003
). In addition, mutations in some Notch pathway components as
well as in Wnt3a severely affect the expression of cyclic genes
(Aulehla et al., 2003
;
Bessho et al., 2001
;
del Barco Barrantes et al.,
1999
; Jiang et al.,
2000
; Jouve et al.,
2000
).
During somite formation specific identities are imposed on somites
according to their axial position (Gossler
and Hrabe de Angelis, 1998
;
Hogan et al., 1985
;
Meinhardt, 1986
).
Transplantation experiments in chick
(Kieny et al., 1972
) and mouse
(Beddington et al., 1992
)
embryos have indicated that positional information is established in the psm
prior to the formation of epithelial somites. During subsequent somite
differentiation, positional specification leads to unique morphologies of
vertebrae along the body axis. Mutational analyses have shown that Hox genes
are essential for the specification of vertebral identity
(Krumlauf, 1994
). During
development Hox genes are activated sequentially according to their position
in the cluster (Duboule,
1994
), leading to unique combinations of Hox genes expressed at
different axial levels, which is referred to as `Hox code'
(Kessel, 1991
;
Kessel and Gruss, 1991
). In
the paraxial mesoderm, Hox genes are generally activated in the posterior
presomitic mesoderm and remain expressed in somites and their derivatives with
distinct and appropriate expression boundaries. Recent analyses have shown
that at least some Hox genes are additionally activated in bursts in the
anterior psm, resulting in dynamic stripes that are correlated with the
oscillating expression of cyclic genes
(Zakany et al., 2001
). In
RBPj
mutant embryos (Rbpsuh - Mouse Genome
Informatics) expression of cyclic genes is disrupted
(del Barco Barrantes et al.,
1999
) and Hox gene expression is reduced
(Zakany et al., 2001
).
Likewise, loss or reduction of Wnt3a affects vertebral identity and
expression of some Hox genes (Ikeya and
Takada, 2001
), suggesting a link between the segmentation clock,
coordinated activation of Hox genes, and positional specification. However,
thus far alterations of vertebral identities in mice with disrupted Notch
signalling have not been reported.
To further study functions of Notch signalling in the paraxial mesoderm we
have generated transgenic mice that express in the paraxial mesoderm a
truncated version of Delta1 (Dll1 - Mouse Genome Informatics),
Dll1dn, which acts as a dominant-negative molecule in
Xenopus and chick embryos (Chitnis
et al., 1995
; Henrique et al.,
1997
). These mice showed reduced Notch activity in the psm, were
viable and displayed defects in somites and vertebrae consistent with known
roles for Notch signalling in anteroposterior somite patterning. In addition,
Dll1dn transgenic mice showed with variable expressivity
and penetrance alterations of vertebral identities consistent with homeotic
transformations. Likewise, hemizygous transgenic Dll1dn
mice, which carried only one functional copy of the endogenous Dll1 gene, as
well as mice heterozygous for the Dll1lacZ null allele
showed changes in vertebral identities, suggesting a previously unnoticed
haploinsufficiency for Dll1. Also, in mice lacking Lfng function
(Zhang and Gridley, 1998
) or
expressing Lfng constitutively in the presomitic mesoderm
(Serth et al., 2003
)
identities of vertebrae were changed and axial identity was shifted
anteriorly, indicating that levels of Notch signalling as well as cyclic
activity of Lfng is essential for positional specification in the
paraxial mesoderm.
| Materials and methods |
|---|
|
|
|---|
EMBL3a ES cell library
(Schuster-Gossler et al.,
1996
Genotyping of mice
PCR typing was performed using genomic DNA isolated from tail biopsies or
yolk sacs, respectively. Used primers: msd::Dll1dn and
Mesp2::Dll1dn: melta119 (CGGCTCTTCCCCTTGTTCTAAC) and Dll1-dn#5
(TCTAGACTATTATCATTCAGGTGG); Mesp2::lacZ: lacZ3 (CAACTTAATCGCCTTGCAGC) and
lacZ4 (CCAGATAACTGCCGTCACTCC); msd::LfngHA3: Lfng-F7 (CCTGTCCACTTTTGGTTTGC)
and Lfng-B13 (CAGAGAATGGTCCCTTGATG); Lfng wild-type allele: lfhs1
(GAACAAATATGGGCATTCACTCCA) and lfgwF13 (GGTCGCTTCTCGCCAGGGCGA);
LfnglacZ allele: lfwF2 (CCAAGGCTAGCAGCCAATTAG) and lacZB2
(GTGCTGCAAGGCGATTAAGTT); Dll1lacZ allele: melta38
(ATCCCTGGGTCTTTGAAGAAG) and lacZ1/Dll1ko (CAAATTCAGACGGCAAACG).
Dll1dn transcripts in msd-Dll1dn and Mesp2-Dll1dn embryos were detected by RT-PCR on total RNA extracted from day 8.5-10.5 embryos using the RNeasy kit (Qiagen). Primers used were melta119 and Dll1-dn#5. HPRT expression was analysed as control using primers HPRT-5' (CACAGGACTAGAACACCTGC) and HPRT-3' (GCTGGTGAAAAGGACCTCT).
In situ hybridisation
In situ hybridisations on sections were performed according to Lescher et
al. (Lescher et al., 1998
).
Whole-mount in situ hybridisations were performed according to Wilkinson
(Wilkinson, 1992
) with minor
modifications using an InsituPro (Intavis AG number 10,000) for automated
sample handling. Probes used were: Cdx1, Dll1, Lfng, Hes5, Hes7,
myogenin, Pax1, Pax9, Nkx3.2, RalDH2, Tbx18, Uncx4.1,
Hoxa4, Hoxa6, Hoxa9, Hoxb3, Hoxb4, Hoxb6, Hoxb8, Hoxc5, Hoxc6, Hoxc8,
Hoxc9, Hoxd1, Hoxd3, Hoxd4 and Hoxd9. Hoxc5 and Hoxc6
probes were generated from genomic PCR fragments using primers Hoxc5-1
(ATGACTTTCTCACCTTCCTGCCCC), Hoxc5-2 (TCTCCTTCCCCAACACCTCTTTAC), Hoxc6-3
(GTCATTTTGTCTGTCCTGGATTGG) and Hoxc6-4 (TCTGGATACTGGCTTTCTGGTCC). The SV40pA
probe was generated from a 250 bp XbaI/BamHI subclone from the
3' end of the msd-Dll1dn construct.
Skeletal preparations
Alcian blue/alizarin red skeletal staining was performed according to
Kessel and Gruss (Kessel and Gruss,
1991
). Single vertebrae were dissected after staining of whole
skeletons.
Embryo tail halves culture
Culture of 9.5-day embryo tails was performed as described
(Serth et al., 2003
).
| Results |
|---|
|
|
|---|
|
If the truncated Dll1 acts also in mouse as a dominant-negative molecule
and inhibits Notch signalling, increasing the dose of the transgene, or
reducing endogenous Notch activity should enhance the observed defects.
Consistent with this idea, external phenotypes and vertebral defects were more
severe, and their penetrance was increased in homozygous transgenic mice from
all three lines (n=7, 15 and 15, for msd::Dll1dn13, 19 and
25, respectively (Fig. 1C,
parts f-l, Fig. 2, and data not
shown). Likewise in hemizygous msd::Dll1dn19 mice that carried only
one copy of the Dll1 WT allele, vertebral defects were enhanced
(Fig. 1C, parts r-v, and
Fig. 2D). In addition,
expression of Hes5, which is a transcriptional target of Notch
(Ohtsuka et al., 1999
;
Shimizu et al., 2002
) and
expressed in the psm of WT embryos in variable stripes
(Fig. 3A,B, and data not
shown), was not detected in the psm of homozygous msd::Dll1dn19
embryos between day 9.5 and 11.5 of development, whereas expression in the
neural tube was unaffected (Fig.
3C,D, and data not shown). Together, these data indicated that
Dll1dn indeed acts in a dominant-negative manner and reduced Notch signalling
in the psm.
|
|
|
|
|
|
|
Altered vertebral identities in mice with disrupted Lfng expression
Because several Hox genes are activated in transcriptional bursts that
correlate with dynamic Lfng expression
(Zakany et al., 2001
), we
analysed mice lacking Lfng function
(Zhang and Gridley, 1998
), and
transgenic msd::LfngHA3 mice expressing Lfng constitutively in the
psm (Serth et al., 2003
). In
embryos of both genotypes Hes5 expression was either downregulated or
not detected (n=7, respectively, data not shown), indicating that
both loss of Lfng function and constitutive Lfng activity
affect Notch signalling similarly, and supporting that cyclic Lfng
activity is a critical parameter of Notch signalling in the psm. Vertebral
malformations in these mice make it difficult to unambiguously assign axial
identities to each vertebra. However, the ventral arch of C1, the anterior
tuberculi normally present at C6, and the spinous process of T2 could be
clearly distinguished and were used as landmarks to analyse this region of the
axial skeleton. A consistent feature of all analysed skeletons of
Lfng null mice (n=7) was a reduced number of cervical
vertebrae and ribs (Fig. 7C).
In five cases, the second vertebra anterior to the first rib-bearing vertebra
T1 (C6 in WT mice) had two ventral processes resembling the anterior tuberculi
present on WT C6. The remainder had one of these processes shifted to either
the next anterior or posterior vertebra. In addition, in four skeletons the
number of ribs attached to the sternum was reduced
(Fig. 7). Transgenic mice with
constitutive Lfng expression in the psm (n=11) showed
similar defects. Five msd::LfngHA3 mice had only six cervical vertebrae,
accompanied in part with additional alterations
(Fig. 7). In all transgenic
mice the number of ribs was reduced, and in four cases also the number of ribs
attached to the sternum was altered (Fig.
7C).
|
| Discussion |
|---|
|
|
|---|
The vertebral columns of msd::Dll1dn transgenic mice showed mild
defects, which probably reflect consequences of perturbed somite polarity. The
largely normal vertebral column allowed us to also unambiguously identify the
absence or ectopic presence of landmarks (e.g. anterior tuberculi and
transverse foramina) characteristic for particular vertebrae. The loss of such
landmarks from some vertebrae and their ectopic presence on others is
indicative of altered vertebral identities and suggests homeotic
transformations. Changes in vertebral identity were also found in mice
expressing Dll1dn under the Mesp2 promoter. In these mice
no additional vertebral malformations were detected, suggesting that changes
in vertebral identities in msd::Dll1dn mice developed independently
from segment polarity-related defects. The lack of vertebral defects
indicative for disrupted anteroposterior somite patterning in
Mesp2::Dll1dn mice is surprising because Notch activity in the
anterior psm is critically involved in somite compartmentalisation
(Takahashi et al., 2003
;
Takahashi et al., 2000
). A
potential explanation might be that Notch activity in Mesp2::Dll1dn
transgenic embryos is higher than in msd::Dll1dn embryos, as
suggested by residual Hes5 expression
(Fig. 5D), and still sufficient
for establishment of segment polarity. The msd element directs mRNA expression
into the posterior psm and newly formed somites but expression is weak or
absent in the anterior region of the psm corresponding to S-I/S0
(Beckers et al., 2000
), whereas
the Mesp2 promoter drives expression specifically in this region
(Fig. 5B). Thus, in addition to
apparently stronger reduction of Notch activity, in msd::Dll1dn
embryos paraxial mesoderm cells are exposed to reduced Notch activity during
most of their progression through the psm, whereas in Mesp2::Dll1dn
embryos Notch activity is only reduced in cells shortly prior to somite
formation, which might contribute to the phenotypic differences. Formally we
cannot exclude that Dll1dn expression in the newly formed somites
contributed to changes in vertebral identity. However, this seems unlikely
because expression in the anterior psm in Mesp2::Dll1dn embryos was
sufficient to affect vertebral identity. The apparent restriction of changes
in vertebral identity to the cervical and upper thoracic region in msd::Dll1dn
and heterozygous Dll1lacZ mice might reflect a higher
sensitivity of anterior Hox genes to reduced Notch activity.
The cervical region of transgenic mice expressing Dll1dn showed
anterior transformations, whereas heterozygous Dll1lacZ
mice, which presumably have reduced Dll1-mediated signals, displayed posterior
or bidirectional transformations, and Dll1dn mice lacking one copy
of Dll1 had mixed phenotypes. Dl1dn rendered chick retina cells deaf
to receiving Notch signals (Henrique et
al., 1997
), blocking Notch activity cell autonomously. Thus,
Dll1dn appears to not only reduce Dll1-mediated Notch
signals, but might also affect signals mediated by other ligands and various
receptors, which could lead to different Notch signalling output in the psm
than reduction of only Dll1. This might not only be a quantitative
effect, because in both Dll1dn and Dll1dn/Dll1lacZ/+
embryos Hes5 expression was severely downregulated and not detected
(Fig. 3 and data not shown).
Such mode of action of the dominant-negative Dll1 could explain the different
phenotypes in Dll1dn and Dll1dn/Dll1lacZ/+ mice, and would
imply that signals mediated by different ligands or receptors contribute to
positional specification and might act potentially in opposite ways similar to
non-redundant or even counteracting functions during somite
compartmentalisation (Takahashi et al.,
2003
).
Based on the severe reduction of Hox gene expression in day 8.5
RBPj
mutant embryos
(Zakany et al., 2001
), which
lack Notch activity, one might expect that attenuated Notch signalling leads
to reduced Hox expression. The results of the expression analysis of 15 Hox
genes by in situ hybridisation in Dll1dn embryos between day 8.5
and 10.5 did not provide evidence for this idea, although we cannot exclude
subtle level differences that were not detected by our analysis. However, the
anterior expression borders of Hoxb6 and Hoxc5 were shifted,
suggesting that the exact positioning of the rostral limit of Hox expression
requires precisely regulated Notch activity in the psm. General Hox activation
in the paraxial mesoderm seems to be only affected significantly if Notch
signalling is severely reduced or completely blocked potentially already in
paraxial mesoderm precursors. How Notch activity and transcriptional
regulation of Hox genes are coupled molecularly during paraxial mesoderm
formation and patterning requires further investigation.
Transformations of vertebral identities, anterior shifts of Hoxb6
expression, and of the position of both fore and hind limb buds were detected
in mice lacking Lfng function or expressing Lfng
constitutively. An apparent anterior shift of Hoxb6 expression in
Lfng mutant embryos could also be expected if fewer segments were
generated in the prospective cervical region, whereas the absolute position of
the anterior Hoxb6 expression border along the anteroposterior body
axis was maintained. Recent models of somite segmentation suggest that the
interaction of graded FGF (Dubrulle et
al., 2001
) or WNT (Aulehla et
al., 2003
) signals with the segmentation clock generates the
periodic somite pattern. Conceptually, increasing the steepness of the
gradient or slowing the periodicity of the clock would lead to fewer segments,
which in either case would be larger. Thus, if the loss of Lfng would
affect the clock (output) and fewer segments would be formed in the
prospective cervical region, they should be larger than normal. However, the
five cervical segments in Lfng mutant embryos occupied essentially
the same space as the anterior five segments in WT embryos
(Fig. 8), strongly supporting
that the rostral Hoxb6 expression border is indeed shifted
anteriorly. The positions of the fore and hind limb buds are invariant in WT
embryos and correspond to the transition between the cervical and thoracic,
and lumbar and sacral regions, respectively
(Burke, 2000
). Their anterior
shift suggests homeotic transformations throughout the trunk region along the
anterior posterior body axis that lead to an overall reduction of the number
of segments in the trunk.
Experiments in chick embryos indicated that psm cells become determined
with respect to the segmentation program and Hox gene expression in the
anterior third of the psm at a level referred to as the `determination front',
which appears to represent a threshold level of FGF8
(Dubrulle et al., 2001
).
Extended exposure of cells to FGF8 in the anterior psm of chick embryos
altered the position of somitic boundaries and shifted somitic Hox gene
expression boundaries anteriorly (Dubrulle
et al., 2001
), and hypo- and hypermorphic mutations in FGFR1
caused homeotic transformations and subtle shifts of Hox gene expression
borders in mouse embryos (Partanen et al.,
1998
), indicating that FGF signalling in the anterior psm has a
critical role in positioning Hox expression borders. In mouse embryos
transcriptional bursts of some Hox genes in the anterior psm correlated with
cyclic Lfng expression, which has led to the idea that
transcriptional regulation of Hox genes just prior to somite formation occurs
as a response to the cyclic outcome of Notch activity, which might couple
segmentation with the acquisition of axial identity
(Zakany et al., 2001
).
Transformations in vertebral identities along the anteroposterior body axis in
mice without Lfng function as well as with non-cyclic Lfng
expression in the psm provide direct experimental evidence that cyclic
Lfng activity is essential to coordinate the generation of segments
with their positional specification. Because the overall specification of
different anatomical regions was maintained, colinearity of Hox gene
expression was most probably not affected. It has been suggested
(Dubrulle et al., 2001
;
Zakany et al., 2001
) that
assigning precise combinatorial Hox gene expression to somites occurs in two
steps: first, most probably in precursors of the paraxial mesoderm prior to
their entering the psm, Hox clusters would be progressively opened and become
transcriptionally accessible. In the second step, in the anterior psm, the
definitive expression of Hox genes would be allocated to segmental units
coupled to the segmentation clock. Our results are consistent with a critical
role of Notch signalling and cyclic Lfng activity in the second step,
potentially after cells have passed the determination front. Thus, the
interplay of FGF and Notch signals in the anterior psm might set definitive
rostral Hox boundaries. Posterior transformations were achieved experimentally
in transgenic mice by ectopic anterior expression of posterior Hox genes
(Kessel et al., 1990
;
Lufkin et al., 1992
;
McLain et al., 1992
).
Likewise, loss of Lfng caused posterior transformations and an
anterior shift of Hoxb6 expression. This suggests that Lfng
activity in the psm is required to prevent ectopic activation, or spreading of
Hox gene expression anterior to their normal rostral expression boundaries.
Thus, formally cyclic Lfng represses Hox gene transcription during
setting the definitive anterior expression borders.
Taken together, our data demonstrate that both reduced Notch signalling without detected disruptions of cyclic gene expression in the psm as well as disrupted cyclic Lfng activity affect the positional specification of mesodermal derivatives along the anterior-posterior body axis. Thus, Notch signalling and most probably its cyclic modulation are required for the specification of vertebral identities.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Akasaka, T., Kanno, M., Balling, R., Mieza, M. A., Taniguchi, M.
and Koseki, H. (1996). A role for mel-18, a Polycomb
group-related vertebrate gene, during the anteroposterior specification of the
axial skeleton. Development
122,1513
-1522.[Abstract]
Aulehla, A. and Johnson, R. L. (1999). Dynamic
expression of lunatic fringe suggests a link between notch signaling and an
autonomous cellular oscillator driving somite segmentation. Dev.
Biol. 207,49
-61.[CrossRef][Medline]
Aulehla, A., Wehrle, C., Brand-Saberi, B., Kemler, R., Gossler,
A., Kanzler, B. and Herrmann, B. G. (2003). Wnt3a plays a
major role in the segmentation clock controlling somitogenesis.
Dev. Cell 4,395
-406.[CrossRef][Medline]
Beckers, J., Caron, A., Hrabe de Angelis, M., Hans, S.,
Campos-Ortega, J. A. and Gossler, A. (2000). Distinct
regulatory elements direct Delta1 expression in the nervous system and
paraxial mesoderm of transgenic mice. Mech. Dev.
95, 23-34.[CrossRef][Medline]
Beddington, R. S., Puschel, A. W. and Rashbass, P.
(1992). Use of chimeras to study gene function in mesodermal
tissues during gastrulation and early organogenesis. Ciba Found.
Symp. 165,61
-74.[Medline]
Bessho, Y., Sakata, R., Komatsu, S., Shiota, K., Yamada, S. and
Kageyama, R. (2001). Dynamic expression and essential
functions of Hes7 in somite segmentation. Genes Dev.
15,2642
-2647.
Burke, A. C. (2000). Hox genes and the global
patterning of the somitic mesoderm. In Somitogenesis.
Vol. 1 (ed. C. Ordahl), pp.155
-183. London, San Diego: Academic
Press.
Chitnis, A., Henrique, D., Lewis, J., Ish Horowicz, D. and
Kintner, C. (1995). Primary neurogenesis in Xenopus
embryos regulated by a homologue of the Drosophila neurogenic gene
Delta. Nature
375,761
-766.[CrossRef][Medline]
Conlon, R. A., Reaume, A. G. and Rossant, J.
(1995). Notch1 is required for the coordinate
segmentation of somites. Development
121,1533
-1545.[Abstract]
del Barco Barrantes, I., Elia, A. J., Wünsch, K., Hrabe De
Angelis, M., Mak, T. W., Rossant, R., Conlon, R. A., Gossler, A. and de la
Pompa, J.-L. (1999). Interaction between L-fringe and Notch
signalling in the regulation of boundary formation and posterior identity in
the presomitic mesoderm of the mouse. Curr. Biol.
9, 470-480.[CrossRef][Medline]
Duboule, D. (1994). Temporal colinearity and
the phylotypic progression: a basis for the stability of a vertebrate Bauplan
and the evolution of morphologies through heterochrony. Development
Supplement, 135-142.
Dubrulle, J., McGrew, M. J. and Pourquie, O.
(2001). FGF signaling controls somite boundary position and
regulates segmentation clock control of spatiotemporal Hox gene activation.
Cell 106,219
-232.[CrossRef][Medline]
Evrard, Y. A., Lun, Y., Aulehla, A., Gan, L. and Johnson, R.
L. (1998). lunatic fringe is an essential mediator
of somite segmentation and patterning. Nature
394,377
-381.[CrossRef][Medline]
Forsberg, H., Crozet, F. and Brown, N. A.
(1998). Waves of mouse Lunatic fringe expression, in four-hour
cycles at two-hour intervals, precede somite boundary formation.
Curr. Biol. 8,1027
-1030.[CrossRef][Medline]
Gossler, A. and Hrabe de Angelis, M. (1998).
Somitogenesis. Curr. Top. Dev. Biol.
38,225
-287.[Medline]
Gossler, A. and Tam, P. P. L. (2002).
Somitogenesis: segmentation of the paraxial mesoderm and the delineation of
tissue compartments. In Mouse Development (ed. J.
Rossant and P. P. L. Tam), pp. 127-153. San Diego:
Academic Press.
Haraguchi, S., Kitajima, S., Takagi, A., Takeda, H., Inoue, T.
and Saga, Y. (2001). Transcriptional regulation of Mesp1 and
Mesp2 genes: differential usage of enhancers during development.
Mech. Dev. 108,59
-69.[CrossRef][Medline]
Henrique, D., Hirsinger, E., Adam, J., Le Roux, I., Pourquie,
O., Ish-Horowicz, D. and Lewis, J. (1997). Maintenance of
neuroepithelial progenitor cells by Delta-Notch signalling in the embryonic
chick retina. Curr. Biol.
7, 661-670.[CrossRef][Medline]
Hogan, B., Holland, P. and Schofield, P.
(1985). How is the mouse segmented? Trends
Genet. 1,67
-74.[CrossRef]
Hrabé de Angelis, M., McIntyre II, J. and Gossler, A.
(1997). Maintenance of somite borders in mice requires the
Delta homologue Dll1. Nature
386,717
-721.[CrossRef][Medline]
Huppert, S. S., Le, A., Schroeter, E. H., Mumm, J. S., Saxena,
M. T., Milner, L. A. and Kopan, R. (2000). Embryonic
lethality in mice homozygous for a processing-deficient allele of Notch1.
Nature 405,966
-970.[CrossRef][Medline]
Ikeya, M. and Takada, S. (2001). Wnt-3a is
required for somite specification along the anteroposterior axis of the mouse
embryo and for regulation of cdx-1 expression. Mech.
Dev. 103,27
-33.[CrossRef][Medline]
Jeannotte, L., Lemieux, M., Charron, J., Poirier, F. and
Robertson, E. J. (1993). Specification of axial identity in
the mouse: role of the Hoxa-5 (Hox1.3) gene. Genes
Dev. 7,2085
-2096.
Jiang, Y. J., Aerne, B. L., Smithers, L., Haddon, C.,
Ish-Horowicz, D. and Lewis, J. (2000). Notch signalling and
the synchronization of the somite segmentation clock.
Nature 408,475
-479.[CrossRef][Medline]
Jouve, C., Palmeirim, I., Henrique, D., Beckers, J., Gossler,
A., IshHorowcz, D. and Pourquié, O. (2000). Notch
signaling is required for cyclic expression of the hairy-like gene HES1 in the
presomitic mesoderm. Development
127,1421
-1429.[Abstract]
Kessel, M. (1991). Molecular coding of axial
positions by Hox genes. Dev. Biol.
2, 367-373.
Kessel, M. and Gruss, P. (1991). Homeotic
transformations of murine vertebrae and concomitant alteration of Hox codes
induced by retinoic acid. Cell
67, 89-104.[CrossRef][Medline]
Kessel, M., Balling, R. and Gruss, P. (1990).
Variations of cervical vertebrae after expression of a Hox-1.1
transgene in mice. Cell
61,301
-308.[CrossRef][Medline]
Kieny, M., Mauger, A. and Sengel, P. (1972).
Early regionalization of the somite mesoderm as studied by the development of
the axial skeleton of the chick embryo. Dev. Biol.
28,142
-161.[CrossRef][Medline]
Krumlauf, R. (1994). Hox genes in vertebrate
development. Cell 78,191
-201.[CrossRef][Medline]
Kusumi, K., Sun, E. S., Kerrebrock, A. W., Bronson, R. T., Chi,
D.-C., Bulotsky, M. S., Spencer, J. B., Birren, B. W., Frankel, W. N. and
Lander, E. S. (1998). The mouse pudgy mutation disrupts
Delta homologue Dll3 and initiation of early somite
boundaries. Nat. Genet.
19,274
-278.[CrossRef][Medline]
Leitges, M., Neidhardt, L., Haenig, B., Herrmann, B. G. and
Kispert, A. (2000). The paired homeobox gene Uncx4.1
specifies pedicles, transverse processes and proximal ribs of the vertebral
column. Development 127,2259
-2267.[Abstract]
Lescher, B., Haenig, B. and Kispert, A. (1998).
sFRP-2 is a target of the Wnt-4 signaling pathway in the developing
metanephric kidney. Dev. Dyn.
213,440
-451.[CrossRef][Medline]
Lufkin, T., Mark, M., Hart, C. P., Dolle, P., LeMeur, M. and
Chambon, P. (1992). Homeotic transformation of the occipital
bones of the skull by ectopic expression of a homeobox gene.
Nature 359,835
-841.[CrossRef][Medline]
Mansouri, A., Voss, A. K., Thomas, T., Yokota, Y. and Gruss,
P. (2000). The mouse homeobox gene Uncx4.1 acts downstream of
Notch and directs the formation of skeletal structures.
Development 127,2251
-2258.[Abstract]
McGrew, M. J., Dale, J. K., Fraboulet, S. and Pourquie, O.
(1998). The lunatic Fringe gene is a target of the molecular
clock linked to somite segmentation in avian embryos. Curr.
Biol. 8,979
-982.[CrossRef][Medline]
McLain, K., Schreiner, C., Yager, K. L., Stock, J. L. and
Potter, S. S. (1992). Ectopic expression of Hox-2.3
induces craniofacial and skeletal malformations in transgenic mice.
Mech. Dev. 39,3
-16.[CrossRef][Medline]
Meinhardt, H. (1986). Models of segmentation.
In Somites in Developing Embryos. Vol. Life Sciences
118 (ed. R. Bellairs, D. A. Ede and J. W. Lash), pp.179
-189. New York: Plenum Press.
Ohtsuka, T., Ishibashi, M., Gradwohl, G., Nakanishi, S.,
Guillemot, F. and Kageyama, R. (1999). Hes1 and Hes5 as notch
effectors in mammalian neuronal differentiation. EMBO
J. 18,2196
-2207.[CrossRef][Medline]
Palmeirim, I., Henrique, D., Ish-Horowicz, D. and Pourquie,
O. (1997). Avian hairy gene expression identifies a molecular
clock linked to vertebrate segmentation and somitogenesis.
Cell 91,639
-648.[CrossRef][Medline]
Partanen, J., Schwartz, L. and Rossant, J.
(1998). Opposite phenotypes of hypomorphic and Y766
phosphorylation site mutations reveal a function for Fgfr1 in anteroposterior
patterning of mouse embryos. Genes Dev.
12,2332
-2344.
Ramirez-Solis, R., Zheng, H., Whiting, J., Krumlauf, R. and
Bradley, A. (1993). Hoxb-4 (Hox-2.6) mutant
mice show homeotic transformation of a cervical vertebra and defects in the
closure of the sternal rudiments. Cell
73,279
-294.[CrossRef][Medline]
Rancourt, D. E., Tsuzuki, T. and Capecchi, M. R.
(1995). Genetic interaction between hoxb-5 and hoxb-6 is revealed
by nonallelic noncomplementation. Genes Dev.
9, 108-122.
Schuster-Gossler, K., Simon Chazottes, D., Guénet, J.-L.,
Zachgo, J. and Gossler, A. (1996).
Gtl2lacZ, an insertional mutation on mouse Chromosome 12
with parental origin-dependent phenotype. Mamm. Genome
7, 20-24.[CrossRef][Medline]
Serth, K., Schuster-Gossler, K., Cordes, R. and Gossler, A.
(2003). Transcriptional oscillation of Lfng is essential for
somitogenesis. Genes Dev.
17,912
-925.
Shimizu, K., Chiba, S., Saito, T., Kumano, K., Hamada, Y. and
Hirai, H. (2002). Functional diversity among Notch1, Notch2,
and Notch3 receptors. Biochem. Biophys. Res. Commun.
291,775
-779.[CrossRef][Medline]
Subramanian, V., Meyer, B. I. and Gruss, P.
(1995). Disruption of the murine homeobox gene Cdx1 affects axial
skeletal identities by altering the mesodermal expression domains of Hox
genes. Cell 83,641
-653.[CrossRef][Medline]
Swiatek, P. J., Lindsell, C. E., Franco Del Amo, F., Weinmaster,
G. and Gridley, T. (1994). Notch1 is essential for
postimplantation development in mice. Genes Dev.
8, 707-719.
Takahashi, Y., Inoue, T., Gossler, A. and Saga, Y.
(2003). Feedback loops comprising Dll1, Dll3 and Mesp2, and
differential involvement of Psen1 are essential for rostrocaudal patterning of
somites. Development
130,4259
-4268.
Takahashi, Y., Koizumi, K., Takagi, A., Kitajima, S., Inoue, T.,
Koseki, H. and Saga, Y. (2000). Mesp2 initiates somite
segmentation through the Notch signalling pathway. Nat.
Genet. 25,390
-396.[CrossRef][Medline]
Wilkinson, D. G. (1992). Whole mount in situ
hybridization of vertebrate embryos. In In Situ Hybridization: A
Practical Approach (ed. D. G. Wilkinson), pp.75
-84. Oxford: Oxford University Press.
Zakany, J., Gerard, M., Favier, B. and Duboule, D.
(1997). Deletion of a HoxD enhancer induces transcriptional
heterochrony leading to transposition of the sacrum. EMBO
J. 16,4393
-4402.[CrossRef][Medline]
Zakany, J., Kmita, M., Alarcon, P., de la Pompa, J. L. and
Duboule, D. (2001). Localized and transient transcription of
Hox genes suggests a link between patterning and the segmentation clock.
Cell 106,207
-217.[CrossRef][Medline]
Zhang, N. and Gridley, T. (1998). Defects in
somite formation in lunatic fringe-deficient mice.
Nature 394,374
-377.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
F. Galis and J. A. J. Metz Evolutionary novelties: the making and breaking of pleiotropic constraints Integr. Comp. Biol., September 1, 2007; 47(3): 409 - 419. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Geffers, K. Serth, G. Chapman, R. Jaekel, K. Schuster-Gossler, R. Cordes, D. B. Sparrow, E. Kremmer, S. L. Dunwoodie, T. Klein, et al. Divergent functions and distinct localization of the Notch ligands DLL1 and DLL3 in vivo J. Cell Biol., July 24, 2007; 178(3): 465 - 476. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Pilon, K. Oh, J.-R. Sylvestre, J. G. A. Savory, and D. Lohnes Wnt signaling is a key mediator of Cdx1 expression in vivo Development, June 15, 2007; 134(12): 2315 - 2323. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mikawa, T. Morozumi, S.-I. Shimanuki, T. Hayashi, H. Uenishi, M. Domukai, N. Okumura, and T. Awata Fine mapping of a swine quantitative trait locus for number of vertebrae and analysis of an orphan nuclear receptor, germ cell nuclear factor (NR6A1) Genome Res., May 1, 2007; 17(5): 586 - 593. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Rubio-Aliaga, D. Soewarto, S. Wagner, M. Klaften, H. Fuchs, S. Kalaydjiev, D. H. Busch, M. Klempt, B. Rathkolb, E. Wolf, et al. A Genetic Screen for Modifiers of the Delta1-Dependent Notch Signaling Function in the Mouse Genetics, March 1, 2007; 175(3): 1451 - 1463. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Carapuco, A. Novoa, N. Bobola, and M. Mallo Hox genes specify vertebral types in the presomitic mesoderm Genes & Dev., September 15, 2005; 19(18): 2116 - 2121. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Deschamps and J. van Nes Developmental regulation of the Hox genes during axial morphogenesis in the mouse Development, July 1, 2005; 132(13): 2931 - 2942. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Dubrulle and O. Pourquie Coupling segmentation to axis formation Development, December 1, 2004; 131(23): 5783 - 5793. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||