|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online March 30, 2004
doi: 10.1242/10.1242/dev.01032





1 Departments of Developmental Biology and Genetics, Stanford University School
of Medicine, Beckman Center B300, 279 Campus Drive, Stanford, CA 94305-5329,
USA
2 Department of Zoology, University of Oxford, South Parks Road, Oxford OX1 3PS,
UK
Author for correspondence (e-mail:
helen.white-cooper{at}zoo.ox.ac.uk)
Accepted 11 December 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Spermatogenesis, Transcription, Chromatin, Meiosis, Differentiation
| Introduction |
|---|
|
|
|---|
Males mutant for any of the meiotic arrest genes [including always
early (aly), cannonball (can), meiosis I
arrest (mia), spermatocyte arrest (sa),
cookie monster (comr), achintya/vismay
(achi/vis) and no-hitter (nht)] are viable but
sterile. Testes from flies mutant for any one of these genes contain
morphologically normal spermatogenic cells up to mature primary spermatocytes.
However, the mutant cells then arrest and fail to initiate either the meiotic
divisions or spermatid differentiation
(Ayyar et al., 2003
;
Jiang and White-Cooper, 2003
;
Lin et al., 1996
). Although
transcription of a number of broadly expressed genes (such as cyclin
A) is normal in the mutant spermatocytes, transcription of many
spermiogenesis genes (e.g. the mitochondrial fusion protein fzo) is
very low or undetectable. The aly-class meiotic arrest genes
(aly, comr, achi/vis) are likely to act in a pathway distinct from
the can-class genes, because they are required for transcription of a
wider range of target genes. In addition to a role in transcription of
spermiogenesis genes, aly-class genes are also essential for the
transcriptional activation in primary spermatocytes of several genes required
for progression into the meiotic divisions (namely twine, cycB,
boule). By contrast can, mia, sa and nht (can-class
genes) are not required for transcription of these cell cycle genes; however,
they are required for translation of twine. The can-class meiotic
arrest genes analysed to date encode testis specific homologues of more
generally transcribed TATA-binding protein associated factors (TAFs)
(Aoyagi and Wassarman, 2000
;
Hiller et al., 2001
) (M.H. and
M.T.F., unpublished). TAFs are subunits of the basal transcription factor
TFIID, which is involved in recruitment of the RNA polymerase II holoenzyme to
the proximal promoter region. Thus, the can-class genes are likely to
activate full levels of transcription of spermatid differentiation genes
through intimate association with target promoters
(Hochheimer and Tjian,
2003
).
Not all genes transcribed in primary spermatocytes are controlled by the
meiotic arrest pathway, so it is likely the targeting of particular promoters
is mediated through sequence-specific DNA-binding activity. Thus, we would
expect that one (or more) of the meiotic arrest genes encode a DNA-binding
protein(s), whereas others are likely to encode regulatory proteins.
aly is one of two Drosophila homologues of the C.
elegans vulval differentiation regulator, lin-9
(Beitel et al., 2000
;
White-Cooper et al., 2000
).
The SynMuvB pathway, in which lin-9 acts, is thought to negatively
regulate adoption of vulval fate and promote hypodermal fate, through
activation of a histone deacetylase chromatin remodelling complex
(Ferguson and Horvitz, 1989
;
Lu and Horvitz, 1998
;
Solari and Ahringer, 2000
).
comr encodes a novel acidic protein with no significant similarities
to other proteins in current sequence databases
(Jiang and White-Cooper,
2003
). achi/vis was the first meiotic arrest
locus to be shown to encode products with sequence-specific DNA-binding
activity (Ayyar et al., 2003
;
Wang and Mann, 2003
). The TALE
class homeodomain proteins encoded by the recent gene duplication pair
achi/vis are virtually identical to each other and are homologues of
the human TGIF sequence-specific DNA-binding factor
(Ayyar et al., 2003
;
Wang and Mann, 2003
). Both
achi and vis are expressed in many cells throughout
development. However, flies that are null mutant for both genes are viable but
male sterile, with a meiotic arrest phenotype. Achi/Vis proteins are localized
to chromatin in wild-type primary spermatocytes and in aly mutant
testes (Wang and Mann,
2003
).
Despite lacking any predicted DNA-binding motifs, both Aly and Comr
proteins are concentrated on chromatin in primary spermatocytes. However, the
nuclear localizations of Aly and Comr are mutually dependent: Aly remains
cytoplasmic in comr mutant testes and vice versa. By contrast, the
localization of Aly and Comr to the nucleus is independent of
achi/vis (Ayyar et al.,
2003
; Jiang and White-Cooper,
2003
; Wang and Mann,
2003
; White-Cooper et al.,
2000
). Aly, Comr and Achi/Vis co-immunoprecipitate from testis
protein extracts, suggesting that they interact in a common complex in vivo
(Wang and Mann, 2003
).
We describe the identification, cloning and characterization of the Drosophila aly-class meiotic arrest gene, matotopetli (topi). The similarity in phenotype between topi and aly, comr and achi/vis suggests that these genes act together in a common pathway. topi encodes a testis-specific predicted Zn-finger protein, making Topi the second putative sequence-specific transcription factor to be placed into the aly class. At least two separate Zn-finger containing regions of Topi are sufficient to bind directly to a 100 amino acid region in the middle of the Comr protein. Like achi/vis, topi activity is not required for the nuclear localization of Aly and Comr proteins. We suggest that the DNA-binding activities of Topi and Achi/Vis are required to recruit Aly and Comr to the promoters of target genes in primary spermatocytes. Consistent with this idea, the majority of target genes require both the topi and achi/vis DNA-binding factors for full transcriptional activation. However, rare exceptions to this rule have been revealed via microarray analysis. A small number of target promoters rely to a much greater extent on one or other of these DNA-binding activities, indicating that in at least some contexts the activities of achi/vis and topi are independent.
| Materials and methods |
|---|
|
|
|---|
Microscopy and immunofluorescence
Live testes were dissected, squashed in 4 µg/ml Hoechst 33342 in testis
buffer (183 mM KCl, 47 mM NaCl, 10 mM Tris pH 6.8) and examined by phase
contrast and fluorescence microscopy. topi mutant testes contained
many balls of cells, and no elongating cysts, hence the name
matotopetli, which means `balls' in the Aztec language, nahuatl. Aly
and Comr proteins were visualized using a BioRad Radiance Plus confocal
microscope, using rabbit anti-Aly or rabbit anti-Comr antibodies detected with
FITC-conjugated secondary antibodies (Sigma), DNA was co-stained with
propidium iodide (Jiang and White-Cooper,
2003
; White-Cooper et al.,
2000
). Phase contrast images were captured using a Photometrics
cooled CCD camera connected to a Zeiss Axiophot microscope, or a Q-imaging
Retiga 1300 CCD camera linked to an Olympus BX50 microscope using IP Lab
Spectrum or Openlab software (Improvision) and then imported into Photoshop.
Images of RNA in situ hybridization to testes were captured on colour slide
film, this was scanned and imported into Photoshop.
Northern blotting and in situ hybridization
Northern blotting of poly-A+ RNA from whole males, whole female, agametic
males and embryos using topi and rp49 probes was carried out
as described previously (Hiller et al.,
2001
). RNA in situ hybridization was carried out as previously
described (White-Cooper et al.,
1998
). Dig-labelled RNA probes were generated using dig-RNA
labelling mix (Roche). Probes for topi, cyclinA, cyclinB, twine, fzo
and Mst87F were generated by transcription off a linearized
cDNA-clone plasmid. For TrxT and CG8349 a T3 RNA polymerase
promoter was included in the 3' RT-PCR primer, and purified PCR product
was used as the template for transcription of the labelled RNA probe.
Microarray analysis and RT-PCR
Full details of the microarray analysis will be presented elsewhere. Testes
and seminal vesicles were dissected from 0- to 1-day-old males homozygous for
red e (control), aly5, can3,
comrz1340, achiZ3922visZ3922 and
topiZ3-2139 in testis buffer, and placed at
80°C within 30 minutes of dissection. For each genotype, three
independent RNA samples were made from 200 testes. Testes were homogenized in
Trizol (Roche), then shipped on dry ice to the BBSRC IGF facility in Glasgow
for RNA extraction, labelling and Affymetrix array hybridization
(http://www.mblab.gla.ac.uk/igf/index.html).
Total RNA (6 µg) per sample was used for probe synthesis. Normalized signal
intensities were averaged over the three replicates and compared between
genotypes. Genes were selected for analysis from a list of genes expressed in
wild-type testes where the mean signal for topi was eight times
higher or lower than that for achi/vis. P values were calculated with
a one tailed t-test on this pair of samples.
For RT-PCR, total RNA was extracted from dissected testes with Trizol reagent. The RNA was resuspended in RNAse free water at a concentration of three testes worth/µl. First-strand cDNA from 4 µl of this sample was generated using oligo-dT primers with the SuperScript II reverse transcriptase system (Invitrogen) following the manufacturer's instructions. As a negative control, wild-type testis RNA was used as the template and reverse transcriptase was omitted from the reaction. cDNA derived from 0.18 testes was used for each RT-PCR reaction and amplified with Taq DNA polymerase (Qiagen) with 24 amplification cycles. Genomic DNA from wild-type flies was used as a positive PCR control.
PCR primers (synthesized by MWG) were designed to amplify 400-1000 bp fragments from the transcript of the genes of interest. The T3 RNA polymerase promoter site, preceded by 6 bp of random sequence, was incorporated into the 3' primer to facilitate production of RNA probes directly from the RT-PCR product. Primer sequences were: CG8349-5' GCTCCTTCAGCGCTACATGC; CG8349-3'T3 GCAACGAATTAACCCTCACTAAAGGGCGCATAGGCACATCG; TrxT-5' TCGGCGAGGGCAGAGCTC; TrxT-3'T3 GCAACGAATTAACCCTCACTAAAGGGCATTCTCGTCGTGGGC.
Cloning of topi
topi was mapped by recombination between th and
cu, and further localized by deficiency complementation to polytene
interval 85E9-13. The topi region was defined by the right
breakpoints of Df(3R)GB104, which complemented
topi, and Df(3R)by10, which failed to
complement topi. This identified a 60 kb region of genomic DNA
containing 23 predicted genes. We used representation of ESTs from different
tissues as a crude guide to the expression pattern of these genes. Seventeen
were not represented in the EST set derived from testis. Four had ESTs from
both testis and other tissues, and two (CG8484 and CG8526)
had ESTs from only testis libraries. The premature stop codons in
topiZ3-2139 and topiZ3-0707 and the
mis-sense mutation in topiZ3-3767 were identified by PCR
amplifying the genomic region containing CG8484 from homozygous
males, and sequencing the bulk PCR product. Predicted Zn-finger motifs within
Topi were identified by eye and using the InterPro analysis tool
(http://www.ebi.ac.uk/InterProScan/).
topi homologues from Anopheles gambiae (on AAAB01008944.1)
and Drosophila pseudoobscura (on Contig815_Contig5737) were
identified using Blast searches of the genome sequence databases.
Yeast two hybrid interaction screen
A Comr-Gal4-DNA-binding-domain fusion construct was made by subcloning the
ORF from a full-length comr cDNA clone into the vector pGBKT7 using
NdeI (at the start codon) and NotI. As no testis cDNA
libraries suitable for two-hybrid screening were available, we generated and
screened a testis cDNA-Gal4-Activation Domain (AD) fusion protein library by
in vivo recombination using the Matchmaker library construction and screening
kit (Clontech). Total RNA (1 µg), isolated from wild-type testes with
Trizol, was used to synthesize first-strand cDNA using an oligo d(T) primer.
Double-strand cDNA was synthesized with SMART III and CDS III anchors. The AD
fusion library construction and two-hybrid screen were carried out in one step
by co-transforming the yeast strain AH109 with ds cDNA, pGADT7-Rec and
pGBKT7/comr. Colonies were picked from SD/-Ade/-His/-Leu/-Trp/X-
-Gal
selection plates after 7 days. A screen of 106 independent
co-transformants yielded 39 colonies that grew under selective conditions and
were blue in the presence of X-
-Gal. AD/library plasmids were isolated
from each positive yeast colony, transformed into E. coli and
sequenced; one of the positive clones contained the full ORF of CG8484
topi.
Deletion analysis plasmid construction
Determination of the protein interaction domains necessitated construction
of comr and topi deletion series. PCR products for the
deletion derivatives were subcloned into pGBKT7 using NdeI and
NotI sites engineered into the primers. Co-transformation of HA109
cells was with pGADT7-RecTopi (full length Topi) or pGADT7-RecComr (full
length Comr) as appropriate. A 622 bp fragment covering five zinc fingers in
Kruppel was generated by PCR from wild-type genomic DNA.
Transfection, expression and immunoprecipitation in mammalian tissue culture cells
The Topi ORF was subcloned into HA-tagged pCDEF3 and the Comr ORF into
FLAG-tagged pCDEF3 respectively at NdeI and NotI sites. 293T
cells were cultured in DMEM with 10% FCS to 90% confluence then co-transfected
with 10 µg HA-tagged Topi and Flag-tagged Comr using Lipofectamine 2000
reagent (Invitrogen). As a negative control, 293T cells were co-transfected
with HA-tagged Topi and Flag-tagged human Smad1. Forty-eight hours after
transfection, cells were collected and processed for immunoprecipitation
(Bennett and Alphey, 2002
),
except that protein G sepharose incubation was carried out at 4°C
overnight.
| Results |
|---|
|
|
|---|
|
matotopetli belongs to the aly-class of meiotic arrest genes
RNA in situ hybridization analysis of the effects of topi mutants
on transcription of meiotic cell cycle and spermatid differentiation genes
placed topi into the aly class of meiotic arrest mutants.
The two strong alleles of topi showed greatly reduced levels of
expression in primary spermatocytes of the meiotic cell cycle transcripts
twine, cyclin B (Fig.
2C-F) and boule (not shown). The transcript levels of
several spermatid differentiation genes, including fzo and
Mst87F, were also dramatically reduced compared with wild-type levels
(Fig. 2G-J). Some expression of
fzo was detected in topiZ3-3767 mutant testes,
consistent with the weaker phenotype seen in this allele by phase-contrast
microscopy (data not shown).
|
|
topi encodes a 814 amino acid multiple Zn-finger predicted protein with a predicted molecular weight of 92 kDa (Fig. 4). A near full length cDNA isolated from testes (AT25463) was identified in the BDGP EST project and was fully sequenced. The conceptually translated Topi protein contains 10 C2H2 and one C2HC class Zn fingers predicted by the PFAM and prosite protein domain analysis tools. The predicted Zn fingers are clustered in the central region of the protein (amino acids 230-650), with the first two fingers being separated from the remaining nine by a 64 amino acid spacer. The mis-sense mutation in topiZ3-3767 alters a conserved residue, G(516)D, just after the second Zn-binding cystine in the seventh predicted Zn finger. The non-sense mutation in topiZ3-0707 would truncate the protein after the first predicted Zn finger (at amino acid 261). The non-sense mutation in topiZ3-2139 would truncate the predicted Topi protein within the seventh predicted Zn finger (amino acid 521), potentially encoding a protein with six Zn fingers. Blast searches were used to identify putative topi orthologues, with sequence conservation extending beyond the Zn finger domains, in the mosquito Anopheles gambiae and in Drosophila pseudoobscura. Unlike both fly genes, the mosquito protein had only 10 predicted Zn fingers owing to lack of three crucial Zn-binding residues from the second Zn finger.
|
|
|
Differential requirements for topi and achi/vis for expression of some target genes
To explore whether topi and achi/vis might
differ in their target gene specificities, we carried out a set of DNA
microarray experiments to examine gene expression in wild-type and meiotic
arrest mutant testes (see Materials and methods) (H.W.-C., unpublished). About
1000 genes were expressed at reduced levels (at least fourfold) in
aly-class meiotic arrest mutants than in wild type, most of these
transcriptional targets of the meiotic arrest genes depended equally on the
functions of aly, comr, topi and achi/vis.
However, transcription of a subset (about 42) of genes was much more dependent
on achi/vis than on any of the other meiotic arrest loci.
Transcription of a different subset (about 44) of genes seemed to be much more
dependent on topi. The raw and log ratio array data for these genes
are presented in Table S1 at
http://dev.biologists.org/supplemental/,
along with data for genes whose expression in wild-type and meiotic arrest
mutant testes has already been examined by RNA in situ hybridization or
northern blotting (White-Cooper et al.,
1998
). Further analysis of representative genes by RT-PCR from
wild-type and mutant testes confirmed the achi/vis versus
topi differential dependence.
CG8349 encodes a predicted cytidine deaminase. 11 testis ESTs for this gene have been sequenced, no CG8349 ESTs have been sequenced from other tissue libraries, indicating that CG8349 transcription is highly testis enriched. Microarray analysis indicated that expression of this gene was approximately five times lower in aly, comr and topi than in wild type, while expression of CG8349 was reduced by two-hundred times in achi/vis compared with wild type. By RT-PCR, we found that CG8349 transcript was detectable, but levels were dramatically reduced in aly, comr, topi, mia and sa mutant testes. However, no transcript was detected in achi/vis mutant testes (Fig. 7A). To further investigate these changes in gene expression, we used in situ hybridization against wild-type and mutant testes. The relative level of transcript can be compared between wild-type and mutant testes using this method as the tissues were mixed before hybridization. In situ hybridization revealed that CG8349 was expressed in primary spermatocytes, and the transcript persisted into mid-late stages of spermatid elongation (Fig. 7B). As predicted by the RT-PCR and array analysis, the in situ hybridization signal intensity for CG8349 was lower than wild type in aly, comr and topi testes (Fig. 7C,E), and the transcript was undetectable by in situ hybridization in achi/vis mutant testes (Fig. 7D).
|
| Discussion |
|---|
|
|
|---|
|
It is intriguing that transcription of some genes (including TrxT
and CG8349) showed a strong requirement for topi but not
achi/vis (or vice versa), and that expression of these genes
was less strongly dependent on the activity of the other meiotic arrest genes.
This indicates that, at least in these contexts, the binding of the Achi/Vis
and Topi transcription factors to DNA is independent. Another feature these
genes have in common is that they are members of clusters of related genes,
with different expression patterns. TrxT is found adjacent in the
genome to the female specific thioredoxin, deadhead
(Svensson et al., 2003
).
CG8349 is the 3'-most of a cluster of three predicted cytidine
deaminase genes (the others being CG8360 and CG8353). The
structure of these promoters may differ from the canonical structure for
meiotic arrest target genes, perhaps by having several binding sites for only
one of the aly-class transcription factors. In this situation partial
activation of gene expression would be achieved on binding of one
transcription factor. Further recruitment of Aly and Comr (and usually the
other DNA-binding factor) would be needed for the robust expression levels
seen in wild type.
Functional domains within the Topi protein
The meiotic arrest gene topi encodes a protein with multiple Zn
fingers. The final five Zn-fingers of Topi form an evolutionarily constrained
unit, which we suggest may function via sequence specific DNA binding
activity. topi has a large number of transcriptional targets
(H.W.-C., unpublished). If, as is likely, Topi binds directly to cis
acting regulatory elements associated with target genes in a sequence-specific
manner, we would expect the protein sequence in the DNA-binding domain to be
evolutionarily constrained. Changes in the affinity of Topi for any particular
DNA sequence would have to be compensated for by changes in the sequence of a
great many promoters, and are therefore likely to be selected against.
Conservation of topi protein sequences within Diptera is extremely
high across the final five Zn-finger motifs, and much lower across the first
six Zn-fingers and at the termini. This conservation is particularly apparent
in the loop regions of the final five Zn fingers, which are likely to be
exposed, and important for interaction with DNA. Additionally these final five
Zn finger motifs are more similar to those found in many transcription factors
from other taxa. topiZ3-2139 has a non-sense mutation that
would truncate the protein before this predicted DNA binding region, and would
presumably therefore be unable to bind DNA. The mis-sense mutation in the
hypomorphic allele topiZ3-3767 may reduce the affinity of
the protein for its target site, but not totally abolish DNA-binding activity,
thus allowing some residual function.
We propose that the first Zn finger of Topi is most important for the
binding to Comr. Zn-finger motifs were first identified as nucleic acid
binding domains. However Zn fingers are also known to be important for some
protein-protein interactions (Evans and
Hollenberg, 1988
; Tsai and
Reed, 1998
). There is precedent among known Zn-finger
transcription factors, as we propose for Topi, for certain of the fingers to
bind proteins, while others contact the DNA, allowing the transcription factor
to target a multi-subunit complex to specific promoters
(Kalenik et al., 1997
). The
Topi protein interacts structurally with Comr, and the region of Topi
containing the first two Zn fingers was sufficient for interaction with Comr
in yeast two hybrid assays. We propose that the first Zn finger is more
important for Comr binding because the second of the two Zn fingers in
mosquito Topi lacks crucial Zn-binding residues, so is unlikely to form a
conventional finger structure in the folded protein. The final five Zn
fingers, which we propose function primarily as DNA-binding motifs, also
showed some Comr-binding activity in the yeast two-hybrid system. This
interaction may stabilize, or increase the binding affinity of, the Topi-Comr
complex. Strikingly, the N-terminal Comr binding region of topi is
much less well conserved than the last five Zn finger containing domain, even
among Diptera (D. melanogaster, D. pseudoobscura, A. gambiae). Also
apparent is the relatively low conservation within the loop regions of the Zn
fingers. If comr is rapidly evolving, the Comr interaction domains
within Comr-binding proteins would also be expected to show low levels of
conservation. It is possible that the N-terminal Zn-finger Comr-binding domain
of Topi has evolved rapidly in concert with the rapid evolution of Comr.
Searches of sequence databases had previously indicated failed to identify a
homologue of D. melanogaster comr in the genome sequence of A.
gambiae, which diverged from Drosophila 250 Mya
(Zdobnov et al., 2002
).
Partial sequence of a comr homologue (H.W.-C., unpublished) was found
in the set of unassembled genome sequence contigs from another Drosophilid,
D. pseudoobscura, which diverged from D. melanogaster 46 Mya
(Bergman et al., 2002
). The
conservation with D. melanogaster comr (31% identical, 52% similar)
was remarkably low considering the relatedness of the species. This relative
lack of conservation was apparent even in the Topi-binding region.
Transcriptional activation by the aly-class genes
The exact mechanism by which the aly homologue lin-9
functions is not well understood. However, some insight has been provided by
the molecular analysis of other genes in the C. elegans Syn-MuvB
pathway, including lin-35 (Rb, Retinoblastoma), lin-53
(RbAp48) and hda-1 (histone deacetylase)
(Lu and Horvitz, 1998
). Other
components of the NURD histone deacetylase and chromatin remodelling complex
also have SynMuvB activity (Solari and
Ahringer, 2000
). The biochemical function of NURD is to
de-acetylate histones and re-position nucleosomes
(Xue et al., 1998
;
Zhang et al., 1998
).
Typically, histone de-acetylation is associated with transcriptional
repression, although exceptions to this rule have been found
(De Rubertis et al., 1996
;
Struhl, 1998
). Another gene in
the SynMuvB pathway, lin-13, has been shown to encode a putative
Rb-interacting protein with multiple C2H2 Zn-fingers, which may be important
for targeting Rb and the NURD complex to specific sites
(Melendez and Greenwald,
2000
). The loop regions of the Zn fingers in LIN-13 showed no
significant similarity with those in Topi, however the two proteins could be
playing similar roles in linking lin-9 and NURD to target promoters.
Analogous to the C. elegans system, we have proposed that
aly, and by extension other genes in the same pathway as
aly, functions through a NURD-complex chromatin-remodelling activity.
Many genes require the aly-class meiotic arrest genes for activation
of expression in primary spermatocytes, while a few may require these genes
for transcriptional repression (H.W.-C., unpublished). Several SynMuvB genes
have also been shown to be important for expression of transgenes in
repetitive extrachromosomal arrays in C. elegans, indicating that, at
least in certain specific contexts, the SynMuvB pathway activates gene
expression (Hsieh et al.,
1999
). We favour a model in which the putative sequence-specific
DNA-binding proteins, Topi and Achi/Vis target Aly and Comr to specific
promoters, where Aly/Comr may then recruit a NURD complex to alter local
chromatin structure. In the second part of the model, transcription of
specific terminal differentiation genes in primary spermatocytes in some way
requires the altered chromatin structure set up by the function of the
Aly/Comr complex. The can-class meiotic arrest genes appear to form a
different functional module that is also required for normal levels of
transcription of many of the same target genes that require aly/comr.
So far, all of the can class meiotic arrest genes molecularly
identified encode homologues of subunits of TFIID. A TFIID complex containing
the testis specific TAFs encoded by the can-class meiotic arrest
genes may have a higher affinity for the altered chromatin conformation than
conventional TFIID, and thus be required for full transcriptional
activity.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
* Present address: Departamento de Genética y Fisiología
Molecular, Instituto de Biotecnología, UNAM, Avenida Universidad #2001
Col. Chamilpa Apdo. Postal 510-3, Cuernavaca, Mor. 62250 México ![]()
These authors contributed equally to the work ![]()
Present address: Department of Biological Sciences, Goucher College, 1021
Dulaney Valley Road, Baltimore, MD 21204-2794, USA ![]()
| REFERENCES |
|---|
|
|
|---|
Aoyagi, N. and Wassarman, D. A. (2000). Genes encoding Drosophila melanogaster RNA polymerase II general transcription factors: diversity in TFIIA and TFIID components contributes to gene-specific transcriptional regulation. J. Cell Biol. 150,F45 F49.
Ayyar, S., Jiang, J., Collu, A., White-Cooper, H. and White,
R. (2003). Drosophila TGIF is essential for
developmentally regulated transcription in spermatogenesis.
Development 130,2841
-2852.
Beitel, G. J., Lambie, E. J. and Horvitz, H. R. (2000). The C. elegans gene lin-9, which acts in an Rb-related pathway, is required for gonadal sheath cell development and encodes a novel protein. Gene 254,253 -263.[CrossRef][Medline]
Bennett, D. and Alphey, L. (2002). PP1 binds Sara and negatively regulates Dpp signaling in Drosophila melanogaster.Nat. Genet. 31,419 -423.[CrossRef][Medline]
Bergman, C., Pfeiffer, B., Rincón-Limas, D., Hoskins, R., Gnirke, A., Mungall, C., Wang, A., Kronmiller, B., Pacleb, J., Park, S. et al. (2002). Assessing the impact of comparative genomic sequence data on the functional annotation of the Drosophila genome. Genome Res. 3,research0086.1 -0086.20.
De Rubertis, F., Kadosh, D., Henchoz, S., Pauli, D., Reuter, G., Struhl, K. and Spierer, P. (1996). The histone deacetylase RPD3 counteracts genomic silencing in Drosophila and yeast. Nature 384,589 -591.[CrossRef][Medline]
Evans, R. and Hollenberg, S. (1988). Zinc fingers: gilt by association. Cell 52, 1-3.[CrossRef][Medline]
Ferguson, E. L. and Horvitz, H. R. (1989). The
multivulva phenotype of certain Caenorabditis elegans mutants results
from defects in two functionally redundant pathways.
Genetics 123,109
-121.
FlyBase (1999). The FlyBase database of the
Drosophila genome projects and community literature.
Nucleic Acids Res. 27,85
-88.
Fuller, M. T. (1993). Spermatogenesis. In The Development of Drosophila, Vol.1 (ed. M. Bate and A. Martinez-Arias), pp.71 -147. Cold Spring Harbor, New York: Cold Spring Harbor Press.
Hiller, M. A., Lin, T.-Y., Wood, C. and Fuller, M. T.
(2001). Developmental regulation of transcription by a
tissue-specific TAF homolog. Genes Dev.
15,1021
-1030.
Hochheimer, A. and Tjian, R. (2003).
Diversified transcription initiation complexes expand promoter selectivity and
tissue-specific gene expression. Genes Dev.
17,1309
-1320.
Hsieh, J., Liu, J., Kostas, S. A., Chang, C., Sternberg, P. W.
and Fire, A. (1999). The RING finger / B-Box factor TAM-1 and
a retinoblastoma-like protein LIN-35 modulate context-dependent gene silencing
in Caenorhabditis elegans. Genes Dev.
13,2958
-2970.
Jiang, J. and White-Cooper, H. (2003).
Transcriptional activation in Drosophila spermatogenesis involves the
mutually dependent function of aly and a novel meiotic arrest gene cookie
monster. Development
130,563
-573.
Kalenik, J. L., Chen, D., Bradley, M. E., Chen, S. J. and Lee,
T. C. (1997). Yeast two-hybrid cloning of a novel zinc finger
protein that interacts with the multifunctional transcription factor YY1.
Nucleic Acids Res. 25,843
-849.
Lin, T.-Y., Viswanathan, S., Wood, C., Wilson, P. G., Wolf, N. and Fuller, M. T. (1996). Coordinate developmental control of the meiotic cell cycle and spermatid differentiation in Drosophila males. Development 122,1331 -1341.[Abstract]
Lu, X. and Horvitz, R. H. (1998). lin-35 and lin-53, two gens that antagonize a C. elegans Ras pathway, encode proteins similar to Rb and its binding protein RbAp48. Cell 95,981 -991.[CrossRef][Medline]
Melendez, A. and Greenwald, I. (2000).
Caenorhabditis elegans lin-13, a member of the LIN-35 Rb class of
genes involved in vulval development, encodes a protein with Zinc fingers and
an LXCXE motif. Genetics
155,1127
-1137.
Olivieri, G. and Olivieri, A. (1965). Autoradiographic study of nucleic acid synthesis during spermatogenesis in Drosophila melanogaster. Mutat. Res. 2, 366-380.[Medline]
Schafer, M., Nayernia, K., Engel, W. and Schafer, U. (1995). Translational control in spermatogenesis. Dev. Biol. 172,344 -352.[CrossRef][Medline]
Solari, F. and Ahringer, J. (2000). NURD-complex genes antagonise Ras-inducted vulval development in Caenorhabditis elegans. Curr. Biol. 10,223 -226.[CrossRef][Medline]
Struhl, K. (1998). Histone acetylation and
transcriptional regulatory mechanisms. Genes Dev.
12,599
-606.
Svensson, M., Chen, J., Pirrotta, V. and Larsson, J. (2003). The ThioredoxinT and deadhead gene pair encode testis- and ovary-specific thioredoxins in Drosophila melanogaster.Chromosoma 112,133 -143.[CrossRef][Medline]
Tsai, R. and Reed, R. (1998). Identification of
DNA recognition sequences and protein interaction domains of the
multiple-Zn-finger protein Roaz. Mol. Cell. Biol.
18,6447
-6456.
Wang, Z. and Mann, R. S. (2003). Requirement
for two nearly identical TGIF-related homeobox genes in Drosophila
spermatogensis. Development
130,2853
-2865.
White-Cooper, H., Schafer, M. A., Alphey, L. S. and Fuller, M. T. (1998). Transcriptional and post-transcriptional control mechanisms coordinate the onset of spermatid differentiation with meiosis I in Drosophila. Development 125,125 -134.[Abstract]
White-Cooper, H., Leroy, D., MacQueen, A. and Fuller, M. T. (2000). Transcription of meiotic cell cycle and terminal differentiation genes depends on a conserved chromatin associated protein, whose nuclear localisation is regulated. Development 127,5463 -5473.[Abstract]
Xue, Y., Wong, J., Moreno, G. T., Young, M. K., Cote, J. and Wang, W. (1998). NURD, a novel complex with both ATP-dependent chromatin-remodeling and histone deacetylase activities. Mol. Cell 2,851 -861.[CrossRef][Medline]
Zdobnov, E., von Mering, C., Letunic, I., Torrents, D., Suyama,
M., Copley, R., Christophides, G., Thomasova, D., Holt, R., Subramanian, G. et
al. (2002). Comparative genome and proteome analysis of
Anopheles gambiae and Drosophila melanogaster.Science 298,149
-159.
Zhang, Y., Leroy, G., Seelig, H. P., Lane, W. S. and Reinberg, D. (1998). The dermatomyositis-specific autoantigen Mi2 is a component of a complex containing histone deacetylase and nucleosome remodeling activities. Cell 95,279 -289.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
S. Gao, M. G. Giansanti, G. J. Buttrick, S. Ramasubramanyan, A. Auton, M. Gatti, and J. G. Wakefield Australin: a chromosomal passenger protein required specifically for Drosophila melanogaster male meiosis J. Cell Biol., February 6, 2008; 180(3): 521 - 535. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Franklin-Dumont, C. Chatterjee, S. A. Wasserman, and S. DiNardo A novel eIF4G homolog, Off-schedule, couples translational control to meiosis and differentiation in Drosophila spermatocytes Development, August 1, 2007; 134(15): 2851 - 2861. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Beall, P. W. Lewis, M. Bell, M. Rocha, D. L. Jones, and M. R. Botchan Discovery of tMAC: a Drosophila testis-specific meiotic arrest complex paralogous to Myb-Muv B Genes & Dev., April 15, 2007; 21(8): 904 - 919. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Jiang, E. Benson, N. Bausek, K. Doggett, and H. White-Cooper Tombola, a tesmin/TSO1-family protein, regulates transcriptional activation in the Drosophila male germline and physically interacts with Always early Development, April 15, 2007; 134(8): 1549 - 1559. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Kostova, C.H. Yeung, C.M. Luetjens, M. Brune, E. Nieschlag, and J. Gromoll Association of three isoforms of the meiotic BOULE gene with spermatogenic failure in infertile men Mol. Hum. Reprod., February 1, 2007; 13(2): 85 - 93. [Abstract] [Full Text] [PDF] |
||||
![]() |
|