|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 17 March 2004
doi: 10.1242/dev.01066
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Animal Biology, School of Veterinary Medicine, University of
Pennsylvania, 3800 Spruce Street, Philadelphia, PA 19104, USA
2 Laboratory of Molecular Genetics, NICHD, NIH, Bethesda, MD 20892, USA
* Author for correspondence (e-mail: saintj{at}vet.upenn.edu)
Accepted 9 January 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Sox9, Tbx2, Pax8, Dlx3, Otic placode, Inner ear, Wnt, Fgf, Xenopus
| Introduction |
|---|
|
|
|---|
Classical transplantation experiments have shown that ear formation is
controlled by interactions with adjacent tissues including the hindbrain and
the paraxial mesoderm (Torres and
Giraldez, 1998
; Baker and
Bronner-Fraser, 2001
). Recent studies have implicated secreted
factors of the Fgf family (Vendrell et
al., 2000
; Ladher et al.,
2000
; Phillips et al.,
2001
; Adamska et al.,
2001
; Leger and Brand,
2002
; Liu et al.,
2003
; Wright and Mansour,
2003
; Alvarez et al.,
2003
), Wnt8C (Ladhler et al., 2000), retinoic acid
(Pasqualetti et al., 2001
) and
Shh (Riccomagno et al., 2002
;
Liu et al., 2002
) in the
specification and patterning of the inner ear in the vertebrate embryo.
The otocyst can be divided along its dorsoventral axis into three
functional domains. Ventrally, the cochlear region is responsible for the
sense of hearing; the medial region is implicated in the senses of motion and
position; and the dorsal region is involved in vestibular functions. In the
recent years, a number of transcription factors that show restricted
expression pattern in each of these functional domains have been identified.
These genes include Pax8, Pax2, Otx1, Prx1, Prx2, Six1, Tbx2 and
Hmx3 (reviewed by Torres and
Giraldez, 1998
; Baker and
Bronner-Fraser, 2001
). In the mouse, mutations in some of these
genes resulted in the loss of specific inner ear components, demonstrating the
importance of some of these transcription factors in the specification and
patterning of the inner ear (reviewed by
Fekete, 1999
).
The Sox proteins constitute a large family of transcriptional regulators
(Wegner, 1999
). They have been
implicated in the control of a broad range of developmental processes
(Kamachi et al., 2000
). One
member of this family, Sox9, has been shown to regulate chondrogenesis in the
mouse embryo (Wright et al.,
1995
; Bell et al.,
1997
; Bi et al.,
1999
; Bi et al.,
2001
). Mutations in one Sox9 allele result in campomelic
dysplasia, a lethal human disorder characterized by autosomal XY sex reversal
and severe skeletal malformations (Houston
et al., 1983
; Foster et al.,
1994
; Wagner et al.,
1994
). These symptoms have also been associated with deafness
(Houston et al., 1983
;
Savarirayan et al., 2003
),
consistent with Sox9 expression in the otic epithelium of several species
(Zhao et al., 1997
;
Ng et al., 1997
;
Spokony et al., 2002
;
Li et al., 2002
;
Liu et al., 2003
). However,
very little is known about the function of Sox9 during development of the
auditory system. We report experiments in Xenopus embryos that
analyze the function of Sox9 during inner ear development and that establishes
Sox9 as a key regulator of otic placode specification.
| Materials and methods |
|---|
|
|
|---|
C), in which the C-terminal domain
of XSox9 cDNA was deleted at amino acid 311, was generated by PCR (forward
primer, ATCGAT GCCACCATGAATCTCTTGGATCCC; reverse primer, CTCGAGCTGAGTGGAGCC
CAACCCCTG) and ligated into pGEMT. A hormone-inducible construct was generated
by fusing Sox9
C to the coding region of the human glucocorticoid
receptor ligand-binding domain (GR) as described
(Gammill and Sive, 1997
C-GR. Mouse Sox9
pCMV-SPORT6 (accession number BC023796) was obtained from Open Biosystems and
the ORF subcloned by PCR into the ClaI and XhoI sites of
pCS2+. All expression constructs were sequenced and the corresponding protein
monitored using an in vitro transcription/translation-coupled rabbit
reticulocyte lysate system in the presence of [35S] methionine
(Promega) and resolved on a NuPAGE BIS-Tris gel (Invitrogen).
Embryo injections and dexamethasone treatment
Dominant-negative Fgf receptor XFD/FgfR
(Amaya et al., 1991
) (2 ng),
GSK3ß (Saint-Jeannet et al.,
1997
) (1 ng), Sox9
C-GR (1 ng) and mouse Sox9 (2 ng) mRNAs
were synthesized in vitro using the Message Machine kit (Ambion, Austin, TX).
Sox9 morpholino antisense (Sox9-mo, 5-10 ng, GCAAAAATGGGGAAAGGTAAGAAAG)
(Spokony et al., 2002
), 5 bp
mismatched Sox9 morpholino antisense (Sox9-mis, 10 ng,
GGAAAAATCGGCAAAGCTAACAAAG),
standard control morpholino antisense (Co-mo, 10 ng), and Dlx3 morpholino
antisense (Dlx3-mo, 30 ng, ATAGTTTATTACCTGCGTCTGAGTG) were purchased from
GeneTools (Corvallis, OR). Synthetic mRNAs and morpholinos were injected in
one blastomere at the two-cell or eight-cell stage as described
(Saint-Jeannet et al., 1994
;
Saint-Jeannet et al., 1997
;
Spokony et al., 2002
). At the
eight-cell stage, one animal ventral cell was injected to target the otic
placode territory. Embryos injected with Sox9
C-GR mRNA were treated at
different time points (stage 6, 11, 15 or 20) with 10 µM of dexamethasone
(Sigma) in NAM 0.1x as described
(Gammill and Sive, 1997
;
Tada et al., 1997
;
Aoki et al., 2003
).
Lineage tracing and whole-mount in situ hybridization
In all experiments, embryos were co-injected with ß-galactosidase mRNA
(ß-gal, 1 ng). At stage 22 or 35 embryos were fixed in MEMFA
(Harland, 1991
) and
successively processed for Red-Gal (Research Organics) staining and in situ
hybridization. For the Dlx3-mo injections, a fluorescein-labeled control
morpholino (Genetools) was co-injected and used to identify the injected side
in a fluorescence microscope. Antisense DIG-labeled probes (Genius kit, Roche)
were synthesized using template cDNA encoding Tbx2
(Hayata et al., 1999
;
Takabatake et al., 2000
), Pax8
(Heller and Brandli, 1999
),
Otx2 (Pannese et al., 1995
),
Bmp4 (Jones et al., 1992
;
Kil and Collazo, 2001
), Xwnt3a
(Wolda et al., 1993
) and Sox9
(Spokony et al., 2002
).
Whole-mount in situ hybridization was performed as described
(Harland, 1991
). For
histology, stained embryos were embedded into Paraplast+, 12 µm sections
cut on a rotary microtome and counterstained with Eosin.
Western blot analysis
Sox9
C-GR-injected embryos were collected at different stages,
homogenized, resolved on a NuPAGE BIS-Tris gel and blotted onto
nitrocellulose. Blots were subsequently incubated in the presence of a Sox9
polyclonal antibody (P-20, Santa Cruz Biotechnology) at a 1:500 dilution,
washed and incubated with anti-goat Ig coupled to horseradish peroxidase
(Santa Cruz Biotechnology, 1:60,000 dilution). The product of the reaction was
revealed using the SuperSignal West Femto Maximum Sensitivity Substrate from
Pierce and detected by exposure onto a BioMax film (Kodak). Blots were
stripped according to the manufacturer recommendations (Pierce) and probed
with anti-
-tubulin antibody (T-9026, Sigma; 1:500 dilution) as a
loading control.
| Results |
|---|
|
|
|---|
|
Sox9 expression in the otic placode is regulated by Wnt and Fgf signaling
Wnt and fibroblast growth factor (Fgf) signaling pathways have been
implicated in inner ear formation in the mouse, chick and zebrafish embryos
(Ladher et al., 2000
;
Leger and Brand, 2002
;
Liu et al., 2003
;
Wright and Mansour, 2003
);
therefore, we tested the requirement of these signaling pathways for Sox9
expression in the otic placode/vesicle in Xenopus. Injection of
glycogen synthase kinase 3ß (GSK3ß) mRNA, a downstream component of
the canonical Wnt pathway known to antagonize Wnt signaling
(He et al., 1995
), completely
blocked Sox9 expression in the otic placode at stage 17
(Fig. 2A, upper panel), in 84%
of injected embryos (n=68). LRP6 is a component of the Wnt receptor
complex. Similar results (not shown) were obtained by injection of a
dominant-negative form of LRP6 (LRP6
C) known to block Wnt signaling in
Xenopus (Tamai et al.,
2000
). Although the neural crest expression domain of Sox9 was
also altered in these embryos injected with GSK3ß
(Luo et al., 2003
) or
LRP6
C (not shown), the otic placode component of Sox9 expression was
always the first domain to be affected. Expression of a dominant-negative Fgf
receptor (XFD/FgfR), lacking the cytoplasmic domain, has been shown to block
Fgf signaling in vivo (Amaya et al.,
1991
). Approximately 45% of XFD/FgfR-injected embryos
(n=60) exhibited a reduction of Sox9 expression in the otic vesicle
at stage 23 (Fig. 2A, lower
panel). As previously described, these embryos had also an open blastopore
dorsally, reflecting Fgf requirement for the development of posterior
structures (Amaya et al.,
1991
).
|
These experiments indicate that the otic expression of Sox9 is under the positive control of both Wnt and Fgf, and suggest that these signaling pathways are implicated in the development of the otic vesicle in Xenopus.
Sox9 depletion prevents otic placode and vesicle formation
To address Sox9 function during inner ear development we performed
loss-of-function studies using morpholino antisense oligonucleotides
(Sox9-mo). The characteristics and the specificity of this antisense oligo
have been previously described (Spokony et
al., 2002
). Embryos at the two-cell stage were injected in one
blastomere with 10 ng of Sox9-mo, a 5 bp mismatched antisense (Sox9-mis) or a
standard control oligo (Co-mo) together with RNA encoding the lineage tracer
ß-galactosidase. In situ hybridization analysis revealed that a large
proportion of Sox9-mo-injected embryos failed to express early otic placode
markers such as Pax8 (66% reduced, n=172) and Tbx2 (77% reduced,
n=125) as shown in Fig.
3. By contrast, the expression of both genes was unperturbed in
Sox9-mis- or Co-mo-injected embryos (Fig.
3A,B). Importantly, the otic expression of Pax8 and Tbx2 can be
rescued in Sox9-depleted embryos by co-injection of wild-type mouse Sox9;
injection of mouse Sox9 mRNA decreased the number of embryos with reduced Pax8
or Tbx2 expression by approximately 50%
(Fig. 3A,B).
|
75% of the
injected embryos (Tbx2, n=51; Bmp4, n=81; Wnt3a,
n=68; Otx2, n=77). Injections of control morpholinos had no
effects on the otic vesicle expression of these markers (not shown). Moreover,
sagittal section through Sox9-mo-injected embryos revealed that most of these
embryos lacked a recognizable otic vesicle on the injected side, while the
overall morphology of these embryos is otherwise unperturbed
(Fig. 4C,D).
|
Sox9 is required to specify the otic placode but not for its subsequent patterning
We next decided to determine the window of time during which Sox9 is
required for otic placode development. To this end, we generated an inducible
inhibitory mutant Sox9 construct (Sox9
C-GR) in which the
hormone-binding domain of the human glucocorticoid receptor is fused to a form
of Sox9 lacking the transactivation domain
(Fig. 5A). This construct was
generated based on the observation that numerous Sox9 mutations in human
affected by campomelic dysplasia are due to truncations or frameshifts that
eliminate the transactivation domain at the C terminus, resulting in a loss of
transactivation activity, such truncated proteins are believed to interfere
with wild-type Sox9 function (McDowall et
al., 1999
; Preiss et al.,
2001
). This type of inducible construct allows temporal
inactivation of Sox9 function by addition of dexamethasone at specific times
during embryogenesis (Gammill and Sive,
1997
; Tada et al.,
1997
). By western blot analysis, using a Sox9-specific antibody,
we showed that after injection at the two-cell stage the levels of
Sox9
C-GR protein remained constant throughout development, from stage
10 to 20 (Fig. 5B).
|
C-GR mRNA and treated with dexamethasone at various stages
(Fig. 6A). Addition of
dexamethasone at the blastula stage (stage 6) caused a loss of otic expression
of Pax8 and Tbx2 at stage 22 (Fig.
6B,C). This result is consistent with the phenotype of
Sox9-depleted embryos described earlier
(Fig. 3) and suggests that this
fusion construct is fully active in blocking Sox9 function. Dexamethasone
treatment at the gastrula stage (stage 11) also resulted in a similar loss of
both otic placode markers (Fig.
6B,C). However, inactivation of Sox9 at neurula stage (+Dex stage
15) failed to block Pax8 and Tbx2 expression in the developing otic placode
(Fig. 6B,C). This result
indicates that Sox9 function is required prior to stage 15 to specify the otic
placode.
|
In order to determine whether Sox9 is also required for subsequent patterning of the otic placode/vesicle, we analyzed the otic expression of Otx2 and Wnt3a in stage 35 embryos in which Sox9 was inactivated at stage 15 or stage 20, thereby bypassing the early requirement for Sox9 (Fig. 7A). As expected embryos treated with dexamethasone at stage 11 lacked an otic vesicle on the injected side (Fig. 7B). However, most of the embryos treated at stage 15 or 20 developed normal otic vesicles with regionalized Otx2 (86%, n=43) and Wnt3a (85%, n=41) expression (Fig. 7B).
|
Maintenance of Sox9 expression depends on Dlx3
The distal-less related homeobox gene Dlx3 is expressed during the initial
stages of sensory placode development and has been implicated in otic placode
formation in the zebrafish embryo (Ekker
et al., 1992
; Solomon and
Fritz, 2002
; Liu et al.,
2003
). Therefore, we analyzed its requirement for Sox9, Pax8 and
Tbx2 otic expression in Xenopus using a morpholino antisense
oligonucleotide (Dlx3-mo) that inhibits splicing of the second intron from the
Dlx3 transcript. Embryos that received unilateral injection of 30 ng of
Dlx3-mo exhibited a specific reduction of Sox9 otic expression at the neurula
stage (82% n=22), while Sox9 neural crest expression domain was only
marginally affected in these embryos (Fig.
8). A similar result was obtained with a different Dlx3 morpholino
targeted to the translational initiation site (80%, n=25; data not
shown). Interestingly, Pax8 or Tbx2 otic expression
(Fig. 8A and not shown) was not
significantly disturbed by inhibiting Dlx3 expression (slight reduction of
Pax8 in 31% of the embryos, n=39; no reduction of Tbx2,
n=15); moreover, these embryos formed normal otic vesicles at stage
35 (Fig. 8B).
|
| Discussion |
|---|
|
|
|---|
Sox9 is one of the earliest genes expressed in the presumptive otic placode
(stage 12/13), its expression is initiated prior to any morphological changes
in the sensory layer of the ectoderm. The dorsolateral thickening of the
ectoderm that defines the position of the prospective otic placode becomes
only visible a few hours later around stage 21/22 (Nieuwkoop and Farber,
1956). Spatially Sox9 and Pax8 have similar expression domain within the
presumptive otic placode (Heller and
Brandli, 1999
), while temporally Sox9 otic expression appears to
precede that of Pax8. This observation, together with the finding that
Sox9-depleted embryos fail to express Pax8 suggests that Sox9 may function
upstream of Pax8 during inner ear development. However, this does not exclude
the possibility that Sox9 and Pax8 may also be involved in maintaining each
other's expression in the presumptive otic placode.
In Xenopus, the distal-less related gene Dlx3 (Xdll2) is expressed
in the ventral ectoderm at the gastrula stage and later marks the boundary
between the ectoderm and the neural crest
(Papalopulu and Kintner, 1993
;
Dirksen et al., 1994
;
Luo et al., 2001
) (reviewed by
Beanan and Sargent, 2000
). This
tissue encompasses the placodal ectoderm that will give rise to the olfactory
and otic placodes. Loss of Dlx3 function resulted in a specific reduction of
Sox9 otic expression domain, suggesting that these factors may act in the same
regulatory pathway during otic placode formation. However, the
Dlx3-mo-injected embryos appeared to form a normal otic vesicle. This could be
explained by the fact that Dlx3-mo generate only an incomplete loss of Sox9
and that a Dlx3-independent pathway may also be involved in the regulation of
Sox9 otic expression. This is in agreement with recent work that has
implicated the zebrafish Dlx3 homolog, Dlx3b, in otic placode formation (a
function partially shared with the linked and coexpressed Dlx4b gene)
(Solomon and Fritz, 2002
) and
demonstrated the existence of a Dlx3-dependent and Dlx3-independent regulation
of Sox9a (the zebrafish Sox9 homolog) expression during otic placode formation
(Liu et al., 2003
). Moreover,
the observation that Pax8 and Tbx2 are not affected in Dlx3-depleted embryos
is consistent with the view that Dlx3 is required for maintenance of Sox9
expression following Sox9 initial function in otic placode specification.
Experiments in amphibian have established that otic placode induction is a
multiple step process that requires signals derived from the mesoderm and the
neuroectoderm (Jacobson, 1966
;
Gallagher et al., 1996
)
(reviewed by Noramly and Grainger,
2002
). More recent studies in chick, zebrafish and mouse have
identified some of these signals. There is evidence that molecules belonging
to the fibroblast growth factor (Fgf) family, expressed in the paraxial
mesoderm (Fgf10 and Fgf19) and the hindbrain (Fgf3 and Fgf8) are involved in
otic vesicle induction and patterning
(Vendrell et al., 2000
;
Ladher et al., 2000
;
Phillips et al., 2001
;
Leger and Brand, 2002
;
Liu et al., 2003
;
Wright and Mansour, 2003
;
Alvarez et al., 2003
).
Additionally, work in the chick embryo suggests that molecules of the Wnt
family are also involved in this process. Wnt8c, which is expressed in the
hindbrain, appears to be required in combination with a Fgf signal (Fgf19) to
generate the otic placode from undifferentiated ectoderm
(Ladher et al., 2000
). In
Xenopus the otic expression of Sox9 appears to be under the dual
control of Fgf and Wnt signaling, as interference with either signaling
pathway blocks Sox9 otic expression. However, because Fgf and Wnt signaling
have also been implicated in mesoderm and neural patterning, the loss of Sox9
expression in the otic placode/vesicle may reflect a disruption of the
putative inducing tissues rather than the inducing molecules. Moreover, the
observation that embryos with compromised Fgf or Wnt signaling form an otic
vesicle of reduced size may suggest: (1) that only an incomplete inhibition of
these pathways was attainable in our experimental conditions; (2) that both
pathways are required concurrently; or (3) that other factors are also
required for the induction of the otic placode in Xenopus.
Although expression of a dominant-negative Fgf receptor
(Amaya et al., 1991
) and
overexpression of GSK3ß (He et al., 1994) are likely to block a broad
range of Fgf and Wnt family members, respectively, these experiments suggest
the existence of an endogenous Fgf and Wnt signal implicated in Sox9
expression in the otic palcode. Wnt8 is expressed in the paraxial mesoderm and
detected at the time of otic placode specification
(Christian and Moon, 1993
) and
could therefore represent this endogenous Wnt signal involved in otic placode
induction in Xenopus. Fgf3 is also a good candidate inducer as it is
detected in the prospective hindbrain at the late gastrula stage
(Lombardo et al., 1998
).
Additionally, Fgf2 has been shown to promote formation of supernumerary otic
vesicles when applied ectopically
(Lombardo and Slack, 1998
),
and therefore could be involved in initiating Sox9 expression in the otic
placode. The identification of these ligands will be key in understanding the
contribution of these two signaling pathways to the induction of the otic
placode in Xenopus.
Sox9 depletion resulted in a severe loss of early (Pax8 and Tbx2) and late (Tbx2, Wnt3a, Otx2 and Bmp4) otic markers. This phenotype is also characterized by the inability of the otic placodal ectoderm to thicken and generate an otic vesicle, suggesting that Sox9 is required for inner ear development in Xenopus. Overexpression of Xenopus or mouse Sox9 in the ventral ectoderm did not lead to ectopic Pax8 expression or formation of supernumerary otic vesicles (not shown). This result indicates that although Sox9 is required it is not sufficient to initiate formation of the otic placode and argues for the requirement of additional factors.
To further define the window of time during which Sox9 is functioning
during otic placode formation, we generated a hormone inducible inhibitory
Sox9 construct (Sox9
C-GR), to produce a temporal inactivation of Sox9
function. Inactivation of Sox9 during gastrulation (stage 11), and prior to
the neural plate stage (stage 15), prevented Pax8 and Tbx2 otic expression.
This observation indicates that a Sox9-dependent pathway is required for
specification of the otic placode, and that the inductive events involved are
taking place prior to the neural plate stage. This is consistent with
transplantation experiments in Xenopus showing that some level of
placodal specification has already occurred by early neurula stage
(Jacobson, 1966
;
Gallagher et al., 1996
).
Conversely, inactivation Sox9 at the neurula stage (stage 15) and beyond
(stage 20), which bypass the early requirement for Sox9, had no effect on the
development of the otic placode and the patterning of the otic vesicle. This
result is of importance as it implies that Sox9 is strictly functioning during
the initial stages of specification of the otic placode.
Campomelic dysplasia (OMIM #114290) is a severe skeletal dysmorphology
syndrome caused by haploinsufficiency of Sox9
(Foster et al., 1994
;
Wagner et al., 1994
;
McDowall et al., 1999
;
Wunderle et al., 1998
;
Olney et al., 1999
;
Preiss et al., 2001
).
Individuals affected by this condition usually die shortly after birth because
of respiratory distress; therefore, it has been difficult to evaluate the
auditory capability of these individuals. However, reports of rare individuals
that survived through adolescence (Houston
et al., 1983
) and adulthood
(Savarirayan et al., 2003
)
indicate that they are affected with sensorineural deafness. Our results in
Xenopus predict that hearing loss associated with campomelic
dysplasia is likely to be the result of an early defect in the specification
of the otic placode. However, the lack of information on the nature of the
inner ear defects associated with this pathology in human, and in a mouse
model of the disease (Bi et al.,
2001
), makes it difficult, at this time, to fully assess this
prediction.
The strict requirement of Sox9 for specification of the inner ear in
Xenopus raises the possibility that other Sox family members might be
more directly involved in the differentiation and the patterning of the otic
vesicle. For example, Sox10, whose expression and function in the developing
neural crest has been well studied in several species
(Southard-Smith et al., 1998
;
Kapur, 1999
;
Dutton et al., 2001
;
Aoki et al., 2003
), is also
expressed in the entire epithelium of the otic vesicle in human, mouse, chick,
frog and fish (Bondurand et al.,
1998
; Southard-Smith et al.,
1998
; Watanabe et al.,
2000
; Cheng et al.,
2000
; Dutton et al.,
2001
; Aoki et al.,
2003
). Sox10 heterozygous mutations have been identified in
individuals who suffer from Waardenburg-Shah (WS4) syndrome (OMIM#277580).
These individuals exhibit aganglionic megacolon, hypopigmentation and
sensorineural deafness (Pingault et al.,
1998
; Southard-Smith et al.,
1999
). The phenotype associated with this pathology indicates an
important role for Sox10 in neural crest formation but also in the development
of the inner ear. In Xenopus, Sox9 otic expression precedes that of
Sox10, which is detected only when the otic placode starts to invaginate into
a vesicle (Spokony et al.,
2002
; Aoki et al.,
2003
). This observation suggests that Sox10 may have function
during the later phase of differentiation and patterning of the otic vesicle
rather than its specification. A comparative analysis of the inner ear defects
of individuals affected by campomelic dysplasia and Waardenburg-Shah syndromes
should provide important information on the respective contribution of these
two Sox family members to the development of the vertebrate inner ear.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Adamska, M., Herbrand, H., Adamski, M., Kruger, M., Braun, T. and Bober, E. (2001). FGFs control the patterning of the inner ear but are not able to induce the full ear program. Mech. Dev. 109,303 -313.[CrossRef][Medline]
Alvarez, Y., Alonso, M. T., Vendrell, V., Zelarayan, L. C.,
Chamero, P., Theil, T., Bösl, M. R., Kato, S., Maconochie, M.,
Riethmacher, D. and Schimmang, T. (2003). Requirements for
FGF3 and FGF10 during inner ear formation. Development
130,6329
-6338.
Amaya, E., Musci, T. J. and Kirschner, M. W. (1991). Expression of a dominant negative mutant of the FGF receptor disrupts mesoderm formation. Cell 66,257 -270.[CrossRef][Medline]
Aoki, Y., Saint-Germain, N., Gyda, M., Magner-Fink, E. K., Lee, Y.-H., Credidio, C. and Saint-Jeannet, J.-P. (2003). Sox10 regulates the development of the neural crest-derived melanocytes in Xenopus. Dev. Biol. 259,19 -33.[CrossRef][Medline]
Baker, C. V. H. and Bronner-Fraser, M. (2001). Vertebrate cranial placodes I. Embryonic induction. Dev. Biol. 232,1 -61.[CrossRef][Medline]
Beanan, M. J. and Sargent, T. D. (2000). Regulation and function of Dlx3 in vertebrate development. Dev. Dyn. 218,545 -553.[CrossRef][Medline]
Bell, D. M., Leung, K. K. H., Wheatley, S. C., Ng, L. J., Zhou, S., Ling, K. W., Sham, M. H., Koopman, P., Tam, P. P. L. and Cheah, K. S. E. (1997). Sox9 directly regulates the type-II collagen gene. Nat. Genet. 16,174 -178.[CrossRef][Medline]
Bi, W., Deng, J. M., Zhang, Z., Behringer, R. R. and de Crombrugghe, B. (1999). Sox9 is required for cartilage formation. Nat. Genet. 22, 85-89.[CrossRef][Medline]
Bi, W., Huang, W., Deanne, J. W., Zhang, Z., Deng, J. M.,
Behringer, R. R. and de Crombrugghe, B. (2001).
Haploinsufficiency of Sox9 results in defective precartilaginous mesenchymal
condensations and premature skeletal mineralization. Proc. Natl.
Acad. Sci. USA 98,6698
-6703.
Bondurand, N., Kobetz, A., Pingault, V., Lemort, N., Encha-Razavi, F., Couly, G., Goerich, D. E., Wegner, M., Abitbol, M. and Goossens, M. (1998). Expression of the SOX10 gene during human development. FEBS Lett. 432,168 -172.[CrossRef][Medline]
Cheng, Y., Cheung, M., Abu-Elmagd, M. M., Orme, A. and Scotting, P. J. (2000). Chick Sox10, a transcription factor expressed in both early neural crest cells and central nervous system. Dev. Brain Res. 121,233 -241.[Medline]
Christian, J. L. and Moon, R. T. (1993). Interactions between XWnt-8 and spemann organizer signaling pathways generate dorsoventral pattern in the embryonic mesoderm of Xenopus. Genes Dev. 7,13 -28.[Medline]
Dirksen, M. L., Morasso, M. I., Sargent, T. D. and Jamrich, M. (1994). Differential expression of a Distal-less homeobox gene Xdll-2 in ectodermal cell lineages. Mech. Dev. 46, 63-70.[CrossRef][Medline]
Dutton, K. A., Pauliny, A., Lopes, S. S., Elworthy, S., Carney,
T. J., Rauch, J., Geisler, R., Haffter, P. and Kelsh, R. N.
(2001). Zebrafish colourless encodes sox10 and specifies
non-ectomesenchymal neural crest fates. Development
128,4113
-4125.
Ekker, M., Akimenko, M. A., Bremiller, R. and Westerfield, M. (1992). Regional expression of three homeobox transcripts in the inner ear of zebrafish embryos. Neuron 9, 27-35.[CrossRef][Medline]
Fekete, D. (1999). Development of the vertebrate ear insights from knockouts and mutants. Trends Neurosci. 22,533 -541.
Foster, J. W., Dominguez-Steglich, M. A., Guioli, S., Kowk, G., Weller, P. A., Stevanovic, M., Weissenbach. J., Mansour, S., Young. I. D., Goodfellow, P. N. et al. (1994). Campomelic dysplasia and autosomal sex reversal caused by mutations in an SRY-related gene. Nature 372,525 -530.[CrossRef][Medline]
Gallagher, B. C., Henry, J. J. and Grainger, R. M. (1996). Inductive processes leading to inner ear formation during Xenopus development. Dev. Biol. 175,95 -107.[CrossRef][Medline]
Gammill, L. S. and Sive, H. (1997). Identification of Otx2 target genes and restrictions in ectodermal competence during Xenopus cement gland formation. Development 124,471 -481.[Abstract]
Hayata, T., Kuroda, H., Eisaki, A. and Asashima, M. (1999). Expression of the Xenopus T-box transcription factor, Tbx2 in Xenopus embryo. Dev. Genes Evol. 209,625 -628.[CrossRef][Medline]
Harland, R. M. (1991). In situ hybridization: an improved whole-mount method for Xenopus embryos. Meth. Cell Biol. 36,685 -695.[Medline]
He, X., Saint-Jeannet, J.-P., Woodgett, J., Varmus, H. E. and Dawid, I. B. (1995). Glycogen synthase kinase 3 and dorsoventral patterning in Xenopus embryos. Nature 374,617 -622.[CrossRef][Medline]
Heller, N. and Brandli, A. W. (1999). Xenopus Pax-2/5/8 orthologues: novel insights into Pax gene evolution and identification of Pax-8 as the earliest marker for otic and pronephric cell lineages. Dev. Genet. 24,208 -219.[CrossRef][Medline]
Houston, C. S., Opitz, J. M., Spranger, J. W., Macpherson, R. I., Reed, M. H., Gilbert, E. F., Herrmann, J. and Schinzel, A. (1983). The Campomelic Syndrome: review, report of 17 cases, and follow-up on the currently 17-year-old boy first reported by Maroteaux et al. in 1971. Am. J. Med. Genet. 15, 3-28.[CrossRef][Medline]
Jacobson, A. G. (1966). Inductive processes in
embryonic development. Science
152, 25-34.
Jones, C. M., Lyons, K. M., Lapan, P. M., Wright, C. V. E. and Hogan, B. L. M. (1992). DVR-4 (Bone Morphogenetic Protein-4) as a posterior-ventralizing factor in Xenopus mesoderm induction. Development 115,639 -647.[Abstract]
Kamachi, Y., Uchikawa, M. and Kondoh, H. (2000). Pairing Sox off with partners in the regulation of embryonic development. Trends Genet. 16,182 -187.[CrossRef][Medline]
Kapur, R. P. (1999). Early death of neural crest cells is responsible for total enteric aganglionosis in Sox10(Dom)/Sox10(Dom) mouse embryos. Ped. Dev. Path. 2, 559-569.
Kil, S.-H. and Collazo, A. (2001). Origins of the inner ear sensory organs revealed by fate map and time-lapse analyses. Dev. Biol. 233,365 -379.[CrossRef][Medline]
Ladher, R. J., Anakwe, K. U., Gurney, A. L., Schoenwolf, G. C.
and Francis-West, P. H. (2000). Identification of
synergistic signals initiating inner ear development.
Science 290,1965
-1967.
Leger, S. and Brand, M, (2002). Fgf8 and Fgf3 are required for zebrafish ear placode induction, maintenance and inner ear patterning. Mech. Dev. 119,91 -108.[CrossRef][Medline]
Li, M., Zhao, C., Wang, Y., Zhao, Z. and Meng, A. (2002). Zebrafish sox9b is an early neural crest marker. Dev. Genes Evol. 212,203 -206.[CrossRef][Medline]
Liu, W., Chien, J. S., Raft, S., Zhang, H., Chiang, C. and Frenz, D. A. (2002). Sonic Hedgehog regulates otic capsule chondrogenesis and inner ear development in the mouse embryo. Dev. Biol. 248,240 -250.[CrossRef][Medline]
Liu, D., Chu, H., Maves, L., Yan, Y-L, Marcos, P. A.,
Postlethwait, J. H. and Westerfield, M. (2003). Fgf3 and Fgf
8 dependent and independent transcription factors are required for otic
placode specification. Development
130,2213
-2224.
Lombardo, A. and Slack, J. M. (1998). Postgastrulation effects of fibroblast growth factor on Xenopus development. Dev. Dyn. 212,75 -85.[CrossRef][Medline]
Lombardo, A., Isaacs, H. V. and Slack, J. M. (1998). Expression and functions of FGF-3 in Xenopus development. Int. J. Dev. Biol. 42,1101 -1107.[Medline]
Luo, T., Matsuo-Takasaki, M. and Sargent, T. D. (2001). Distinct roles for distal-less genes Dlx3 and Dlx5 in regulating ectodermal development in Xenopus. Mol. Reprod. Dev. 60,331 -337.[CrossRef][Medline]
Luo, T., Lee, Y.-H., Saint-Jeannet, J-P. and Sargent, T. D.
(2003). Induction of neural crest in Xenopus by transcription
factor AP2
. Proc. Natl. Acad. Sci. USA
100,532
-537.
McDowall, S., Argentaro, A., Ranganathan, S., Weller, P.,
Mertin, S., Mansour, S., Tolmie, J. and Harley, V.
(1999). Functional and structural studies of wild type Sox9 and
mutations causing Campomelic dysplasia. J. Biol. Chem.
274,24023
-24030.
Ng, L. J., Wheatley, S., Muscat, G. E. O., Conway-Campbell, J., Bowles, J., Wright, E., Bell, D. M., Tam, P. P. L., Cheah, K. S. E. and Koopman, P. (1997). SOX9 binds DNA, Activates transcription, and co-expresses with type II collagen during chondrogenesis in the mouse. Dev. Biol. 183,108 -121.[CrossRef][Medline]
Nieuwkoop, P. D. and Faber, J. (1956).Normal table of Xenopus laevis (Daudin) . Amsterdam: North-Holland Publishing Co.
Noramly, S. and Grainger, R. M. (2002). Determination of the embryonic inner ear. J. Neurobiol. 53,100 -128.[CrossRef][Medline]
Olney, P. N., Kean, L. S., Graham, D., Elsas, L. J. and May, K. M. (1999). Campomelic syndrome and deletion of Sox9. Am. J. Med. Genet. 84,20 -24.[CrossRef][Medline]
Pannese, M., Polo, C., Andreazzoli, M., Vignali, R., Kablar, B., Barsacchi, G. and Boncinelli, E. (1995). The Xenopus homologue of Otx2 is a maternal homeobox gene that demarcates and specifies anterior body regions. Development 121,707 -720.[Abstract]
Papalopulu, N. and Kintner, C. (1993). Xenopus Distal-less related homeobox genes are expressed in the developing forebrain and are induced by planar signals. Development 117,961 -975.[Abstract]
Pasqualetti, M., Neun, R., Davenne, M. and Rijli, F. M. (2001). Retinoic acid rescues inner ear defects in Hoxa1 deficient mouse. Nat. Genet. 29, 34-39.[CrossRef][Medline]
Pingault, V., Bondurand, N., Kuhlbordt, K., Goerich, D. E., Prehu, M.-O., Puliti, A., Herbarth, B., Hermans-Borgmeyer, I., Leguis, E., Matthijs, G. et al. (1998). SOX10 mutations in patients with Waardenburg-Hirschprug disease. Nat. Genet. 18,171 -173.[CrossRef][Medline]
Phillips, B. T., Bolding, K. and Riley, B. B. (2001). Zebrafish fgf3 and fgf8 encode redundant functions required for otic placode induction. Dev. Biol. 235,351 -365.[CrossRef][Medline]
Preiss, S., Argentaro, A., Clayton, A., John, A., Jans, D. A.,
Ogata, T., Nagai, T., Barrosso, I., Schafer, A. J. and Harley, V.
R. (2001). Compound effects of point mutations causing
campomelic dysplasia/autosomal sex reversal upon Sox Structure, nuclear
transport, DNA binding, and transcriptional activation. J. Biol.
Chem. 276,27864
-27872.
Riccomagno, M. M., Martinu, L., Mulheisen, M., Wu, D. K. and
Epstein, D. J. (2002). specification of the mammalian
cochlea is dependent on Sonic hedgehog. Genes Dev.
16,2365
-2378.
Saint-Jeannet, J.-P., Thiery, J.-P. and Koteliansky, V. (1994). Effect of an inhibitory mutant of the FGF receptor on mesoderm-derived alpha-smooth muscle actin-expressing cells in Xenopus embryo. Dev. Biol. 164,374 -382.[CrossRef][Medline]
Saint-Jeannet, J.-P., He, X., Varmus, H. E. and Dawid, I. B.
(1997). Regulation of dorsal fate in the neuraxis by Wnt-1 and
Wnt-3a. Proc. Natl. Acad. Sci. USA
94,13713
-13718.
Savarirayan, R., Robertson, S. P., Bankier, A. and Rogers, J. G. (2003). Variable expression of campomelic dysplasia in a father and his 46, XY daughter. Ped. Pat. Mol. Med. 22, 37-46.[CrossRef]
Solomon, K. S. and Fritz, A. (2002). Concerted action of Two dlx paralogs in sensory placode formation. Development 129,929 -940.
Southard-Smith, E. M., Kos, L. and Pavan, W. J. (1998). Sox10 mutation disrupts neural crest development in Dom Hirschprung mouse model. Nat. Genet. 18, 60-64.[CrossRef][Medline]
Southard-Smith, E. M., Anrist, M., Ellison, J. S., Agarwala, R., Baxevanis, A. D., Chakravarti, A. and Pavan, W. J. (1999). The Sox10Dom mouse: modeling the genetic variation of Waardenburg-Shah (WS4) syndrome. Gen. Res. 9,215 -225.[Medline]
Spokony, R. F., Aoki, Y., Saint-Germain, N., Magner-Fink, E. K. and Saint-Jeannet, J.-P. (2002). The transcription factor Sox9 is required for cranial neural crest development in Xenopus. Development 129,421 -432.[Medline]
Tada, M., O'Reilly, M. A. and Smith, J. C. (1997). Analysis of competence and Brachyury autoinduction by use of hormone-inducible Xbra. Development 124,2225 -2234.[Abstract]
Takabatake, Y., Takabate, K. and Takeshima, K. (2000). Conserved and divergent expression of T-box genes Tbx2-Tbx5 in Xenopus. Mech. Dev. 91,433 -437.[CrossRef][Medline]
Tamai, K., Semenov, M., Kato, Y., Spokony, R. F., Liu, C., Katsuyama, Y., Hess, F., Saint-Jeannet, J.-P. and He, X. (2000). LDL receptor-related proteins in Wnt signal transduction. Nature 407,530 -535.[CrossRef][Medline]
Torres, M. and Giraldez, F. (1998). The development of the vertebrate inner ear. Mech. Dev. 71, 5-21.[CrossRef][Medline]
Vendrell, V., Carnicero, E., Giraldez, F., Alonso, M. T. and Schimmang, T. (2000). Induction of inner ear fate by FGF3. Development 127,2011 -2019.[Abstract]
Watanabe, K.-I., Takeda, K., Katori, Y., Ikeda, K., Oshima, T., Yasumoto, K.-I., Saito, H., Takasaka, T. and Shibahara, S. (2000). Expression of Sox10 gene during mouse inner ear development. Mol. Brain Res. 84,141 -145.[Medline]
Wagner, T., Wirth, J., Meyer, J., Zabel, B., Held, M., Zimmer, J., Pasantes, J., Dagna Bricarelli, F., Keutel, J., Heustert, E. et al. (1994). Autosomal sex reversal and Campomelic dysplasia are caused by mutations in and around the SRY-related gene SOX9. Cell 79,1111 -1120.[CrossRef][Medline]
Wegner, M. (1999). From head to toes: the
multiple facets of Sox proteins. Nucleic Acid Res.
27,1409
-1420.
Wolda, S. L., Moody, C. J. and Moon, R. T. (1993). Overlapping expression of Xwnt-3A and Xwnt-1 in neural tissue of Xenopus laevis embryos. Dev. Biol. 155, 46-57.[CrossRef][Medline]
Wright, T. J. and Mansour, S. L. (2003). Fgf3
and Fgf10 are required for mouse otic placode induction.
Development 130,3379
-3390.
Wright, E., Hargrave, M. R., Christiansen, J., Cooper, L., Kun, J., Evans, T., Gangadharan, U., Greenfield, A. and Koopman, P. (1995). The Sry-related gene Sox9 is expressed during chondrocyte in mouse embryos. Nat. Genet. 9, 15-20.[CrossRef][Medline]
Wunderle, V. M., Critcher, R., Hastie, N., Goodfellow, P. N. and
Schedl, A. (1998). Deletion of long-range regulatory
elements upstream of Sox9 causes campomelic dysplasia. Proc. Natl.
Acad. Sci. USA 95,10649
-10654.
Zhao, Q., Eberspaecher, H., Lefebvre, V. and deCrombrugghe, B. (1997). Parallel expression of Sox9 and Col2a1 in cells undergoing chondrogenesis. Dev. Dyn. 209,377 -386.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
K. Dutton, L. Abbas, J. Spencer, C. Brannon, C. Mowbray, M. Nikaido, R. N. Kelsh, and T. T. Whitfield A zebrafish model for Waardenburg syndrome type IV reveals diverse roles for Sox10 in the otic vesicle Dis. Model. Mech., January 1, 2009; 2(1-2): 68 - 83. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-L. Yan, J. Willoughby, D. Liu, J. G. Crump, C. Wilson, C. T. Miller, A. Singer, C. Kimmel, M. Westerfield, and J. H. Postlethwait A pair of Sox: distinct and overlapping functions of zebrafish sox9 co-orthologs in craniofacial and pectoral fin development Development, March 1, 2005; 132(5): 1069 - 1083. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hans, D. Liu, and M. Westerfield Pax8 and Pax2a function synergistically in otic specification, downstream of the Foxi1 and Dlx3b transcription factors Development, October 15, 2004; 131(20): 5091 - 5102. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. F. Barald and M. W. Kelley From placode to polarization: new tunes in inner ear development Development, September 1, 2004; 131(17): 4119 - 4130. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||