|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 17 March 2004
doi: 10.1242/dev.01068
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Max-Planck-Institut für Molekulare Genetik, Ihnestrasse 73, D-14195 Berlin, Germany
* Author for correspondence (e-mail: antebi{at}molgen.mpg.de)
Accepted 12 January 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Dauer, Hormone, Aging, C. elegans, Cholesterol
| Introduction |
|---|
|
|
|---|
Identified pathways regulating this developmental choice include
insulin/IGF, TGFß, cGMP and serotonergic signaling
(Finch and Ruvkun, 2001
),
which relay neural signals to control programs throughout the body.
Insulin/IGF and TGFß peptides are primary endocrines synthesized and
released in response to favorable stimuli, mainly from sensory neurons
(Li et al., 2003
;
Ren et al., 1996
). TGFß
signals through its receptors to inactivate DAF-3/SMAD and DAF-5/SNO, allowing
reproductive development (da Graca et al.,
2003
; Estevez et al.,
1993
; Georgi et al.,
1990
; Inoue and Thomas,
2000
; Patterson et al.,
1997
; Ren et al.,
1996
). A complex of DAF-3 and DAF-5 specifies diapause in adverse
environments. Insulin/IGF signaling not only controls C. elegans
dauer, but is also a central regulator of somatic endurance and longevity
across taxa (Tatar et al.,
2003
). Insulin-like agonists stimulate the DAF-2/insulin-like
receptor, initiating a kinase cascade that phosphorylates DAF-16 forkhead
transcription factor (Kimura et al.,
1997
; Morris et al.,
1996
; Ogg et al.,
1997
; Ogg and Ruvkun,
1998
; Paradis et al.,
1999
; Paradis and Ruvkun,
1998
; Pierce et al.,
2001
). This results in cytoplasmic sequestration of DAF-16, and as
a consequence animals undergo reproductive growth and live short lives. In
adverse environments, DAF-16 enters the nucleus, promoting stress resistance,
diapause and longevity (Henderson and
Johnson, 2001
; Lee et al.,
2001
; Lin et al.,
2001
).
There is evidence that both insulin/IGF and TGFß receptors transduce
signals through downstream secondary endocrines. Mosaic analysis and
tissue-specific promoter studies reveal that daf-2 regulates diapause
and life span by systemic signals (Apfeld
and Kenyon, 1998
; Wolkow et
al., 2000
). Similarly, daf-4/TGFß receptor type 2
regulates dauer formation cell non-autonomously
(Inoue and Thomas, 2000
). As
components of nuclear receptor signaling, daf-9 and daf-12,
are epistatic to insulin/IGF and TGFß signaling for diapause regulation,
they may comprise this secondary pathway. DAF-9, a cytochrome P450 of the CYP2
class, resembles steroidogenic and fatty acid hydroxylases, as well as
xenobiotic detoxifying enzymes (Gerisch et
al., 2001
; Jia et al.,
2002
). It probably produces a hormone for DAF-12, a nuclear
receptor transcription factor related to vertebrate vitamin D, pregnane and
androstane nuclear receptors (Antebi et
al., 2000
).
daf-9 mutants fall into two distinct classes
(Gerisch et al., 2001
;
Jia et al., 2002
). Strong
loss-of-function mutants have dark intestines owing to transient excess fat
storage, form dauer larvae constitutively (Daf-c), which eventually recover to
sterile adults that live about 25% longer than wild type. Weak
loss-of-function mutants have penetrant heterochronic delays in L3 gonadal
leader cell migrations (Mig), reduced fecundity and are slightly short-lived.
Somewhat opposite, daf-12 null mutants have impenetrant heterochrony,
light intestines, fail to form dauer larvae (Daf-d) and live short lives
(Antebi et al., 1998
;
Gerisch et al., 2001
).
daf-9 phenotypes are daf-12(+) dependent, showing that
daf-12 acts downstream. Moreover, daf-9 mutants specifically
resemble daf-12 ligand-binding domain mutants, suggesting that loss
of ligand production or binding specify dauer formation. Finally, both
daf-9 and daf-12 interact with long-lived daf-2,
enhancing the longevity of strong mutants (class 2) but mildly suppressing
longevity of weak mutants (class 1) (Gems
et al., 1998
; Gerisch et al.,
2001
). Both are also required for the extended longevity seen in
animals whose germline has been ablated
(Gerisch et al., 2001
;
Hsin and Kenyon, 1999
),
revealing gonadal influences on life span.
A simple model is that DAF-9 produces a hormone for DAF-12, which bypasses
diapause, promotes reproductive development and, perhaps, shortens life span.
This hormone might be a sterol, as cholesterol deprivation phenocopies larval
defects (Gerisch et al.,
2001
). Expressed in potential endocrine tissues (two head cells,
the hypodermis and the hermaphrodite spermathecae), daf-9 appears to
control developmental decisions for the entire organism. However, it is not
known whether DAF-9 actually produces hormonal signals, what specific roles
the various daf-9 expressing tissues play, and whether or how
daf-9 is regulated by sensory inputs and upstream signaling pathways.
Here we have investigated these issues. Our findings implicate daf-9
as a central point of developmental control, producing hormonal signals that
regulate C. elegans life history.
| Materials and methods |
|---|
|
|
|---|
E. coli growth arrested with
streptomycin (50 µg/ml) were used, varying the dilution and volume plated.
Dauer pheromone was prepared as described
(Golden and Riddle, 1984
. 2-3
days later, plates were scored for daf-9::gfp and dauer
formation.
Expression mosaics
Larvae from daf-9(dh6) dhEx66 mothers were examined by
fluorescence microscopy for daf-9 expression with M2-Bio
GFP-Binocular (Kramer Scientific), and confirmed at higher magnification with
an Axioskop 2 (Zeiss). Scored as reproductive (light intestine, vulval, seam
and gonadal cell divisions), or dauer (dauer alae, dark intestine, arrested
development, thin body and pharynx), animals were followed to confirm
expression pattern and development. Mosaic animals were found at a frequency
of
1/250.
Genotypic mosaics
ncl-1(e1865) was injected with a cocktail of ncl-1
(cosmid C33C3, 10 ng/µl), 7.1 kb daf-9::gfp (10 ng/µl) and
sur-5::gfp (pTG96, 75 ng/µl) constructs. Stable F2
extrachromosomal lines (e.g. dhEx107) were inspected to verify
ncl-1 rescue and co-segregation of ncl-1(+) and
sur-5::gfp neurons. Mosaics were analyzed from strain daf-9(dh6)
ncl-1(e1865) dhEx107. L2-L4 animals were initially screened for loss of
intestinal or neural gfp expression to see P- and AB-mosaics
respectively. To determine where in the cell lineage mosaic loss occurred, the
following cells were typically scored: CANL/R, ADL/R, BAGL/R, ASKL/R, NSML/R,
BDUL/R, ALML/R, ASIL/R, HSNL/R, EXC, Ex gland L/R, Hyp 8, 9, 10, PLML/R,
seams, posterior/anterior pharynx, somatic gonad, sex myoblasts, body muscle,
intestine, hyp7, vulva and ventral cord neurons
(Hedgecock and Herman, 1995
).
Mosaic animals were found at a frequency of
1/1000. The array
dhEx24 (T13C5, pTG96) is described elsewhere
(Gerisch et al., 2001
).
daf-9::gfp expression constructs
daf-9 constructs were made by standard molecular techniques using
genomic fragments or isoform B cDNA amplified with gene-specific primers and
cloned in front of gfp. daf-9::gfp contains 7.16 kb upstream promoter
and the entire genomic daf-9-coding region, including introns with
gfp fused at the C terminus. This construct was used to make
integrant dhIs59, dhIs64 and extrachromosomal dhEx66, as
previously described (Gerisch et al.,
2001
). dhEx67 construct is similar, but has 1.82 kb
promoter (forward, CTCCAGTTTTGGGTGTTTCAGAGCAGCG). Array dhEx203 was
made from the dr434 construct
(Jia et al., 2002
), which
consists of 3.03 kb of daf-9 promoter, isoform B cDNA with
gfp fused at the C terminus. dhEx82 construct contains 1.15
kb promoter, with intron 1 inserted in daf-9B cDNA and gfp
fused at the C terminus. To make this, a 1.68 kb genomic fragment was PCR
amplified (forward, GCTCTAGAGATACACCAGGGTATCACTTC; reverse,
TCGATTAAGAACATCAGTTC) and cloned into XbaI/XhoI sites at the
5' end of daf-9 cDNA. dhEx94 construct contains 1.19
kb daf-9 promoter, exon and intron 1. A 2.07 kb fragment was PCR
amplified (forward, CTCCAGTTTTGGGTGTTTCAGAGCAGCG; reverse,
CCCGGTACCTGATCTGAAATTTTAATATT), digested with SalI/KpnI and
a 1.44 kb subfragment cloned into L3781 (A. Fire, personal communication).
dhEx300 construct contains 0.27 kb promoter (forward, TGTTGCAAATGTTCAAAATGTCACGCTCA; reverse, GCGGTACCATTACGAGTGGCATACTGTAT), fused directly to gfp.
Heterologous tissue-specific constructs were made by inserting amplified fragments into PstI/BamHI sites in front of daf-9 cDNA, with gfp fused at the C terminus, using the following promoter regions: 0.64 kb col-3 (dhEx207), 1.15 kb dpy-7 (dhEx217), 3.45 kb F25B3.3 (dhEx256), 0.63 kb mec-7 (dhEx176), 3.59 kb sdf-9 (dhEx354) and 3.18 kb wrt-1 (dhEx294). The following primers carrying restriction sites for PstI (F primer) and BamHI (R primer) were used: col-3 (forward, GCCTGCAGCTACTTCTACACACATTGCAA; reverse, GCGGATCCGTTGGAAACTGAAGATTCTCA); dpy-7 (forward, GCCTGCAGCTATGTGCAATGTCACGTGGA; reverse, GCGGATCCCTGGAACAAAATGTAAGAATA); F25B3.3 (forward, GACTCTGCTGCAGAAAATATCTCGTCATC; reverse, GCGGATCCGATATTCTGAACAAGAAACCA); mec-7 (forward, GCCTGCAGGAGCTACGCCGAACTTGGAG; reverse, GCGGATCCGACGAATAATGGAGGAGTCA); sdf-9 (forward, GCCTGCAGGTCGACTTGTCAATGTCGCAG; reverse, GCGGATCCTTTGAAAATAATATATCTAGT); wrt-1 (forward, GCAAGCTTGTGCAAGCACAGCTAGAGGTC; reverse, GCGGATCCCATCGGATTGTGATTAGCTTC).
For F25B3.3, an internal PstI site was used for cloning. To express daf-9 under the wrt-1 promotor we introduced a HindIII site into the F-primer. A 0.12 kb HindIII/BamHI fragment of wrt-1 was cloned infront of the daf-9 cDNA, then a HindIII fragment of 3.04 kb was added. Transgenic animals were made by injecting constructs at a concentration of 10-20 ng/µl with lin-15(+) marker plasmid at 75-90 ng/µl into the germline of lin-15(n765) animals.
Quantitation of daf-9 expression
gfp fluorescence of dhIs64 and dhIs59 animals
grown at different temperatures was imaged through an Axioplan 2 Microscope
(Zeiss) and photographed with a Hamamatsu ORCA-ER camera. Pixel intensity over
a fixed area was measured with Axiovision 3.1 software (Zeiss). These
measurements were then used as a reference to quantitate expression in other
genotypes or culture conditions.
| Results |
|---|
|
|
|---|
To understand how daf-9-expressing tissues impact gene function, we asked what phenotypes were restored when daf-9 was selectively expressed. Initially, we generated expression mosaics: transgenic lines containing an extrachromosomal array of genomic daf-9::gfp (dhEx66) in the daf-9(dh6) background. Animals expressing daf-9 in hypodermis and XXX cells reached maturity, whereas cohorts without the transgene arrested as dauer larvae. Mosaics arise spontaneously either from mitotic loss or silenced expression of the array in a particular tissue. At both 20°C and 25°C, mosaics expressing daf-9 in the hypodermis bypassed diapause, had normal gonadal development and were fertile (Fig. 1A). This indicates that hypodermal expression is sufficient to drive reproductive development, including the correct timing of distal tip cell migrations. Interestingly, in such mosaics hypodermal daf-9 expression levels were often elevated, implying that daf-9-expressing XXX cells normally communicate cell non-autonomously to inhibit expression in the hypodermis. Mosaics expressing daf-9 in XXX cells alone were not found, probably because of their rarity.
|
One concern is that daf-9::gfp was overexpressed in extrachromosomal arrays, owing to multiple copies of the gene. We obtained similar results when daf-9 was present at an estimated fivefold lower molar ratio using the daf-9 cosmid T13C5 in an array marked with sur-5::gfp (dhEx24). Mosaics in which daf-9(+) was included in P2 or C only, but absent from other blastomeres reached reproductive maturity (Fig. 1D, n=4). In summary, we conclude that daf-9 works cell non-autonomously, and that hypodermal daf-9 can be sufficient to promote reproductive growth. Thus, the hypodermis is a major endocrine tissue that regulates development.
Tissue-specific rescue of daf-9 phenotypes
Hypodermal daf-9 expression
As an alternative to mosaics, we made gfp fusions to
daf-9 cDNA driven by tissue-specific promoters. When fused to
promoters from col-3 (dhEx207, hypodermis, seam cells, P
ectoblasts) (Cox and Hirsh,
1985
), dpy-7 (dhEx217, hypodermis, seam cells)
(Gilleard et al., 1997
) and
wrt-1 (dhEx294, hypodermis)
(Aspock et al., 1999
), near
wild-type function was restored in daf-9(dh6) and
daf-9(rh50) (Fig. 2,
Table 1). Transgenically
rescued animals bypassed diapause, had normal light intestines, complete
gonadal reflexion and large broods, further demonstrating that daf-9
functions cell non-autonomously and that hypodermal daf-9 suffices
for reproductive growth. Active from embryo (dpy-7) and early larvae
(col-3) to adult, and from embryo to L4 (wrt-1), these
promoters expressed hypodermal daf-9 earlier and later than normal
with no obvious effect, except that pdpy-7::daf-9 transgenics were
Daf-d, failing to form dauer larvae on starved out plates (n>300).
Thus, constitutive hypodermal expression resulted in a gain-of-function
(Daf-d) opposite the loss-of-function phenotype (Daf-c).
|
|
Epistasis experiments with daf-9 loss-of-function place it
downstream or parallel to TGFß and insulin/IGF signaling
(Gerisch et al., 2001
;
Jia et al., 2002
). We asked
how constitutive hypodermal overexpression affects these pathways. We found
that pcol-3::daf-9 and pdpy-7::daf-9 potently suppressed
Daf-c phenotypes of null allele daf-7(m62)/TGFß and partially
restored progeny production (Table
2). However, dark intestine and egg laying defects were
unaffected. Similarly, these transgenes suppressed the Daf-c phenotype of
insulin receptor mutant daf-2(e1368) and partially restored progeny
production. A stronger allele, daf-2(e1370) was also suppressed for
dauer morphogenesis, but animals arrested as sterile, dark L3/L4 larvae.
Delayed or arrested cellular development was evident in most tissues,
including somatic gonad, germline, seam and vulva. In addition, the
pcol-3::daf-9 transgene also had no effect on e1368 and
e1370 longevity (data not shown). Thus, constitutive hypodermal
daf-9 overexpression only partly rescues daf-2 for
diapause.
|
daf-9 is also weakly expressed in a few unidentified neurons
(Gerisch et al., 2001
;
Jia et al., 2002
).
Pan-neuronal expression using the F25B3.3 promoter (dhEx256)
(Altun-Gultekin et al., 2001
)
also rescued Daf-c and Mig phenotypes, but much less effectively than XXX
expression (Table 1). Finally,
expression in touch neurons with the mec-7 promoter
(Hamelin et al., 1992
) failed
to rescue (dhEx176, Table
1), revealing that daf-9 must be expressed in an
appropriate subset of neurons.
daf-9 promoter constructs
To define the daf-9 promoter regions mediating tissue-specific
expression, we generated a number of constructs
(Fig. 2G). A 1.44 kb fragment
containing 1.19 kb of promoter, exon and intron 1 maintained expression in all
tissues (dhEx94). 0.27 kb promoter fused directly to gfp,
maintains robust XXX cell expression only (dhEx300), revealing that
an XXX element resides in this small region, while hypodermal and spermathecal
elements may lie upstream and downstream of this. Indeed, the daf-9
cDNA construct with 3.03 kb of promoter but lacking introns (dhEx203)
was expressed solely in XXXL/R, and reintroducing intron 1 restored hypodermal
and spermathecal expression (dhEx82). Thus, their elements probably
reside within intron 1.
Environmental influences on daf-9 expression
We next looked at the effect of environmental conditions on daf-9
expression under control of the endogenous promoter. We varied temperature,
cholesterol, food and dauer pheromone, and observed daf-9::gfp levels
by fluorescence microscopy. Integrants, dhIs64 as well as
dhIs59, which expressed at half the level (data not shown), gave
similar results. Hypodermal daf-9 showed a striking pattern of
regulation by environmental conditions, as follows. In favorable environments
(abundant food and cholesterol, 20°C, low pheromone) hypodermal
daf-9 was weakly expressed (Figs
3,
4). Conditions of mild stress
(reduced food and cholesterol, 22-25°C, higher pheromone) not sufficient
to drive dauer formation, resulted in upregulation. However, in strongly dauer
inducing conditions (low food and cholesterol, 27°C, high pheromone)
hypodermal daf-9 was switched off, as detailed below.
|
|
Cholesterol
C. elegans requires cholesterol for growth and development.
Wild-type animals cultured in cholesterol-deficient media display gonadal Mig
phenotypes similar to daf-9(rh50) and form dauer-like larvae
(Gerisch et al., 2001
). We
observed that hypodermal daf-9 was also sensitive to dietary
cholesterol (Fig. 4A-D). A
minor reduction (NG minus cholesterol plates and washed OP50), as judged by
absence of cellular phenotype, maximally upregulated hypodermal
daf-9. A further reduction (agarose plates with washed OP50), as
judged by presence of Mig animals, did not lead to a further increase.
Finally, in dauer larvae formed by cholesterol deprivation there was no
expression. Excess cholesterol had no effect.
Food
In abundant food, hypodermal daf-9 was weakly expressed. As food
is decreased 10-fold, expression increased
(Fig. 4E). Further dilution led
to weaker or no expression. Some of these animals formed dauer larvae.
Pheromone
As pheromone increased, hypodermal daf-9 increased in expression
(Fig. 4F). At higher pheromone
concentrations, when animals entered dauer, expression ceased.
Taken together, these results imply that the response of hypodermal daf-9 to environmental cues modulates dauer commitment, antagonizing it under weak dauer-inducing conditions.
Genetic influences on daf-9 expression
We next examined the effect of genotype by introducing daf-9::gfp
(dhIs64) into various Daf mutant backgrounds representing nuclear
hormone, insulin/IGF, TGFß and cGMP signaling
(Table 3). Similar results were
obtained with dhIs59 (Table
4).
|
|
|
We reasoned that if reduced hormone binding upregulates hypodermal daf-9, then daf-9 mutants themselves, presumably diminished in hormone production, could also influence hypodermal expression. We made a promoter fusion consisting of 1.19 kb upstream region plus the first intron of daf-9 joined to gfp (dhEx94) (Fig. 2G). Expressed in all three cell types, this transgene makes no functional DAF-9 product. When introduced into the hypomorphic mutant daf-9(rh50), dhEx94 was strongly overexpressed (Fig. 5B), suggesting autoregulation. By contrast, in the daf-9(dh6) null background, hypodermal expression was off (Fig. 5C). Thus, although partial reduction of daf-9 activity stimulates hypodermal daf-9 expression, complete loss of daf-9 activity does not.
Insulin/IGF signaling
We crossed daf-9::gfp into the backgrounds of insulin/IGF pathway
mutants daf-2/insulin/IGF receptor and daf-16/FOXO. For
daf-2 we used conditional temperature-sensitive Daf-c alleles, which
are fully suppressed by the Daf-d null daf-16(mgDf50)
(Gottlieb and Ruvkun, 1994
;
Ogg et al., 1997
). Whereas
hypodermal daf-9 was strongly upregulated in daf-2
reproductively growing animals relative to daf-2(+), daf-2 dauer
larvae showed no hypodermal expression
(Table 3, Fig. 6C,D). Alone,
daf-16(mgDf50) had little effect on daf-9 expression. Moreover,
hypodermal upregulation was not daf-16 dependent, as
daf-16daf-2 animals had elevated hypodermal expression at 20°C
(Fig. 6G,H) and even higher
expression at 25°C. By contrast, in daf-2daf-12 animals,
expression ceased (Fig. 6F) showing daf-12 dependence.
|
300)
and 0% (n
300) without the transgene. This may be because of the
presence of multiple copies of the daf-9 regulatory region, as
hypodermal overexpression with heterologous promoters (see above) did not
enhance Daf-c phenotypes. It could also reflect the effect of overexpression
in XXX cells. To address the possibility that TGFß or insulin/IGF pathways substitute for one another, we crossed dhIs64 into a daf-3daf-16 double mutant (Table 3). Yet even in this background a normal response of hypodermal daf-9 expression to temperature was seen. Thus, during reproductive growth, thermal influences on hypodermal expression can occur independently of major transcriptional outputs of TGFß and insulin/IGF signaling.
| Discussion |
|---|
|
|
|---|
DAF-9 regulates diapause cell non-autonomously
Consistent with an endocrine mode of action, daf-9 regulates
diapause cell non-autonomously. Overexpressing daf-9 constitutively
in the hypodermis, using col-3, dpy-7 and wrt-1 promoters,
efficiently rescued daf-9 phenotypes. Animals bypassed diapause,
displayed light intestines, normal gonadal development and near normal brood
sizes. In mosaic experiments using daf-9 constructs under control of
the endogenous promoter, animals that retained hypodermal expression, but had
lost expression in XXX cells reached reproductive maturity. Particularly
revealing were C+ only mosaics, where daf-9 expression was limited to
hypodermis, body muscle and a few neurons. Despite the fact that most cells
were genotypically daf-9(), tissues expressed reproductive
programs. It is possible that our experiments overestimate the importance of
the hypodermis simply because daf-9 is overexpressed in transgenic
arrays. Nevertheless, genotypic mosaics that contained daf-9 on a
cosmid at a fivefold lower gene dose also led to reproductive development when
expressed in the C blastomere only. Thus, hypodermal expression of
daf-9 is sufficient to avert diapause and drive reproductive
development, and daf-9 acts cell non-autonomously.
daf-9 function in XXX cells also promotes reproductive development
based on a number of lines of evidence. First, laser ablation of XXX cells
leads to transient dauer-like arrest in a proportion of animals
(Gerisch et al., 2001
;
Ohkura et al., 2003
). However,
the majority of such animals reach maturity, showing that XXX is important but
not essential for diapause regulation. Such microsurgery experiments remove
not only the daf-9 signal, but others as well. To address this, we
selectively expressed daf-9 in XXX cells. Driven by an endogenous XXX
regulatory element or heterologous sdf-9 promoter, daf-9 XXX
variably rescued Daf-c and gonadal defects of daf-9 mutants,
confirming that expression in XXX cells promotes reproductive development.
Again, because transgenes may overexpress daf-9 it is unclear how
closely this reflects the native situation.
In addition, the XXX cells also communicate with the hypodermis. Ablation
of XXX cells (Gerisch et al.,
2001
) or mosaic loss of an extrachromosomal array upregulated
daf-9 hypodermal expression, showing that daf-9 products
from XXX cells normally inhibit hypodermal daf-9.
daf-9 works downstream of insulin/IGF and TGFß signaling
Epistasis experiments reveal that daf-9 loss of function acts
downstream or parallel to daf-16/FOXO, daf-3/SMAD and
daf-5/SNO, but upstream of daf-12, with respect to diapause
(Gerisch et al., 2001
;
Jia et al., 2002
).
Overexpressing daf-9 constitutively in the hypodermis confirmed and
extended these observations. daf-9 driven by dpy-7 and
col-3 promoters efficiently rescued the Daf-c phenotypes of a null
mutant in daf-7/TGFß ligand, as well as in two hypomorphic
mutants of the daf-2/insulin/IGF receptor. In the daf-7
mutant and the less severe daf-2 mutant, animals reached reproductive
maturity. By contrast, overexpressing daf-9 did not effectively
suppress daf-12 Mig phenotypes, consistent with daf-9 action
through daf-12.
Transcriptional regulation of hypodermal daf-9 is likely to be a
rate-limiting point of control in the hormone metabolic pathway in which this
gene functions. That daf-9 overexpression bypasses larval defects of
insulin/IGF and TGFß signaling mutants suggests that both pathways
somehow act via activation of daf-9. Suppression of daf-2 in
particular suggests that analogous secondary endocrines in vertebrates might
be able to ameliorate diabetic or other metabolic syndromes. Possibly
PPAR
agonists work similarly to reverse cases of type 2 diabetes
(Rocchi and Auwerx, 1999
).
However, not all defects were suppressed by daf-9 overexpression. For example, daf-7 egg laying and dark intestine phenotypes prevailed. Although overt dauer morphogenesis was absent in rescued daf-2(e1370) strains, animals remained developmentally arrested as L3/L4 larvae with dark intestines typical of daf-2 alone. Clearly both of these branches of the dauer pathway must also have daf-9-independent outputs.
Environmental signals regulate daf-9
Changes in daf-9 expression are a striking visible readout for
environmental influences on diapause, reflecting a central role in dauer
regulation. As predicted, daf-9 expression was sensitive to the
environment, but primarily in the hypodermis. Here, by mid-L2 it was
upregulated, signifying commitment to reproductive development, but switched
off in the dauer larvae. Interestingly, the epidermis is a primitive endocrine
tissue in many arthropods, including Drosophila
(Lafont, 2000
;
Warren et al., 2002
), and even
in vertebrates steroidogenic enzymes are expressed in skin
(Slominski et al., 1996
).
Hypodermal daf-9 expression is not, however, simply an on-off
switch. Notably, under mild dauer-inducing conditions hypodermal
daf-9 was actually upregulated. One possibility is that this reflects
a homeostatic response to ensure reproductive development in the face of mild
adversity. Although the final choice between diapause and reproductive growth
is not graded, but all or none (Antebi et
al., 1998
; Apfeld and Kenyon,
1998
), animals must nevertheless adapt to different levels of
stress. For example, preceding any final commitments to diapause, nematodes
already shift to fat and carbohydrate storage, lengthen the molt cycle and
change their foraging behavior (Golden and
Riddle, 1984
; Thomas et al.,
1993
).
By contrast, daf-9 expression in XXX cells increased in dauer
larvae. This is surprising, as daf-9 expression in XXX cells alone
supported reproductive growth of daf-9 mutants. Perhaps
post-transcriptional regulation in XXX cells is key. Supporting this view,
overexpression of daf-9 in XXX cells alone, under the control of the
endogenous and sdf-9 promoters did not bypass the Daf-c phenotypes of
daf-2 and daf-7. Genetic analysis of the sdf-9
phosphatase-like protein suggests that it post transcriptionally augments
DAF-9 activity (Ohkura et al.,
2003
).
Dietary cholesterol influences dauer signaling
Aside from food, pheromone and temperature, evidently dietary cholesterol
impacts hypodermal daf-9 expression and dauer signaling. Cholesterol
promotes reproductive development and fertility; deprivation arrests growth,
impedes molting and decreases fertility
(Shim et al., 2002
;
Yochem et al., 1999
). In
addition, reduced cholesterol phenocopies gonadal Mig and Daf-c defects in
wild type, and enhances weak daf-9 mutant phenotypes
(Gerisch et al., 2001
;
Jia et al., 2002
). Here, we
found that although modest decreases in cholesterol also upregulated
hypodermal daf-9, cholesterol starvation induced dauer formation and
abolished daf-9 expression.
Because cholesterol is the precursor to steroids, oxysterols, bile acids
and vitamin D, cholesterol starvation is likely to perturb the production of
sterol-derived hormones that regulate diapause. Interestingly, Niemann-Pick
type C proteins mediate intracellular cholesterol trafficking
(Ribeiro et al., 2001
) and
deletion of the two C. elegans homologs leads to a Daf-c phenotype
(Sym et al., 2000
). One of the
homologues is reportedly expressed in the XXX cells
(Ohkura et al., 2003
). It is
also possible that cholesterol availability indirectly influences the
metabolism of a DAF-12 hormone.
DAF-12 regulates daf-9 expression in a feedback loop
What is the molecular basis of daf-9 hypodermal regulation?
Notably, it was wholly dependent on daf-12, suggesting that DAF-12(+)
positively promotes daf-9 expression. By contrast, other Daf-d loci,
such as daf-16, daf-3 and daf-5 alone, as well as
daf-16daf-3 double mutants had little effect. Moreover, DAF-12 may
require some threshold level of a DAF-9-produced hormone to promote hypodermal
expression, as such expression was absent in daf-9 null mutants.
daf-12 dependence is somewhat surprising because by genetic epistasis
it lies downstream of daf-9. Conceivably, within this endocrine
tissue daf-9 expression is DAF-12 regulated, but within downstream
target tissues DAF-12 acts epistatically.
Other genetic evidence supports the view that DAF-12's activity on the
daf-9 promoter is regulated by negative feedback. First, hypomorphic
daf-9 alleles, which are predicted to diminish hormone production
potently upregulated a daf-9 promoter construct. Second, missense
mutations in the daf-12 ligand-binding domain, predicted to diminish
affinity for ligand, also resulted in upregulation. If DAF-12 regulates the
daf-9 promoter directly, it suggests that DAF-12's transcriptional
activity is inhibited by the daf-9 hormone. Interestingly, an
evolutionarily related vertebrate homolog, CAR-ß is a constitutively
active nuclear receptor the activity of which is inhibited by androstane
ligands (Forman et al., 1998
).
Ecdysone receptor also initially positively promotes ecdysone production, but
then negatively feeds back on synthesis
(Lafont, 2000
).
Daf-c mutants from insulin/IGF, TGFß and cGMP pathways affected hypodermal daf-9 expression much like environmental perturbations and daf-9 mutants, causing upregulated hypodermal expression in reproductively growing animals but no expression in Daf-c dauer larvae. Notably, elevated daf-9 expression was largely independent of the transcriptional outputs of these pathways, but dependent on daf-12. This observation suggests that insulin/IGF and TGFß signaling cascades could directly regulate DAF-9 or DAF-12.
daf-9 has multiple larval functions
The role of daf-9 in dauer formation was separable from its later
role in gonadogenesis. For example, restoration of daf-9 in XXX cells
alone often led to dauer bypass, but subsequent gonadal defects. Additionally,
cultures of daf-9 mutants are typically either Daf-c or Mig, not
mixtures of the two phenotypes. This could potentially be explained by the
feedback regulation of daf-9 described here. Although daf-9
null mutants lack daf-9 expression, hypomorphs may have increased
hypodermal daf-9, as seen in daf-9(rh50), thereby averting
diapause. Potentially, lower levels of daf-9 activity driven by the
feedback loop are sufficient to bypass diapause, whereas higher levels are
required to promote gonadal development. Alternatively, daf-9 may be
required at different times, at the L3 commitment for the dauer decision, and
L4 commitment for gonadal cell migration programs.
We interpret gonadal Mig phenotypes as a heterochronic delay in
stage-specific migration programs, where cells repeat earlier steps and fail
to advance to the next stage (Antebi et
al., 1998
). Such a program may regulate the general migratory
machinery, as well as instructive surface receptors that guide cellular
pathfinding in strict temporal sequence. Indeed, the UNC-5 receptor, repelled
by ventral UNC-6/netrin cues, guides the distal tip cells dorsally, and is
expressed in a delayed fashion or not at all in daf-9 and
daf-12 ligand-binding domain mutants
(Su et al., 2000
). Evidently
this program is advanced by hormonal signals. Interestingly, ecdysteroid
signaling regulates the timing of border cell migration in the
Drosophila ovary (Bai et al.,
2000
). Moreover, metastatic tumors can subvert hormonally
activated migration programs (Green and
Furr, 1999
), and be influenced by UNC-5 status
(Thiebault et al., 2003
).
The dauer endocrine network
Our data suggest a three state model for regulation of diapause involving
homeostatic feedback regulation of daf-9 expression. In
dauer-inducing conditions (Fig.
7A), environmental cues downregulate insulin/IGF, TGFß and/or
lipophilic hormone signaling below a crucial threshold. This leads to a
failure to express hypodermal daf-9, possibly because DAF-12 activity
is low or inactive. DAF-9 activity in XXX cells may also be similarly
influenced. Consequently, reproductive hormone levels drop. In target tissues,
unliganded DAF-12 specifies diapause. In conditions of moderate stress
(Fig. 7B), initially low levels
of reproductive hormone and/or TGFß and insulin/IGF signaling result in
compensatory upregulation of hypodermal daf-9 by DAF-12. This drives
reproductive programs, including the appropriate timing of gonadal distal tip
cell migrations. In replete environments
(Fig. 7C), daf-9
reproductive hormone levels are high, and partly inhibit DAF-12
transcriptional effects on the daf-9 promoter, keeping hormone levels
within normal bounds. In reproductively growing larvae, XXX cells could
secrete tonic levels of hormone, whereas hypodermis may respond dynamically to
changes in XXX cell activity or directly to genetic and environmental inputs.
It is possible that DAF-12 ligand-binding domain occupancy is a central
integrator of this information. However, DAF-12 activity may also be modified
directly by daf-9-independent inputs originating from TGFß and
insulin/IGF signaling.
|
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Ailion, M. and Thomas, J. H. (2000). Dauer
formation induced by high temperatures in Caenorhabditis elegans.Genetics 156,1047
-1067.
Altun-Gultekin, Z., Andachi, Y., Tsalik, E. L., Pilgrim, D.,
Kohara, Y. and Hobert, O. (2001). A regulatory cascade
of three homeobox genes, ceh-10, ttx-3 and ceh-23, controls
cell fate specification of a defined interneuron class in C. elegans.Development 128,1951
-1969.
Antebi, A., Culotti, J. G. and Hedgecock, E. M. (1998). daf-12 regulates developmental age and the dauer alternative in C. elegans. Development 125,1191 -1205.[Abstract]
Antebi, A., Yeh, W. H., Tait, D., Hedgecock, E. M. and Riddle,
D. L. (2000). daf-12 encodes a nuclear receptor that
regulates the dauer diapause and developmental age in C. elegans.Genes Dev. 14,1512
-1527.
Apfeld, J. and Kenyon, C. (1998). Cell nonautonomy of C. elegans daf-2 function in the regulation of diapause and life span. Cell 95,199 -210.[CrossRef][Medline]
Aspock, G., Kagoshima, H., Niklaus, G. and Burglin, T. R.
(1999). C. elegans has scores of hedgehog-related genes:
sequence and expression analysis. Genome Res.
9, 909-923.
Bai, J., Uehara, Y. and Montell, D. J. (2000). Regulation of invasive cell behavior by taiman, a Drosophila protein related to AIB1, a steroid receptor coactivator amplified in breast cancer. Cell 103,1047 -1058.[CrossRef][Medline]
Birnby, D. A., Link, E. M., Vowels, J. J., Tian, H., Colacurcio,
P. L. and Thomas, J. H. (2000). A transmembrane
guanylyl cyclase (DAF-11) and Hsp90 (DAF-21) regulate a common set of
chemosensory behaviors in C. elegans. Genetics
155,85
-104.
Cassada, R. and Russell, R. (1975). The dauer-larva: a post-embryonic developmental variant of the nematode C. elegans. Dev. Biol. 46,326 -342.[CrossRef][Medline]
Cox, G. N. and Hirsh, D. (1985). Stage-specific
patterns of collagen gene expression during development of Caenorhabditis
elegans. Mol. Cell. Biol. 5,363
-372.
da Graca, L. S., Zimmerman, K. K., Mitchell, M. C., Kozhan-Gorodetska, M., Sekiewicz, K., Morales, Y. and Patterson, G. I. (2003). DAF-5 is a Ski oncoprotein homolog that functions in a neuronal TGFb pathway to regulate C. elegans dauer development. Development 131,435 -446.
Estevez, M., Attisano, L., Wrana, J. L., Albert, P. S., Massague, J. and Riddle, D. L. (1993). The daf-4 gene encodes a bone morphogenetic protein receptor controlling C. elegans dauer larva development. Nature 365,644 -649.[CrossRef][Medline]
Finch, C. E. and Ruvkun, G. (2001). The genetics of aging. Annu. Rev. Genomics Hum. Genet. 2, 435-462.[CrossRef][Medline]
Forman, B. M., Tzameli, I., Choi, H. S., Chen, J., Simha, D., Seol, W., Evans, R. M. and Moore, D. D. (1998). Androstane metabolites bind to and deactivate the nuclear receptor CAR-beta. Nature 395,612 -615.[CrossRef][Medline]
Gems, D., Sutton, A. J., Sundermeyer, M. L., Albert, P. S.,
King, K. V., Edgley, M. L., Larsen, P. L. and Riddle, D. L.
(1998). Two pleiotropic classes of daf-2 mutation affect
larval arrest, adult behavior, reproduction and longevity in C. elegans.Genetics 150,129
-155.
Georgi, L. L., Albert, P. S. and Riddle, D. L. (1990). daf-1, a C. elegans gene controlling dauer larva development, encodes a novel receptor protein kinase. Cell 61,635 -645.[CrossRef][Medline]
Gerisch, B., Weitzel, C., Kober-Eisermann, C., Rottiers, V. and Antebi, A. (2001). A hormonal signaling pathway influencing C. elegans metabolism, reproductive development, and life span. Dev. Cell 1,841 -851.[CrossRef][Medline]
Gilleard, J. S., Barry, J. D. and Johnstone, I. L. (1997). cis regulatory requirements for hypodermal cell-specific expression of the Caenorhabditis elegans cuticle collagen gene dpy-7. Mol. Cell. Biol. 17,2301 -2311.[Abstract]
Golden, J. W. and Riddle, D. L. (1984). The Caenorhabditis elegans dauer larva: developmental effects of pheromone, food, and temperature. Dev. Biol. 102,368 -378.[CrossRef][Medline]
Gottlieb, S. and Ruvkun, G. (1994). daf-2, daf-16 and daf-23: genetically interacting genes controlling Dauer formation in Caenorhabditis elegans. Genetics 137,107 -120.[Abstract]
Green, S. and Furr, B. (1999). Prospects for the treatment of endocrine-responsive tumours. Endocr. Relat. Cancer 6,349 -371.[Abstract]
Hamelin, M., Scott, I. M., Way, J. C. and Culotti, J. G. (1992). The mec-7 beta-tubulin gene of Caenorhabditis elegans is expressed primarily in the touch receptor neurons. EMBO J. 11,2885 -2893.[Medline]
Hedgecock, E. M. and Herman, R. K. (1995). The ncl-1 gene and genetic mosaics of Caenorhabditis elegans.Genetics 141,989 -1006.[Abstract]
Henderson, S. T. and Johnson, T. E. (2001). daf-16 integrates developmental and environmental inputs to mediate aging in the nematode Caenorhabditis elegans. Curr. Biol. 11,1975 -1980.[CrossRef][Medline]
Hsin, H. and Kenyon, C. (1999). Signals from the reproductive system regulate the lifespan of C. elegans.Nature 399,362 -366.[CrossRef][Medline]
Inoue, T. and Thomas, J. H. (2000). Targets of TGF-beta signaling in C. elegans dauer formation. Dev. Biol. 217,192 -204.[CrossRef][Medline]
Jia, K., Albert, P. S. and Riddle, D. L.
(2002). DAF-9, a cytochrome P450 regulating C. elegans
larval development and adult longevity. Development
129,221
-231.
Kimura, K. D., Tissenbaum, H. A., Liu, Y. and Ruvkun, G.
(1997). daf-2, an insulin receptor-like gene that
regulates longevity and diapause in C. elegans.Science 277,942
-946.
Lafont, R. (2000). Understanding insect endocrine systems: molecular approaches. Entomologia experimentalis et Applicata 97,123 -126.[CrossRef]
Larsen, P. L. (1993). Aging and resistance to
oxidative damage in C. elegans. Proc. Natl. Acad. Sci.
USA 90,8905
-8909.
Lee, R. Y., Hench, J. and Ruvkun, G. (2001). Regulation of C. elegans DAF-16 and its human ortholog FKHRL1 by the daf-2 insulin-like signaling pathway. Curr. Biol. 11,1950 -1957.[CrossRef][Medline]
Li, W., Kennedy, S. G. and Ruvkun, G. (2003).
daf-28 encodes a C. elegans insulin superfamily member that
is regulated by environmental cues and acts in the DAF-2 signaling pathway.
Genes Dev. 17,844
-858.
Lin, K., Hsin, H., Libina, N. and Kenyon, C. (2001). Regulation of the Caenorhabditis elegans longevity protein DAF-16 by insulin/IGF-1 and germline signaling. Nat. Genet. 28,139 -145.[CrossRef][Medline]
Lithgow, G. J., White, T. M., Melov, S. and Johnson, T. E.
(1995). Thermotolerance and extended life-span conferred by
single-gene mutations and induced by thermal stress. Proc. Natl.
Acad. Sci. USA 92,7540
-7544.
Morris, J. Z., Tissenbaum, H. A. and Ruvkun, G. (1996). A phosphatidylinositol-3-OH kinase family member regulating longevity and diapause in C. elegans.Nature 382,536 -539.[CrossRef][Medline]
Murakami, S. and Johnson, T. E. (1996). A genetic pathway conferring life extension and resistance to UV stress in Caenorhabditis elegans. Genetics 143,1207 -1218.[Abstract]
Ogg, S. and Ruvkun, G. (1998). The C. elegans PTEN homolog, DAF-18, acts in the insulin receptor-like metabolic signaling pathway. Mol. Cell 2, 887-893.[CrossRef][Medline]
Ogg, S., Paradis, S., Gottlieb, S., Patterson, G. I., Lee, L., Tissenbaum, H. A. and Ruvkun, G. (1997). The Fork head transcription factor DAF-16 transduces insulin-like metabolic and longevity signals in C. elegans. Nature 389,994 -999.[CrossRef][Medline]
Ohkura, K., Suzuki, N., Ishihara, T. and Katsura, I.
(2003). SDF-9, a protein tyrosine phosphatase-like molecule,
regulates the L3/dauer developmental decision through hormonal signaling in
C. elegans. Development
130,3237
-3248.
Paradis, S. and Ruvkun, G. (1998). C.
elegans Akt/PKB transduces insulin receptor-like signals from AGE-1 PI3
kinase to the DAF-16 transcription factor. Genes Dev.
12,2488
-2498.
Paradis, S., Ailion, M., Toker, A., Thomas, J. H. and Ruvkun, G. (1999). A PDK1 homolog is necessary and sufficient to transduce AGE-1 PI3 kinase signals that regulate diapause in C. elegans.Genes Dev. 13,1438 -