|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 31 March 2004
doi: 10.1242/dev.01093
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1 Zebrafish Neurogenetics Junior Research Group, Institute of Virology,
Technical University-Munich, Trogerstrasse 4b, D-81675 Munich, Germany and
GSF-National Research Center for Environment and Health, Institute of
Developmental Genetics, Ingolstaedter Landstrasse 1, D-85764 Neuherberg,
Germany
2 Institut de Génétique et de Biologie Moléculaire et
Cellulaire, CNRS/INSERM/ULP, 1 rue Laurent Fries, BP 10142, F-67404 Illkirch
Cedex, C.U. de Strasbourg, France
Author for correspondence (e-mail:
bally{at}gsf.de)
Accepted 21 January 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Her5, Hairy, Midbrain-hindbrain boundary, Zebrafish, Neurogenesis, Pre-patterning
| Introduction |
|---|
|
|
|---|
Neurogenesis has been extensively studied in Drosophila (reviewed
by Campos-Ortega, 1993
).
First, populations of cells competent to undergo neurogenesis are defined
giving rise to so-called `proneural fields' or `proneural clusters', within
which neuronal progenitors are selected. Progenitor selection relies on
lateral inhibition mediated by the Notch receptor. Cells expressing high
levels of the Notch ligand Delta will commit to neuronal differentiation and
at the same time inhibit the neighbouring cells to enter the neuronal program
(Simpson, 1997
). After binding
of Delta, the Notch receptor undergoes intra-membranous cleavage to generate a
Notch Intra-Cellular Domain (NICD), which translocates to the nucleus, binds
members of the Suppressor-of-Hairless (SU(H)) family and activates
transcription of downstream effectors
(Lecourtois and Schweisguth,
1998
; Struhl and Adachi,
1998
; Bray and Furriols,
2001
; Mumm and Kopan,
2000
). Major Notch targets are basic helix-loop-helix (bHLH)
transcriptional repressors of the Enhancer-of-Split [E(Spl)] family, which
prevent activity of proneural factors driving neurogenesis
(Fisher and Caudy, 1998
).
Cells expressing high levels of Delta, by contrast, will maintain activity of
proneural factors (such as the bHLH proteins Achaete, Scute and Atonal) and
Delta transcription. Thus, initial differences in the levels of Delta
expression among the cells of a proneural cluster are amplified, leading to
the reinforcement of a neuronal fate.
Current evidence suggests that neurogenesis uses similar molecules in
vertebrates as in invertebrates (Appel and
Chitnis, 2002
; Chitnis,
1999
; Lewis,
1998
). In these species, a number of Notch-, Delta-like and
bHLH-encoding genes are involved in similar cascades within the neurogenic
domains of the neural tube (Blader et al.,
1997
; Chitnis et al.,
1995
; Chitnis and Kintner,
1996
; de la Pompa et al.,
1997
; Haddon, 1998; Ma et al.,
1996
; Takke et al.,
1999
). Vertebrate bHLH factors include the Neurogenin and Ath
(Atonal-related), Ash (Achaete-Scute-related), and Hairy/E(spl) (Hes and Hairy
in mouse and chicken, Her in zebrafish) subclasses, of which the first three
have proneural activity, while most Hairy/E(spl) factors inhibit neurogenesis
(Bertrand et al., 2002
;
Fisher and Caudy, 1998
;
Kageyama and Nakanishi, 1997
;
Lee, 1997
). Proneural bHLH
factors are expressed with partially overlapping patterns. However, whether
they play redundant or rather combinatorial roles remains in most cases
unknown (Cau and Wilson, 2003
;
Mizuguchi et al., 2001
;
Parras et al., 2002
).
Although lateral inhibition is a major and evolutionarily conserved
mechanism in restricting the extent of neurogenesis within proneural fields,
the prepatterning mechanisms that specify these fields in the first place seem
more variable and are less well understood. Both in invertebrates and
vertebrates, a combination of positive and negative factors, the expression of
which is controlled by the embryonic patterning machinery, establishes a grid
of neurogenesis-competent domains along the anteroposterior (AP) and
dorsoventral (DV) axes. Several cases of neuronal inhibition independent of
lateral inhibition have been reported in vertebrates
(Bellefroid et al., 1998
;
Bourguignon et al., 1998
;
Andreazzoli et al., 2003
). Many
local neurogenesis repressors belong to the Hairy family
(Bally-Cuif and Hammerschmidt,
2003
; Sasai,
1998
). For example, Hairy restricts neuronal competence within the
Drosophila peripheral nervous system
(Fisher and Caudy, 1998
). In a
reminiscent manner, Xenopus ESR6e prevents neurogenesis in the
embryonic superficial ectoderm (Chalmers
et al., 2002
), and mouse Hes1 negatively controls neurogenic
domains within the olfactory epithelium
(Cau et al., 2000
). Hairy and
the related E(Spl) proteins distinguish themselves from other bHLH factors by
a proline residue in their DNA-binding domain and a C-terminal WRPW
tetrapeptide. In contrast to E(spl), however, they can act independently of
Notch signalling.
The midbrain-hindbrain (MH) is an interesting domain of the neural plate to
study the mechanisms controlling the spatial extent of neurogenesis
(Martinez, 2001
;
Rhinn and Brand, 2001
;
Wurst and Bally-Cuif, 2001
),
as the midbrain-hindbrain boundary (MHB) is characterised by delayed neuronal
differentiation (Bally-Cuif et al.,
1993
; Palmgren,
1921
; Vaage, 1969
;
Wullimann and Knipp, 2000
).
This `intervening zone' (IZ) separates midbrain from hindbrain neuronal
clusters and is believed to serve as a pool of precursor cells for the
construction of MH structures during development. The functional importance of
the IZ is highlighted in
Hes1-/-;Hes3-/- mouse mutants, where
MH precursor cells differentiate prematurely, leading to the development of an
abnormally small MH and to the lack of specific MH neuronal populations such
as midbrain dopaminergic neurons, cranial neurons III and IV, or the locus
coeruleus (Hirata et al.,
2001
). We recently demonstrated that, in the zebrafish, the
Hairy/E(spl)-like bHLH transcription factor Her5 is crucially required for IZ
formation at the onset of neurogenesis
(Geling et al., 2003
).
her5 (Müller et al.,
1996
) is expressed from 70% epiboly onwards in a domain of the
neural plate that prefigures the early IZ and separates the first anterior
neuronal cluster (ventrocaudal cluster, vcc) from presumptive motor- and
lateral neurons in rhombomere 2 (r2M and r2L)
(Fig. 1A-B')
(Geling et al., 2003
).
Impairment of Her5 activity leads to the ectopic generation of cells
expressing neurogenin1 (ngn1) and later of differentiated
neurons across the medial (future ventral) aspect of the IZ
(Fig. 1C,C')
(Geling et al., 2003
). Thus,
Her5 is crucial in inhibiting neurogenesis within the IZ and in maintaining
the full MH precursor pool in zebrafish. However, to date, the molecular mode
of action of Her5 has not been analysed.
|
| Materials and methods |
|---|
|
|
|---|
Transgenic lines
ngn1 transgenic reporter lines (8.4ngn1:gfp,
3.4ngn1:gfp, 3.1ngn1:gfp)
(Fig. 6A, left panel,
6B-H') have been described previously
(Blader et al., 2003
). Ectopic
activation of her5 expression was achieved by applying to
pzhsp70:her5 (homo or heterozygote) transgenic embryos a heat-shock
pulse between 80% epiboly and tail-bud stage, as described
(Geling et al., 2003
).
pzhsp70:her5 transgenic embryos were identified by PCR following in
situ hybridisation (Geling et al.,
2003
).
|
Eboxngn1:gfp) and transient reporter assays
Eboxngn1:gfp, the E-box located in the ANPE
element (CATGTG) was selectively replaced by an unrelated sequence (TCTAGA),
using standard procedures. Details of these constructs are available upon
request. Both constructs were then flanked by I SceI restriction
sites, which allow efficient integration in the Medaka genome in co-injection
with the I SceI meganuclease enzyme
(Thermes et al., 2002
E-Boxngn1:gfp circular plasmid DNAs were
injected together with 1 U/µl I-SceI meganuclease (Roche, 10
U/µl) into wild-type embryos at the one-cell stage. Embryos were left to
develop at 28°C upon injection and fixed at 1-3 somites for in situ
hybridisation analysis.
Antisense experiments
The morpholino antisense oligonucleotide MOher5
(Gene-Tools Inc., Oregon, USA) was described previously and demonstrated to
fully and specifically inhibit the translation of endogenous her5
mRNA (Geling et al., 2003
). It
was dissolved to a stock concentration of 2 mM in H2O and injected
into one-cell stage wild-type or transgenic embryos at 2 mM.
RNA injections
To prepare coe2 capped RNA, the full-length coding region of
coe2 (Bally-Cuif et al.,
1998
) was PCR-amplified using the following primers: upstream,
5' GCGAATTCGCACAAGTGTCAT 3'; downstream, 5'
CGCTCGAGATCAGGAGATTACACA 3'. It was then subcloned into the pXT7 vector
(Dominguez et al., 1995
) and
verified by sequencing. her5VP16 encodes a dominant form of Her5 and
was described previously (Bally-Cuif et
al., 2000
). All capped RNAs were synthesised using Ambion mMessage
mMachine kits following the recommended procedure. RNAs were injected at the
following concentrations: 100 ng/µl Notch-nicd-myc
(Takke et al., 1999
); 100
ng/µl XDeltastu (Haddon, 1998); with or without
nls-lacZ (40 ng/µl) as lineage tracer; 100 ng/µl
Xcoe2
DBD (Dubois
et al., 1998
); 100 ng/µl coe2; 5 ng/µl
her5VP16. For capped RNA injections together with the
MOher5 we used 100 ng/µl NICD or
XDeltastu RNAs together with 2 mM MOher5.
DAPT treatment
DAPT treatment was performed as described
(Geling et al., 2002
) from 60%
epiboly until the three-somite stage. After treatment, the embryos were fixed
with 4% PFA overnight at 4°C and processed for in situ hybridisation.
In situ hybridisation and immunohistochemistry
Probe synthesis, in situ hybridisation and immunohistochemistry were
carried out as previously described
(Hammerschmidt et al., 1996
).
The following antibodies were used: rabbit anti-ß-galactosidase (Cappel)
(dilution 1:4000), mouse anti-Myc (Sigma 9E10) (dilution 1:1000), mouse
anti-HNK1 (DSHB Zn12) (dilution 1:500) and rabbit anti-GFP (AMS TP401)
(dilution 1:500). Secondary antibodies were goat anti-mouse-HRP, goat
anti-rabbit-HRP, goat anti-mouse-Cy3 and goat anti-rabbit-FITC (Jackson
ImmunoResearch Laboratories), all diluted to 1:200. The staining for
HRP-conjugated antibodies was revealed with DAB following standard
protocols.
| Results |
|---|
|
|
|---|
|
Together, these observations indicate that both her5 expression
and its activity, although inhibited by NICD in an artificial overexpression
context, are independent of Notch signalling. This is in striking contrast to
the E(Spl)-like bHLH factors that act downstream of Notch in lateral
inhibition during neurogenesis (Bertrand
et al., 2002
; Fisher and
Caudy, 1998
).
Her5 activity is required to inhibit the establishment of a neurogenic field in the medial IZ
The above experiments indicate that Her5 does not act as a downstream
effector of Notch to promote lateral inhibition. Thus, we examined whether
Her5 might instead act upstream of Notch, by blocking the specification of a
proneural field at the IZ. If this were the case, removing Her5 activity
should reveal a neurogenic domain at the IZ, in which Notch controls the
selection of neurons by lateral inhibition.
With the exception of notch1a
(Fig. 2A-C), the other known
components of the zebrafish lateral inhibition pathway are not expressed
within the medial IZ. However, expression of these factors, such as the
deltaA gene (delA), was induced upon injection of the
morpholino antisense oligonucleotide MOher5 that was previously
shown to antagonise her5 selectively
(Geling et al., 2003
) (75% of
cases, n=16) (Fig.
3A,B, and data not shown). Similarly, expression of
notch1a was enhanced across the medial IZ in these conditions to
reach levels comparable with those of adjacent anterior and posterior domains
(78% of cases, n=18) (Fig.
3C,D).
|
To corroborate this notion further, we monitored ngn1 expression upon the concomitant block of Her5 activity and impairment of Notch-Delta signalling. When MOher5 and NICD RNA were co-injected into one-cell stage embryos, the level of ngn1 expression induced across the medial IZ was much reduced compared with injections of MOher5 alone (80% of cases, n=21) (compare Fig. 3K,L), and this level was comparable with the downregulated expression of ngn1 in the vcc and r2 territories (Fig. 3L). Conversely, co-injection of MOher5 and RNA encoding DeltaStu led to increased levels of ngn1 expression across the medial IZ compared with injection of MOher5 alone (85% of cases, n=20) (compare Fig. 3K,M). Again, the intensity of ngn1 expression achieved within the medial IZ matched that of more anterior and posterior domains (Fig. 3M). We conclude that blocking Her5 activity generates a neurogenic domain at the medial IZ, in which committed neuronal precursors are selected by Delta/Notch signalling.
Together, the above experiments demonstrate that Her5 acts upstream of Notch signalling, by blocking the differentiation of a proneural field within the medial IZ. Thus, Her5 can be regarded as a prepattern factor that is involved in the spatial control of neurogenesis in the anterior neural plate.
The non-basic HLH transcription factor gene coe2 is also target of Her5 activity
We next aimed at determining the targets of Her5 activity in neurogenesis
inhibition. Her5 acts at an early step in the neurogenic cascade; we thus
investigated whether expression of early proneural genes other than
ngn1 were also regulated by Her5.
In addition to ngn1, at least three other related bHLH genes with
putative proneural function are expressed in territories adjacent to the IZ at
the end of gastrulation: the achaete-scute homologues asha
and ashb (formerly zash1a, zash1b) (Allende and Weinberg,
2002) and the atonal-related gene neurod4 (previously
zath3 and atonal3) (Park
et al., 2003
; Wang et al.,
2003
). A comparative expression analysis of these proneural
markers with precisely staged embryos showed that expression of asha,
ashb and neurod4 within the MH area was initiated slightly later
than ngn1. asha is expressed at the three-somite stage mostly
anterior to the IZ (Fig. 4A),
whereas ashb expression lies posterior of the IZ in the presumptive
hindbrain (Fig. 4C).
neurod4 flanks the IZ like ngn1
(Fig. 4E)
(Park et al., 2003
;
Wang et al., 2003
). In
striking contrast to ngn1, we found that removal of Her5 activity did
not cause ectopic expression of these genes (n=20)
(Fig. 4B,D,F). Thus, these
genes are not involved in the establishment of the ectopic neurogenic field in
the IZ of Her5-blocked embryos. It furthermore suggests that the ectopic
activation of ngn1 by removal of Her5 is a specific effect on
ngn1.
|
Thus, Her5 activity is crucially involved in the selective repression of ngn1 and coe2, both of which have proneural activity and may thus be involved in the establishment of the ectopic neurogenic domain at the IZ of embryos that lack Her5 activity.
Crossregulatory interactions between her5 and coe2 expression at the IZ
In contrast to ngn1, coe2 exhibits an early expression phase,
which precedes ngn1 expression and straddles the whole MH area
(Bally-Cuif et al., 1998
).
These observations prompted us to analyse in more detail a potential
connection between Her5 and Coe2 activities. Precise comparison of
her5 and coe2 expression on exactly staged embryos showed
that her5 transcription, detectable from 65-70% epiboly, precedes
coe2, initiated at 75% epiboly in the anterior neural plate over a
broad domain that covers the presumptive mes- and anterior rhombencephalon
(Fig. 4K, black bracket). Until
the tail-bud stage, coe2 and her5 expression overlap across
the entire mediolateral extent of the IZ
(Fig. 4L,M). Then,
coe2 expression is cleared from the IZ at early somitogenesis
(Fig. 4N; schematised in
Fig. 4O). We tested a possible
crossregulation between her5 and coe2 by monitoring her5 expression in embryos
injected with RNA encoding a dominant-negative form of Xcoe2, Xcoe2
DBD
(Dubois et al., 1998
). The
Xcoe2
DBD protein harbours a deletion in its DNA-binding domain but has
an intact dimerisation domain, and was previously used to inhibit the function
of endogenous Xcoe2 protein via the formation of non DNA-binding
Xcoe2-Xcoe2
DBD heterodimers (Dubois
et al., 1998
). We reasoned that the high sequence identity between
Xcoe2 and Coe2 HLH domains (89%) would permit Xcoe2
DBD to act
dominant-negatively on zebrafish Coe2 as well. Indeed, we could show that
injection of Xcoe2
DBD RNA into one-cell stage
zebrafish embryos downregulated ngn1 expression strongly, as reported
for Xcoe2
DBD in Xenopus
(Dubois et al., 1998
) (see
Fig. 5E) (78% of cases,
n=15). This effect was suppressed by co-injection of coe2
RNA (not shown, 75% of cases, n=16), underscoring its selectivity.
Injections of Xcoe2
DBD RNA inhibited her5
expression at tail-bud stages (Fig.
4P,Q) (73% of cases, n=19), a phenotype also rescued by
the co-injection of coe2 RNA (Fig.
4R) (73% of cases, n=20). Given that the onset of
coe2 expression in vivo follows her5 induction, we conclude
that Coe2 is necessary for the early maintenance of her5 expression.
Together, our results point to a loop of crossregulation where Coe2 initially
maintains her5 expression, and Her5 in turn clears coe2
expression from the IZ at early somitogenesis stages.
|
We tested next whether ngn1 expression was responsive to Her5 in
the absence of Coe2 function. Embryos injected with RNA encoding
Xcoe2
DBD display downregulated expression of ngn1 in the MH
area (82% of cases, n=19) (Fig.
5D,E), demonstrating that Coe2 is necessary for the maintenance of
high levels of ngn1 expression in this location. Furthermore, upon
co-injection of Xcoe2
DBD RNA and MOher5,
ngn1 was still induced across the medial IZ at levels comparable with
those found in the vcc and r2M clusters
(Fig. 5F) (85% of cases,
n=20). Thus, Coe2 activity is not necessary for the induction of
ngn1 expression across the medial IZ in the absence of Her5, and is
unlikely to be an intermediate step in the inhibition of ngn1
expression by Her5 in that location.
We conclude from these experiments that ngn1 and coe2 expression positively crossregulate each other in the MH area to maintain reciprocal high levels of transcription. However, they are also independent targets of Her5 in its repression of the formation of a neurogenic domain in the medial IZ.
Inhibition of coe2 or ngn1 expression by Her5 is sufficient to prevent neuronal differentiation across the medial IZ
Because ngn1 and coe2 are both targets of Her5, we asked
next to which extent the inhibition of either gene's expression contributed to
the absence of neuronal differentiation across the medial IZ. In spite of
remaining levels of coe2 expression in ngn1-/-
mutants (Fig. 5B), we found
that the progression of neurogenesis was fully impaired at later stages in
these mutants in the MH area, as revealed by the absence of deltaB
(delB) expression in eight-somite stage embryos
(Fig. 5G-H') and of zn12
immunoreactivity in this location at the 18-somite stage
(Fig. 5I,J). This is in
striking contrast to the development of basal neuronal populations in the
spinal cord, which are largely preserved
(Fig. 5H, blue arrows)
(Cornell and Eisen, 2002
).
Thus, Ngn1 function is strictly necessary for the progression of neurogenesis
to neuronal commitment and differentiation of basal MH populations.
Furthermore, we found that no neurons differentiated across the medial IZ when
MOher5 was injected into ngn1-/- mutants (100%
of cases, n=18) (Fig.
5K, compare with 3G). Thus, the block of ngn1 expression
by Her5 is sufficient to ensure the absence of neuronal differentiation across
the medial IZ.
In striking parallel, blocking Coe2 function by injection of
Xcoe2
DBD RNA lead to a dramatic decrease in neuronal
differentiation within the MH domain (82% of cases, n=18)
(Fig. 5L,M), identifying Coe2
as another factor crucially necessary for progression of neurogenesis in this
area. Furthermore, absence of Coe2 function prevented neuronal differentiation
induced by removing Her5 activity across the medial IZ (85% of cases,
n=19) (Fig. 5N,
compare with Fig. 3G). Thus,
the downregulation of coe2 expression by Her5 at the medial IZ, like
inhibition of ngn1 expression, is sufficient to prevent neuronal
differentiation in this area.
We conclude that, as both ngn1 and coe2 are required for ectopic neurogenesis at the IZ, Her5 acts redundantly on these two genes to prevent neuronal differentiation in this location.
An E-box in the anterior neural plate enhancer of the ngn1 gene is necessary for repression by Her5
We next investigated whether the inhibition of ngn1 expression by
Her5 could be tracked down to specific enhancer regions in the ngn1
upstream sequence. Previous characterisation of the ngn1 locus
demonstrated that an 8.4 kb upstream fragment was sufficient to drive correct
reporter expression in neuronal clusters of the anterior neural plate and
sensory precursors of the spinal cord (8.4ngn1:gfp)
(Blader et al., 2003
)
(Fig. 6A,B). We found that
injection of MOher5 into this transgenic line induced strongly
gfp transcription across the medial IZ
(Fig. 6B, blue arrow) (77% of
cases, n=18). Conversely, ectopic expression of Her5 within this line
(obtained by crossing into the pzhsp70:her5 transgenic background and
heat-shock at the onset of neurogenesis) severely reduced gfp
expression (not shown). Thus, the element(s) of response to Her5 are contained
within the 8.4 kb fragment of the ngn1 enhancer.
The 8.4 fragment contains two elements, the lateral stripe element (LSE)
driving expression in sensory spinal clusters, and the anterior neural plate
element (ANPE) driving expression in anterior clusters, including the vcc and
r2M (Blader et al., 2003
)
(Fig. 6A,B). To determine
whether the Her5 response was confined to one of these elements, we monitored
gfp expression upon injection of MOher5 into the
3.4ngn1:gfp transgenic line (which lacks the LSE but maintains
the ANPE) and 3.1ngn1:gfp line (where both elements are
deleted) (Fig. 6A). Strong
gfp induction across the medial IZ was observed when Her5 activity
was blocked in the 3.4ngn1:gfp background, in a manner
indistinguishable from that observed in 8.4ngn1:gfp
transgenics (Fig. 6D,E) (78% of
cases, n=14). Thus, the response element to Her5 activity is
contained within the 3.4 kb of upstream ngn1 sequence, thus is
excluded from the LSE. By contrast, gfp expression was only
marginally induced in the 3.1ngn1:gfp line generally in a few
cells that are located close to the ventral midline
(Fig. 6F-H', blue arrows)
(66% of cases, n=15). We conclude that the ngn1 transgene
contains partially redundant Her5 response elements. The major repressor
element resides between 3.4 and 3.1 kb upstream of the
ngn1 start site while a weaker element is located proximal to the
ANPE.
Remarkably, the ANPE contains a CATGTG sequence (in position 3187 to
3182), which fits the canonical `E-box' (CANNTG). E-boxes are known
binding sites for bHLH proneural factors, and can also be bound by
Hairy/E(Spl) proteins (Davis and Turner,
2001
; Fisher and Caudy,
1998
). We thus analysed whether this E-box might be part of the
element(s) mediating Her5 repression. To this end, the E-box was replaced by a
cluster of point mutations (CATGTG to TCTAGA). The mutation was placed into
3.3ngn1:gfp that has a 5' deletion of 100 bp terminating
immediately upstream of the ANPE (generating construct
3.3
Eboxngn1:gfp)
(Fig. 6A). Both constructs were
flanked by the restriction site for the meganuclease SceI, and were
injected into wild-type embryos together with the meganuclease enzyme. As
described in Medaka (Thermes et al.,
2002
), this procedure favoured early integration of the transgene,
leading to the production of very moderately mosaic embryos that display
remarkably low ectopic expression (Fig.
6I-K). These embryos are thus suitable for a founder analysis, and
we studied expression of gfp mRNA at and around the IZ. Although the
non-mutated 3.3ngn1:gfp construct never gave rise to
gfp expression across the medial IZ
(Fig. 6I) (100% of cases,
n=20), we found that most embryos injected with
3.3
Eboxngn1:gfp displayed prominent ectopic
expression of gfp in this location (67% of cases, n=18)
(Fig. 6J,K), as expected for a
negatively acting element
Together, these results suggest that a major element mediating the active
repression of ngn1 expression at the medial IZ is the E-box contained
within the ANPE. To test by a different experimental approach whether Her5
acts through the ANPE, we next examined whether it behaved as a repressor or
an activator in the E-box-dependent process inhibiting ngn1
expression. To this aim we tested the response of 3.4ngn1:gfp
and 3.1ngn1:gfp to the fusion protein Her5VP16, which behaves
as a dominant activator of Her5 targets
(Bally-Cuif et al., 2000
).
Although 3.1ngn1:gfp failed to respond to Her5VP16
(Fig. 6L,M) (0% of cases,
n=21), we found that gfp expression was induced ectopically
by Her5VP16 in the 3.4ngn1:gfp line
(Fig. 6N-P) (63% of cases,
n=53). Thus, to prevent ngn1 expression across the IZ, Her5
functions as a transcriptional inhibitor that might either bind directly the
ANPE E-box or inhibit expression of an activator normally binding this
site.
| Discussion |
|---|
|
|
|---|
her5 expression is not a target of Notch signalling at the MHB
Most E(spl) factors act as Notch effectors in cell fate decisions,
including the control of somitogenesis and neurogenesis in vertebrates
(Artavanis-Tsakonas et al.,
1999
; Davis and Turner,
2001
). We found, however, that Her5, although belonging to the
E(spl) class and inhibiting neurogenesis, is not a target of Notch signalling
and lateral inhibition. Three independent experimental findings support this
conclusion: blocking or lowering Notch signalling using either DAPT treatment,
notch1a-deficient des mutant embryos or overexpression of
DeltaStu does not perturb her5 expression and does not
cause ectopic neurogenesis in the IZ. Moreover, quite in contrast to what one
would expect from a Notch effector, her5 expression was inhibited
rather than activated by ectopic activation of the Notch pathway in
NICD-expressing embryos. Similar observations were previously made for
her5 expression in endodermal progenitors at early gastrulation
(Bally-Cuif et al., 2000
).
These observations suggest that Notch signalling is not involved in
controlling her5 expression at the MHB. Moreover, upon induction of a
proneural cluster in place of the IZ (by blocking Her5 function), the
activation of lateral inhibition did not affect her5 expression in
this location (A.G. and L.B.-C., unpublished). Thus, the regulation of
her5 by ectopic NICD does not play a role in the control of MH
neurogenesis, and Her5 does not, in contrast to most other E(spl) factors, act
as a Notch effector in the control of neurogenesis at the IZ.
Her5 acts as a prepattern factor
Prepattern factors act at the interface of patterning and neurogenesis to
control the location and extent of neuronal differentiation sites without
influencing the overall structure of the neural plate/tube. This definition is
based on the pre-patterning systems controlling neurogenesis in the
Drosophila peripheral nervous system
(Davis and Turner, 2001
;
Fisher and Caudy, 1998
). Her5
meets these requirements as its expression is regulated by the embryonic
patterning machinery including Wnt and Fgf signalling at the MHB
(Geling et al., 2003
;
Reifers et al., 1998
), its
activity does not impinge on patterning
(Geling et al., 2003
), and it
controls expression of the proneural genes ngn1 and coe2
(Geling et al., 2003
) (this
paper). To date, only few factors have been identified in vertebrates that
fulfil these strict criteria. These include the inhibitors of neurogenesis
Anf, BF1 and Xrx1 in the anterior neural plate, Zic2 and Xiro3 in the spinal
cord, and Hes1 in the mouse olfactory epithelium (for reviews, see
Bally-Cuif and Hammerschmidt,
2003
; Sasai,
1998
), as well as some positive factors, such as Iro1 and Iro7 in
Xenopus and zebrafish (Cavodeassi
et al., 2001
; de la
Calle-Mustienes et al., 2002
;
Itoh et al., 2002
) and
Flh/Not1 in the zebrafish epiphysis (Cau
and Wilson, 2003
). All these factors control primarily expression
of proneural genes rather than the patterning machinery. Moreover, like for
Her5, their activity was in some cases directly shown to be independent of
lateral inhibition (Bellefroid et al.,
1998
; Bourguignon et al.,
1998
; Andreazzoli et al.,
2003
). As previously mentioned
(Andreazzoli et al., 2003
),
these observations suggest that independence of Notch signalling is a common
theme of inhibitory prepatterning in the vertebrate neural plate.
The mode of action of prepatterning inhibitors at the molecular level
remains mostly hypothetical. Our results demonstrate that Her5 acts by
blocking expression of the proneural genes ngn1 and coe2 and
preventing the specification of a neurogenic cluster at the level of the MHB,
thereby generating the neuron-free IZ. Removal of Her5 activity creates a
neurogenic domain at the medial IZ that is sensitive to Notch/Delta
signalling, and where lateral inhibition operates to select and commit
progenitors within a pool of precursors. A similar activity was reported for
mouse Hes1 in the olfactory neuroepithelium
(Cau et al., 2000
). Our data
suggest that inhibitory prepatterning in vertebrates might, at least in part,
function by restricting the size of proneural fields within
neurogenesis-competent areas of the neuroepithelium. The major response
element to Her5 is an E-box located in the ANPE of the ngn1 upstream
region, which is the principal enhancer driving ngn1 expression in
anterior proneural clusters of the vcc and r2
(Blader et al., 2003
). These
results suggest that MH neuronal precursors belong to a single proneural
cluster within which ngn1 expression is locally repressed at the MHB
to generate the IZ. A very similar situation has been reported for the control
of achaete in Drosophila, where Hairy binds an element
located close to the enhancer driving achaete expression in the notum
(Ohsako et al., 1994
;
Van Doren et al., 1994
). Hairy
and Her5, however, diverge in two respects. First, Hairy establishes the
distinction between non-neural and neural ectoderm within the fly notum, while
Her5, like mouse Hes1, controls neurogenesis within an already neuralised
tissue. Second, Her5 belongs in sequence to the E(spl), rather than the Hairy,
subclass, suggesting that the distinction made in Drosophila between
E(spl) and Hairy functions (Notch effectors versus Notch-independent
prepatterning inhibitors, respectively) has not been conserved during
evolution (Fisher and Caudy,
1998
).
The factors that control the local induction of her5 expression
remain to be defined. Spg/Pou2 is required for the specification of a large
portion of the anterior neural plate that includes the her5 domain
but also the entire hindbrain (Belting et
al., 2001
; Burgess et al.,
2002
; Hauptmann et al.,
2002
; Reim and Brand,
2002
). MH factors such as Pax2.1, Eng2/3 and Fgf8 are only
necessary for her5 maintenance
(Lun and Brand, 1998
;
Reifers et al., 1998
;
Scholpp and Brand, 2001
).
Finally, her5 expression is transiently controlled by Coe2, but this
interaction affects her5 maintenance rather than her5
induction, and is unlikely to be direct, as we failed to identify Coe2-binding
sites (Dubois and Vincent,
2001
) in a her5 enhancer fragment sufficient to
recapitulate her5 expression at all stages
(Tallafuss and Bally-Cuif,
2003
).
Molecular mode of Her5 action
We demonstrate that a number of early proneural genes (asha, ashb,
neurod4, ngn1 and coe2) are expressed in domains flanking the
IZ, but that Her5 selectively inhibits expression of only two of them,
ngn1 and coe2. These two genes are probably independent
targets of Her5 repression. This is surprising given that Ngn1 and Coe2,
possibly because of their positive crossregulation, appear to play identical
roles: blocking expression of either one of these genes is sufficient to
prevent neurogenesis in the IZ. Several interpretations might account for the
regulation of both ngn1 and coe2 by Her5. Given the crucial
importance of the IZ in maintaining a pool of progenitors at the MHB, which is
necessary both for the maintenance of MHB integrity
(Geling et al., 2003
;
Hirata et al., 2001
) and for
MH growth (Cowan and Finger,
1982
), it is possible that this dual inhibitory mechanism has been
evolutionarily selected to efficiently prevent neurogenesis at the MHB. In
addition, it is possible that Ngn1 and Coe2 control other and distinct
processes in addition to neurogenesis. We demonstrated previously that Her5 is
also necessary to enhance cell proliferation in the medial IZ, independently
of its suppression of ngn1 expression
(Geling et al., 2003
). Coe2
might impinge on the control of proliferation. In addition, other cellular
processes could be regulated by Coe factors, such as neuronal specification,
differentiation, migration and axonal pathfinding
(Dubois and Vincent,
2001
).
At the molecular level, several mechanisms appear to be used by
Hairy/E(spl) factors to restrict neurogenesis. These include direct binding to
the enhancer and transcriptional inhibition of proneural target genes,
competition with activator bHLH proteins for the same DNA-binding sites, and
functional inhibition by the formation of inactive heterodimers with proneural
factors (Davis and Turner,
2001
). Drosophila Hairy acts by direct binding and
repression of the achaete enhancer
(Ohsako et al., 1994
;
Van Doren et al., 1994
). Her5
acts at a very early stage on the expression of ngn1 and
coe2, suggesting that its main early activity at the IZ is
transcriptional inhibition of these targets. Whether the action of Her5 on
ngn1 and coe2 expression is direct, however, remains to be
shown. The regulatory regions controlling coe2 expression have not
been characterised. Our analysis of the ngn1 enhancer identifies an
E-box within the ANPE domain as the major element mediating transcriptional
inhibition of ngn1 at the medial IZ. Although E(spl) factors are
generally considered to bind N boxes with higher affinity in vitro,
interaction with E-boxes has also been reported
(Davis and Turner, 2001
). It
is thus possible that Her5 binds to this element and directly inhibits
ngn1 transcription. Chromatin immunoprecipitation experiments will be
required to resolve this issue. In addition, we observed that the proximal
region of the ngn1 upstream sequence (3.1 kb) also exhibits a
moderate response to Her5 activity, restricted to the ventral midline of the
IZ. A repetition of two N boxes is present in positions 235/230
and 225/220 upstream of the ngn1 translation start site
(C.P., P. Blader and U.S., unpublished), which might be involved in this
regulation. However, our results with the 3.3 kb fragment suggest that,
in the presence of the ANPE, these elements do not play a major role. The 3.1
kb fragment is also capable of driving reporter expression that excludes the
IZ, but it is initiated with a delay within the vcc and r2M
(Blader et al., 2003
). Thus,
elements contained within this fragment might be involved in controlling
ngn1 expression in the MH domain and its repression from the ventral
midline of the IZ at a later, possibly maintenance stage.
Neurogenesis in the MH area requires Ngn1 and Coe2
We demonstrate here that both Ngn1 and Coe2 functions are necessary for the
progression of neurogenesis and for the early events of neuronal
differentiation in the MH domain. Blocking Coe2 activity downregulates
ngn1 expression throughout the neural plate (A.G. and L.B-C.,
unpublished), suggesting a requirement for Coe2 in all primary neurons. The
absence of ngn1 function prevents delB expression in the
anterior proneural clusters, including the presumptive motorneurons of
rhombomeres 2 and 4, and the vcc, and is also necessary for neuronal
differentiation of vcc derivatives, which comprise at least the first
differentiating populations of the reticulospinal nMLF neurons
(Easter et al., 1994
;
Wilson et al., 1990
). This,
together with previous reports, indicates a strict requirement for Ngn1 in
spinal sensory neurons (Cornell and Eisen,
2002
; Golling et al.,
2002
) and the MH area (this paper) of the embryonic zebrafish CNS.
By contrast, Ngn1 is not essential for motor- and interneuron development in
the trunk and spinal cord (Cornell and
Eisen, 2002
; Golling et al.,
2002
; Park et al.,
2003
), and for epiphysial neurons
(Cau and Wilson, 2003
).
Differential requirements for Ngn in CNS neuronal differentiation was also
observed in other vertebrates, a typical example being the complementary
requirements for Ngn2 and Mash1 in the mouse embryonic neural tube (see
Bertrand et al., 2002
). Other
bHLH factors, such as Achaete-scute or Olig, may play redundant or prominent
roles in neurogenic areas that differentiate normally in
ngn1-deficient embryos.
Our results point to synergistic roles of Ngn1 and Coe2 in MH neurogenesis,
possibly reflecting the positive cross-regulation of their expression, and a
parallel activity of these factors rather than their action in a linear
cascade. It is possible that the crossregulation of ngn1 and
coe2 expression helps stabilise the committed state of neuronal
progenitors, as described for Xenopus Xcoe2
(Dubois et al., 1998
).
Together, our results lead to a model for the spatial control of MH neurogenesis (Fig. 7). In this process, ngn1 and coe2 expression are crucial elements that permit neurogenesis throughout the MH, which is initially identified as a single territory competent to form neurons. At the MHB, ngn1 and coe2 expression are the targets of Her5 inhibition. This inhibition prevents the specification of a proneural cluster in this location and permits the generation of the IZ.
|
| ACKNOWLEDGMENTS |
|---|
DBD), T.
Jowett (krox20), and E. Weinberg (ash1a, ash1b) for gifts of
probes and constructs; V. Korzh for providing the ath3 cDNA prior to
publication and for advice on anterior hindbrain neurons; N. Hopkins for the
neurod3hi1059 mutant line; and S. Holley for providing
des embryos. DAPT was a gift of Boehringer Ingelheim Pharma KG. The
monoclonal antibody zn12 developed by B. Trevarrow was obtained from the
Developmental Studies Hybridoma Bank maintained by the University of Iowa,
Department of Biological Sciences, Iowa City, IA 52242. Work in L.B-C.'s
laboratory is supported by a VolkswagenStiftung `junior research group' grant
and DFG grant BA2024/2-1. Work in U.S.'s laboratory was supported by INSERM,
CNRS, HUS, ARC, AFM, VW Stiftung and AICR, ACI. | Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Allende, M. L. and Weinberg, E. S. (1994). The expression pattern of two zebrafish achaete-scute homolog (ash) genes is altered in the embryonic brain of the cyclops mutant. Dev. Biol. 166,509 -530.[CrossRef]