|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online April 22, 2004
doi: 10.1242/10.1242/dev.01064
Molecular and Computational Biology Program, Department of Biological Sciences, University of Southern California, Los Angeles, CA 90089-1340, USA
* Author for correspondence (e-mail: jtower{at}USC.edu)
Accepted 8 January 2004
| SUMMARY |
|---|
|
|
|---|
1.2 kb
S18 chorion gene and the 840 bp ori-ß. Deletion mapping of ACE3
revealed that an evolutionarily conserved 142 bp core sequence functions in
amplification in this context. Several deletions had quantitative effects,
suggesting that multiple, partially redundant elements comprise ACE3. S.
cerevisiae ARS1 origin sequences could not substitute for ori-ß,
thereby confirming the sequence specificity of ori-ß. Deletion mapping of
ori-ß identified two required components: a 140 bp 5' element and a
226 bp A/T-rich 3' element called the ß-region that has significant
homology to ACE3. Antibody to the origin recognition complex subunit 2 (ORC2)
recognizes large foci that localize to the endogenous chorion gene loci and to
active transgenic constructs at the beginning of amplification. Mutations in
Orc2 itself, or the amplification trans regulator satin
eliminated the ORC2 foci. By contrast, with a null mutation of
chiffon (dbf4-like) that eliminates amplification, diffuse
ORC2 staining was still present, but failed to localize into foci. The data
suggest a novel function for the Dbf4-like chiffon protein in ORC
localization. Chromosomal position effects that eliminated amplification of
transgenic constructs also eliminated foci formation. However, use of the
buffered vector allowed amplification of transgenic constructs to occur in the
absence of detectable foci formation. Taken together, the data suggest a model
in which ACE3 and ori-ß nucleate the formation of a ORC2-containing
chromatin structure that spreads along the chromosome in a mechanism dependent
upon chiffon.
Key words: Dbf4, DNA replication, Chiffon, ORC, Amplification, Drosophila
| Introduction |
|---|
|
|
|---|
60
fold, thereby providing an increased copy number of chorion gene templates for
transcription. Amplification occurs through the repeated firing of DNA
replication origins located within each chorion gene cluster. Bi-directional
replication forks proceed unusually slowly away from the origins, creating an
onionskin-like DNA structure (Claycomb et
al., 2002
If amplification is prevented by a trans-acting mutation or a chromosomal
rearrangement that moves the origin away from the gene cluster, the resultant
under-production of chorion proteins causes female sterility characterized by
thin eggshells and nonviable eggs (Orr et
al., 1984
; Spradling and
Mahowald, 1981
). This thin eggshell/female sterile phenotype has
allowed for identification of numerous trans-acting genes that regulate
amplification. The first of these trans-acting genes to be cloned,
k43, was found to encode the second largest subunit of the origin
recognition complex (ORC) (Gossen et al.,
1995
; Landis et al.,
1997
). The six-protein ORC was originally discovered in yeast and
is required for DNA replication and other aspects of chromosome function in
all eukaryotes (Beall et al.,
2002
; Bell, 2002
;
Chesnokov et al., 1999
). ORC
binds at origins and is required for recruitment of numerous additional
proteins that participate in replication initiation. Data from yeasts and
Xenopus in vitro systems indicate that among the last proteins to
bind prior to origin firing are the CDC7 protein kinase and its regulatory
subunit Dbf4. The Drosophila gene chiffon was found to be
required for chorion gene amplification and to be related to yeast
dbf4 (Landis and Tower,
1999
). Additional conserved DNA replication factor genes required
for chorion gene amplification include those encoding Cyclin E
(Calvi et al., 1998
), E2F
(Royzman et al., 1999
), DP
(Royzman et al., 1999
), RBF
(Bosco et al., 2001
), CDT1
(Whittaker et al., 2000
),
geminin (Quinn et al., 2001
)
and MCM6 (Schwed et al.,
2002
). Antibody to ORC1 or ORC2 reveals that, coincident with the
initiation of amplification, ORC moves from a diffuse nuclear distribution
into dramatic foci localized at the chorion gene loci
(Asano and Wharton, 1999
;
Calvi et al., 1998
;
Royzman et al., 1999
). The
data demonstrate that Drosophila chorion gene amplification uses
evolutionarily conserved machinery for initiation; however, some mechanism
must exist to uniquely mark the chorion gene loci origins for activation
during amplification, when overall genomic replication has ceased.
Large cloned fragments of the chorion gene loci can be re-introduced into
the Drosophila genome via P element-mediated germline transformation,
and these transgenic constructs can amplify with the correct tissue and
temporal specificity (deCicco and
Spradling, 1984
). However, amplification is highly sensitive to
chromosomal position effects and only
1/3 of inserts will be active. The
third chromosome locus has been studied in the greatest detail, and a 3.8 kb
SalI fragment was capable of high level amplification at some sites.
This fragment was found to contain two striking sequence elements: The
`
region' upstream of the S18 chorion gene and the related
`ß region' downstream were A/T-rich, internally repetitive and had
similarities to the yeast origin consensus sequence, suggesting that they
might function in regulating amplification
(Levine and Spradling, 1985
).
Deletion mapping of transgenic constructs identified a required 320 bp element
that contained the most of
region and was called ACE3
(Orr-Weaver et al., 1989
). The
function of ACE3 in amplification and several ACE3 sequence elements are
conserved among multiple Drosophila species
(Swimmer et al., 1990
), and
deletion analysis indicated that ACE3 is composed of multiple,
partially-redundant elements (Orr-Weaver
et al., 1989
). Regions between the chorion genes were found to be
stimulatory for amplification (Delidakis
and Kafatos, 1989
). Two-dimensional gel analysis of DNA
replication intermediates revealed that multiple origins functioned in
amplification, with the majority of initiations (70-80%) occurring near the
ß region downstream of S18
(Delidakis and Kafatos, 1989
;
Heck and Spradling, 1990
).
Insulator elements are DNA sequences first identified in studies of
transcription (Gerasimova and Corces,
2001
). Insulators can block the interaction of enhancers with
promoters when they are placed in between, and can also protect transgenes
from chromosomal position effects on transcription when they are placed
flanking the transgene. The suppressor of Hairy-wing protein binding
site insulator [su(Hw)BS] was found to be able to protect chorion gene locus
constructs from position effects on amplification
(Lu and Tower, 1997
). This
provided a more sensitive and convenient assay for amplification sequence
requirements. Using such a buffered vector an 840 bp sequence-specific origin
element called ori-ß was identified
(Lu et al., 2001
). Ori-ß
is located downstream of the S18 chorion gene and contains the ß
region. Ori-ß was necessary and sufficient for amplification in
combination with ACE3. An insulator placed between ACE3 and ori-ß
inhibited amplification, indicating that ACE3 and ori-ß interact in cis.
Two-dimensional gel analysis of a construct containing ACE3, S18 and
ori-ß identified initiations occurring at ori-ß, while no
initiations could be detected at ACE3. Taken together, the data suggest that
ACE3 functions as a `replicator'
(Stillman, 1993
) and interacts
with ori-ß in cis to allow DNA replication initiation at ori-ß. The
buffered vector system was used to analyze the sequence requirements for ACE3
and ori-ß function in greater detail, including the formation of ORC2
foci.
| Materials and methods |
|---|
|
|
|---|
|
pACE3mt-2, pACE3mt-3, pACE3mt-4 and pACE3mt-5
Subregions of the 320 bp ACE3 fragment in BP construct were amplified by
PCR using primer sets 2, 3, 4 and 5, respectively. The PCR products were
digested at KpnI and BamHI sites engineered into the
primers, and subcloned into pBS*K-2.8 to create intermediate
constructs. Then a fragment containing su(Hw)BS, ACE3mt, S18 and
ori-ß was liberated from the intermediate construct by digestion with
NotI and XhoI, and cloned into the NotI to
XhoI sites of BP to generate the final constructs.
pOriß mt-1 through pOriß mt-9
The 840 bp ori-ß fragment in the BP construct was amplified by PCR
using primer sets 6-14, respectively. The PCR products were digested at the
BglII and XhoI sites engineered into the primers, and then
cloned into the BglII to XhoI sites of the BP constructs to
create the series of ori-ß deletions
(Fig. 4,
Fig. 5).
|
|
pBP-B2
The set 16 oligonucleotides represent the two DNA strands of the B2 element
of yeast ARS1 from 793 bp to 812 bp plus added BglII and
XhoI half-sites. The oligos were annealed and the fragment cloned
into the BglII to XhoI sites in the BP construct to generate
pBP-B2.
pMini-1
This construct contains one ACE3 mt-3 and one ori-ß mt-2 with no
intervening sequences. The 840 bp ori-ß fragment in the BP construct was
amplified by PCR using primer set 7, digested at BglII and
XhoI sites engineered into the primers, and cloned into the
BglII to XhoI sites in pBS*K-2.8 (described
above) to generate pBS*K-2.6. The 320 bp ACE3 fragment in the BP
construct was amplified by PCR using primer set 3, digested at KpnI
and BamHI sites, and cloned into the KpnI to BglII
sites in pBS*K-2.6. A fragment containing one ACE3 mt-3 and one
ori-ß mt-2 was liberated by digestion with NotI and
XhoI, and cloned into the NotI to XhoI sites in the
BP construct to generate pMini-1.
pMini-2
This construct contains three copies of ACE3 mt-3 and one ori-ß mt-2
without the intervening sequences. The 320 bp ACE3 fragment in the BP
construct was amplified by PCR using primer sets 17, 18 and 19, respectively.
The PCR products were digested with KpnI and EcoRI,
EcoRI and NheI, and NheI and BamHI,
respectively. The three fragments were cloned into the KpnI to
BglII sites in pBS*K-2.6 (described above) in the same
reaction. A fragment containing three ACE3 mt-3 and one ori-ß mt-2 was
then liberated by digestion with NotI and XhoI, and cloned
into the NotI to XhoI sites in the BP construct to generate
pMini-2.
pMini-C
This construct contains one ori-ß mt-2 without ACE3 and the
intervening sequences. pBS*K-2.6 (described above) was digested
with KpnI and BglII. The larger fragment containing
su(Hw)BS, plasmid vector and ori-ß mt-2 was end-filled by T4 DNA
polymerase, and then ligated to circularize. A fragment containing one
ori-ß mt-2 and su(Hw)BS was liberated by digestion with NotI and
XhoI, and cloned into the NotI to XhoI sites in the
BP construct to generate pMini-C.
Primer sequences
SET1: 5' AGCTGGTACC KpnI CTGAGCCTGGCCAACATCTAA
3'; 5' AGCTGGATCC BamHI GAGCTTGACACCGATTTTTCAG
3'
SET2: 5' AGCTGGTACC KpnI GAAAGTGGAACGGTTGTGTTTA 3'; 5' AGCTGGATCC BamHI GCATAGTTTCGATCA 3'
SET3: 5' AGCTGGTACC KpnI GAAAGTGGAACGGTTGTGTTTA 3'; 5' AGCTGGATCC BamHI GAGCTTGACACCGATTTTTCAG 3'
SET4: 5' AGCTGGTACC KpnI GAAAGTGGAACGGTTGTGTTTA 3'; 5' AGCTGGATCC BamHI AAGGCAGTGGCCTGAAAATTC 3'
SET5: 5' AGCTGGTACC KpnI CTACCAACGCAGCAGAATTTTC 3'; 5' AGCTGGATCC BamHI GAGCTTGACACCGATTTTTCAG 3'
SET6: 5' AGCTGAGATCT BglII GCATATCTTAGCTGA 3'; 5' AGCTCTCGAG XhoI GGCTGGAATATACTCACATTTG 3'
SET7: 5' AGCTGAGATCT BglII GCATATCTTAGCTGA 3'; 5' AGCTCTCGAG XhoI AACGCGTTTATTTTCGAATACAC 3'
SET8: 5' AGCTAGATCT BglII AATGAAGCTGCAAAGCTAAAACTA 3'; 5' AGCTCTCGAG XhoI GTTTGGGGTAATCAATCAAACTA 3'
SET9: 5' AGCTAGATCT BglII TTGCTTGAAATTATGTTTTTGTAAAA 3'; 5' AGCTCTCGAG XhoI GTTTGGGGTAATCAATCAAACTA 3'
SET10: 5' AGCTAGATCT BglII AATGAAGCTGCAAAGCTAAAACTA 3'; 5' AGCTCTCGAG XhoI CAGCCGGTTTTTCTGATAAAAC 3'
SET11: 5' AGCTGAGATCT BglII GCATATCTTAGCTGA 3'; 5' AGCTCTCGAG XhoI TCATTCGCCATGACAATTATTC 3'
SET12: 5' AGCTGAGATCT BglII GCATATCTTAGCTGA 3'; 5' AGCTCTCGAG XhoI ATCGCGTTTTATGTAATAGATTC 3'
SET13: 5' AGCTGAGATCT BglII GCATATCTTAGCTGA 3'; 5' AGCTCTCGAG XhoI AGTCACATACAAAACTTAAAATTA 3'
SET14: 5' AGCTGAGATCT BglII GCATATCTTAGCTGA 3'; 5' AGCTCTCGAG XhoI GAACTTGGCTTGTCTAAGTGA 3'
SET15: 5' AGCTGGATCC BamHI CTAACAAAATAGCAAATTTCG 3'; 5' AGCTCTCGAG XhoI ACAATCAATCAAAAAGCCAAA 3'
SET16: 5' GATCT BglII TATTTATTTAAGTATTGTTTC 3'; 5' TCGAG XhoI AAACAATACTTAAATAAATAA 3'
SET17: 5' AGCTGGTACC KpnI GAAAGTGGAACGGTTGTGTTTA 3'; 5' AGCTGAATTC EcoRI GAGCTTGACACCGATTTTTCAG 3'
SET18: 5' AGCTGAATTC EcoRI GAAAGTGGAACGGTTGTGTTTA 3'; 5' AGCTGCTAGC NheI GAGCTTGACACCGATTTTTCAG 3'
SET19: 5' AGCTGCTAGC NheI GAAAGTGGAACGGTTGTGTTTA 3'; 5' AGCTGGATCC BamHI GAGCTTGACACCGATTTTTCAG 3'
Generation of transgenic lines
Transgenic strains were generated by P element-mediated germline
transformation (Rubin and Spradling,
1982
), using the w1118 recipient strain. All
inserts were made homozygous by crosses to appropriate balancer stocks, and
single copy insertions were confirmed by genomic Southern blots (data not
shown).
Measurement of amplification levels
The measurement of amplification levels for transgenic constructs was
previously described (Lu and Tower,
1997
). Briefly, DNA was isolated from stage 13 egg chambers (ECs),
restriction digested and Southern blotted. Blots were hybridized with
radiolabeled restriction fragments of the constructs, and with a ribosomal DNA
probe (pDmrY22) (Dawid et al.,
1978
) as a control for amount of DNA loaded. Southern blot signals
were quantitated by phosphorimager analysis, and the amplification level was
calculated by comparing the signal for the transgene in EC DNA to the signal
for the transgene in male DNA, where there is no amplification, with the
following formula: fold
amplification=(transgeneEC/transgeneMale)/(rDNAEC/rDNAMale).
No amplification yields a value of 1.
Antibody staining and BrdU labeling
Antibody staining procedure was provided by Bosco and Orr-Weaver
(Royzman et al., 1999
).
Dissected ovaries were fixed by 8% formaldehyde/Buffer B solution for 5
minutes, then blocked with 2% normal donkey serum (NDS) in CHIP lysis buffer
(50 mM HEPES/KOH pH 7.5, 140 mM NaCl, 1 mM EDTA, 1% Triton X-100 and 0.1%
Na-Deoxycholate). After washing, 1:2500 dilution of anti-ORC2 sera (provided
by Stephen Bell) in CHIP lysis buffer plus 2% NDS was added to the ovaries,
and incubated for 18-20 hours at 4°C. After washing, a 1:150 dilution of
Cy3-conjugated goat anti-rabbit Ab (Jackson ImmunoResearch Laboratories) was
used to visualize ORC2. DAPI staining was performed to counterstain DNA in the
nuclei. Antibody staining was examined using the BioRad MRC 600 confocal
microscope with a 100x objective. BrdU labeling of ovaries was performed
essentially as described (Lilly and
Spradling, 1996
), according to a detailed procedure provided by
Calvi and Lilly (B. Calvi and M. J. Lilly, unpublished). Anti-BrdU antibody
(Becton Dickson) was used at 1:20 dilution. The labeling was visualized using
a 1:150 dilution of FITC-conjugated AffiniPure goat anti-mouse antibody
(Jackson Labs).
| Results |
|---|
|
|
|---|
1.2 kb S18 chorion gene and the 840 bp ori-ß element
(Fig. 2A). The chorion gene
locus sequences are directly flanked by su(Hw)BS insulator elements that
protect the construct from negative chromosomal position effects. ACE3
contains sequences that are conserved among multiple Drosophila
species, as indicated by shading. The exact spacing of ACE3 and ori-ß
does not appear to be crucial for amplification: ACE3 and ori-ß are
normally separated by
1.2 kb, yet constructs containing only ACE3 and
ori-ß immediately adjacent to each other still amplify up to 14 fold
(Lu et al., 2001
|
19 fold amplification and the complete deletion of ACE3 (AD)
reduced amplification to fourfold. No amplification yields a value of 1
meaning that deletion of ACE3 almost but not completely eliminates
amplification in this context. Deletion of the non-conserved 5' or
3' ACE3 sequences in mutants 1 and 2 had quantitative effects, and
reduced amplification to average
14 fold and
15 fold, respectively.
Mutant 3 containing only the conserved sequences supported average
11-fold amplification, demonstrating that the evolutionarily conserved
sequences are sufficient for partial ACE3 activity. Deletion of some 3'
conserved sequences in mutant 4 further reduced activity, and deletion of a
significant part of 5' conserved sequences in mutant 5 reduced activity
close to the extent of a deletion of all of ACE3. The data suggest that
multiple, partially redundant elements comprise ACE3. The same conclusion was
obtained in a previous deletion analysis of ACE3 in unbuffered vectors
(Orr-Weaver et al., 1989
Previously, deletion of all of ori-ß was found to eliminate
amplification, indicating that ori-ß was also a sequence specific element
required for amplification. To begin to analyze the sequence requirements for
ori-ß function, constructs were generated to determine if the equally
A/T-rich S. cerevisiae ARS1 origin sequences could substitute for
ori-ß. The complete 193 bp ARS1 and the 20 bp B2 DNA unwinding element
from ARS1 were substituted for ori-ß in constructs BP-ARS1 and BP-B2,
respectively (Fig. 3A). The BP
construct supported an average
19-fold amplification, while a complete
deletion of ori-ß reduced amplification to
3 fold. The yeast
sequences were found to have no detectable activity in amplification, thereby
confirming the sequence specificity of ori-ß
(Fig. 3B).
|
region in ACE3, and is
indicated by shading (Fig. 4A).
Deletions were generated in the context of the BP construct containing the
starting 840 bp ori-ß. BP supported
20 fold amplification while a
complete deletion of ori-ß (OD) reduced amplification to
4 fold.
Deletion of the 3' 140 bp in mutant 1 had a quantitative effect,
reducing amplification to
12 fold
(Fig. 4B). More extensive
3' deletions in mutant 2 and mutant 9 did not further reduce
amplification (Fig. 4 for
ori-ß mutant 2, and Fig.
5, see below, for ori-ß mutant 9). The data indicate that,
with the possible exception of a stimulatory effect of the 3' most 140
bp, the 3' half of the starting 840 bp ori-ß is not essential. By
contrast, deletion of the 5' 140 bp in mutant 3 or more extensive
5' deletions in mutants 4 and 5 reduced activity to the extent of a
deletion of all of ori-ß (Fig.
4B), indicating that the 5' 140 bp are essential for
ori-ß activity. It is unlikely that deletion of the 140 bp at the
5' end of ori-ß is simply causing a suboptimal spacing between ACE3
and ori-ß, as deletion of the entire
1.2 kb S18 gene in SP
construct (Lu et al., 2001
An additional series of 3' deletions were generated to determine if
the A/T-rich ß region was also required for ori-ß function
(Fig. 5A). The 5' 140 bp
found to be essential above were not sufficient for ori-ß activity in
mutant 6. Addition of the 5' half of the ß region in mutant 7
resulted in a very slight increase in activity, while inclusion of the entire
ß region in mutant 8 supported amplification of average
14 fold
(Fig. 5B). Therefore, a 366 bp
fragment containing a 5' 140 bp element and the 226 bp A/T-rich
ß-region was sufficient to function as ori-ß.
It was of interest to determine if the smaller ACE3 and ori-ß
fragments found to function in the context of the BP construct would be
sufficient to support amplification in combination with each other.
Previously, the starting 320 bp ACE3 element and the starting 840 bp
ori-ß element in the SP construct were found to be sufficient to support
moderate levels of amplification, ranging from 4 to 14 fold. By contrast, the
560 bp ori-ß mutant 2 plus either one or three copies of the 142 bp ACE3
mutant 3 did not support detectable amplification at virtually all insertion
sites (Fig. 6). This is
probably due to the deletion of quantitative elements and/or a non-optimal
spacing of the ACE3 and ori-ß sequences. The one notable exception is
transgenic line 1 of the `mini-1' construct containing one copy of the smaller
ACE3 and ori-ß elements, which reproducibly amplified to
5 fold. The
data suggest that some unique aspect of this particular chromosomal insertion
site stimulates amplification of an otherwise inactive construct.
|
|
In wild-type follicle cells, faint and diffuse nuclear ORC2 staining and
genomic endoreplication persists through stage 9 of oogenesis. Endoreplication
ceases by stage 10A, and coincidentally the diffuse nuclear ORC2 staining
disappears. At this time the ORC staining relocalizes to the chorion gene loci
coincident with the initiation of amplification
(Royzman et al., 1999
)
(Fig. 7A). An alternative
explanation for the chiffon phenotype might be that in chiffon mutants genomic
endoreplication persists, thereby preventing or masking the relocalization of
ORC2 to the chorion gene loci. However, BrdU labeling of wild-type and chiffon
mutant follicle cells shows that genomic endoreplication does not persist in
the vast majority of chiffon mutant follicle cells
(Fig. 7J-L). Therefore, chiffon
does appear to be genuinely required for ORC localization and the formation of
the dramatic foci. Interestingly, faint and patchy BrdU labeling was seen to
persist in rare, isolated, chiffon mutant follicle cells
(Fig. 7K,L). It is not clear if
this faint labeling represents genomic endoreplication or low level chorion
gene amplification, or both.
Transgenic chorion gene constructs can create an extra focus of ORC
staining in follicle cell nuclei (Austin et
al., 1999
). However, previous experiments indicated that extra ORC
foci could not be detected for the BP construct
(Lu et al., 2001
). This result
might have been due to the modest amplification level for BP (
20 fold),
or to the different sequence content of BP, and experiments were undertaken to
try to distinguish between these two possibilities. Multiple transgenic lines
for three different constructs were assayed for the presence of additional
foci of ORC2 localization (Fig.
7; additional data not shown), and selected lines were re-assayed
side-by-side to confirm their relative amplification levels
(Fig. 8). Two transgenic lines
of BP supported 18- and 26-fold amplification, respectively
(Fig. 8B), with no detectable
extra ORC2 foci formation (Fig.
7B). However extra foci of BrdU incorporation were readily
observed (data not shown). By contrast, three similarly active lines of the
buffered Yes-3.8S construct, containing more extensive chorion gene locus
sequences, exhibited extra dramatic ORC2 localization
(Fig. 7C). The data demonstrate
that the lack of foci formation observed for the BP construct is not simply
due to a low amplification level. Construct Caryos-3.8S contains the same
sequences as Yes-3.8S, but is not buffered by flanking insulator elements
(Fig. 8A), so amplification
occurs at some chromosomal locations but not others due to negative
chromosomal position effects (Fig.
8B). With Caryos-3.8S, foci formation correlated with
amplification level, in that foci formation was observed only for highly
amplifying insertion sites (Fig.
7D,E; additional data not shown). The data suggest that negative
chromosomal position effects that reduce amplification also reduce foci
formation, but that use of the buffered vector allows amplification to occur
in the absence of (visible) foci formation.
|
| Discussion |
|---|
|
|
|---|
1.2 kb
S18 chorion gene, and these sequences supported efficient
amplification (
20 fold) with minimal position effects. For this reason,
the BP construct was chosen for detailed analysis of ACE3 and ori-ß
sequence requirements. Evolutionarily conserved core sequences were found to
be sufficient for the majority of ACE3 activity. Deletion of the less
conserved 5' and 3' flanking sequences within ACE3 had
quantitative effects, suggesting that multiple, partially redundant elements
comprise ACE3. These results and conclusions are analogous to those from a
previous study of ACE3 sequence requirements done in the context of a larger,
unbuffered construct (Orr-Weaver et al.,
1989
Recently a protein complex containing Drosophila Myb, p120 and
three other proteins was found to bind to both ACE3 and ori-ß sequences,
and Myb was found to be required in trans for amplification
(Beall et al., 2002
). Both Myb
and p120 are capable of DNA binding on their own, and have binding sites that
overlap with the essential core region of ACE3
(Fig. 2A). There are two Myb
consensus binding sites (121 to 127 and 137 to 142 in
Fig. 2A) and three p120 binding
regions (27 to 56, 89 to 105 and 184 to 216 in
Fig. 2A) in ACE3 element. Small
(30-40 bp) deletions that removed one of Myb consensus binding sites or one of
the p120-binding sites in the core region of ACE3 had negative effects on
amplification in the context of the BP construct. Taken together, these data
suggest that another function of the conserved core region sequences of ACE3
is to bind the Myb complex.
Two-dimensional gel analyses of the endogenous third chromosome chorion
gene locus demonstrated that the majority (70-80%) of initiations occurred in
a region containing the ori-ß element
(Delidakis and Kafatos, 1989
;
Heck and Spradling, 1990
). In
2D gel analysis of the BP construct, abundant initiation events, as indicated
by bubble structures, were associated with the ori-ß element while no
initiations could be detected for ACE3 (Lu
et al., 2001
). To begin to examine the sequence requirements for
ori-ß function, ori-ß was substituted by either the entire 193 bp
S. cerevisiae ARS1 origin sequence, or the 20 bp B2 element from
ARS1, which is a putative DNA unwinding element. No activity in supporting
amplification was detected for either fragment, indicating that ori-ß is
not simply an A/T-rich or easily unwound sequence. Deletion mapping suggests
two sub-components of ori-ß: an essential 5' 140 bp region that is
not particularly A/T-rich, and the 226 bp A/T-rich ß region. The 366 bp
fragment containing both regions was sufficient for the majority of ori-ß
activity. In addition the 3' most 140 bp of the starting 840 bp
ori-ß fragment may have a small stimulatory effect. The portion of the
region in ACE3 and the ß region in ori-ß are each A/T-rich
and internally repetitive, and have some sequence homology with each other
(Levine and Spradling, 1985
).
A large fragment containing the ß-region can bind ORC in vitro
(Austin et al., 1999
).
Therefore, we hypothesize that, like the sequences in ACE3, one required
function of the ß region in ori-ß is to bind ORC.
A similar organization has been identified for a developmentally regulated
origin in another dipteran fly, Sciara coprophila
(Bielinsky et al., 2001
). In
Sciara larvae, the salivary gland cells amplify several loci
containing putative pupal case genes, resulting in chromosomal DNA `puffs'.
The ori II/9A DNA replication initiation site has been mapped to the
nucleotide level and has similarities to the yeast ARS. Drosophila
ORC has been shown to bind to an 80 bp region adjacent to this replication
start site (Bielinsky and Gerbi,
2001
).
Analysis of trans-acting gene mutations confirmed the intimate association
between amplification initiation and the formation of a large focus of ORC2
localization at amplifying chromosomal loci. Mutations in k43
(Orc2) itself, or the newly identified trans-regulatory gene
satin, eliminated ORC2 antibody staining and focus formation. Null
mutations of chiffon, a dbf4-like gene, completely eliminate
amplification (Landis and Tower,
1999
). In chiffon-null mutant follicle cells, diffuse
ORC2 staining was still present in the nucleus, but it failed to localize into
foci at stage 10A. A similar phenotype had previously been observed for
mutations in the amplification trans-regulators dDP (a subunit of
E2F) and Rbf (Bosco et al.,
2001
; Royzman et al.,
1999
). A role for chiffon in ORC localization was
surprising given the well-characterized order of events known for other
organisms. In S. cerevisiae and Xenopus in vitro systems,
ORC is bound at origins and is required for the subsequent binding of Dbf4 and
its catalytic subunit CDC7, which is one of the last events before origin
firing (Bell, 2002
;
Bell and Dutta, 2002
). The data
suggest two possible models for the role of chiffon in ORC2 focus
formation during amplification. In the first model, chiffon protein would bind
first to the chorion gene sequences, either directly or more likely via an
interaction with another DNA-binding protein, as the chiffon sequence suggests
no obvious DNA-binding motifs. Chiffon would then recruit Drosophila
ORC2 to the DNA. This model seems unlikely given the opposite order of events
observed in yeast and in Xenopus in vitro systems. In the second and
favored model, a relatively small amount of ORC binds first to the chorion
gene loci, most probably to the conserved core sequences in ACE3 and the
ß region in ori-ß. Chiffon protein would then interact with the ORC
complex(es) and catalyze the further binding of large amounts of ORC to
generate the dramatic foci observed upon staining with ORC2 antibody. We
envision a mechanism in which the
and ß regions nucleate ORC
binding, and then through a process dependent upon chiffon, an ORC-containing
chromatin structure spreads along the chromosome to form the dramatic foci.
This model is appealing in that it provides a way for ACE3 and ori-ß to
interact and form a chromosomal domain activated for DNA initiation events.
Previous data indicated that ACE3 and ori-ß interact during amplification
in a way that can be blocked by an intervening insulator element
(Lu et al., 2001
). Moreover,
analysis of the endogenous locus indicates that ACE3 is required for the
activation of multiple origins spread throughout a chromosomal domain
containing the chorion gene cluster. This model is testable in that it
predicts that the insulators would form a boundary for this ORC-containing
chromatin structure.
The possibility cannot be ruled out that chiffon is not the true Dbf4
homolog in Drosophila, but this appears unlikely. Chiffon shows
conservation with Dbf4 homologs from all other species in the key ORC-binding
domain (called CDDN2) and the CDC7-binding domain (called CDDN1)
(Landis and Tower, 1999
).
Moreover, there is no other gene in the Drosophila genome with
detectable homology to Dbf4. However, chiffon contains an additional large
C-terminal protein domain present only in Dbf4 homologs from closely related
species, such as Medfly and mosquito. We speculate that this C-terminal domain
may play a specific role in chorion gene amplification. Further experiments
will be required to determine if a role in ORC localization is a
characteristic of all Dbf4 family members, or whether this represents a
function unique to the large chiffon protein.
Consistent with the correlation between ORC2 focus formation and
amplification initiation, dramatic ORC2 foci can form at the sites of
amplifying transgenic chorion gene constructs. It was therefore surprising
that in no cases were foci observed at the sites of actively amplifying BP
constructs. This is despite the fact that amplification was readily observed
at these sites by BrdU incorporation. One possible explanation might be the
moderate amplification level of BP (18- to 20-fold). However, the YES-3.8S
construct amplifies to similar levels as BP, and an extra ORC2 focus was
observed for every line. In addition multimers of ACE3 with very low
amplification level are capable of creating additional ORC2 foci
(Austin et al., 1999
).
Therefore, the lack of focus formation with BP is not simply due to its
moderate amplification level, but must reflect the specific sequence content
or arrangement in BP. The lack of focus formation in BP is also not simply due
to the presence of flanking insulator elements, as the YES-3.8S construct
contains the same flanking insulator elements. The data suggest two
non-exclusive possibilities. The first is that the difference is due to the
fact that BP contains less extensive chorion gene sequences than YES-3.8S.
Although deletion of these sequences has no significant effect on
amplification level, it may be that redundant ORC binding sites have been
deleted, thereby dramatically reducing visible focus formation. The second
possibility is that the relevant difference is the amount of sequence present
inside the insulators. BP contains only 2.4 kb between the insulators, whereas
Yes-3.8 contains 9 kb. If the insulators limit the size of the domain in which
an ORC containing chromatin structure can spread from ACE3 and/or ori-ß,
then the small size of this domain in BP may not create a visible focus. In
this model, the insulators would have two significant effects on
amplification: they would prevent the spread of negative chromatin structures
into the bounded region and thereby prevent negative chromosomal position
effects; and they would limit the ORC containing chromatin structure and
initiation activity to the bounded region. These models should be testable in
the future by CHIP analysis of chromatin structures associated with chorion
gene sequences and transgenic constructs
(Austin et al., 1999
). It will
be of interest in the future to determine if su(Hw)BS insulators or other
types of insulators are involved in organizing the endogenous chorion gene
locus and the rest of the genome into domains of DNA replication activity.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Asano, M. and Wharton, R. P. (1999). E2F
mediates developmental and cell cycle regulation of ORC1 in Drosophila.
EMBO J. 18,2435
-2448.[CrossRef][Medline]
Austin, R. J., Orr-Weaver, T. L. and Bell, S. P.
(1999). Drosophila ORC specifically binds to ACE3, an origin of
DNA replication control element. Genes Dev.
13,2639
-2649.
Beall, E. L., Manak, J. R., Zhou, S., Bell, M., Lipsick, J. S.
and Botchan, M. R. (2002). Role for a Drosophila
Myb-containing protein complex in site-specific DNA replication.
Nature 420,833
-837.[CrossRef][Medline]
Bell, S. P. (2002). The origin recognition
complex: from simple origins to complex functions. Genes
Dev. 16,659
-672.
Bell, S. P. and Dutta, A. (2002). DNA
replication in eukaryotic cells. Annu. Rev. Biochem.
71,333
-374.[CrossRef][Medline]
Bielinsky, A. K., Blitzblau, H., Beall, E. L., Ezrokhi, M.,
Smith, H. S., Botchan, M. R. and Gerbi, S. A. (2001). Origin
recognition complex binding to a metazoan replication origin. Curr.
Biol. 11,1427
-1431.[CrossRef][Medline]
Bielinsky, A. K. and Gerbi, S. A. (2001). Where
it all starts: eukaryotic origins of DNA replication. J. Cell
Sci. 114,643
-651.[Abstract]
Bosco, G., Du, W. and Orr-Weaver, T. L. (2001).
DNA replication control through interaction of E2F-RB and the origin
recognition complex. Nat. Cell Biol.
3, 289-295.[CrossRef][Medline]
Calvi, B. R. and Spradling, A. C. (1999).
Chorion gene amplification in Drosophila: A model for metazoan
origins of DNA replication and S-phase control.
Methods 18,407
-417.[CrossRef][Medline]
Calvi, B. R., Lilly, M. A. and Spradling, A. C.
(1998). Cell cycle control of chorion gene amplification.
Genes Dev. 12,734
-744.
Chesnokov, I., Gossen, M., Remus, D. and Botchan, M.
(1999). Assembly of functionally active Drosophila origin
recognition complex from recombinant proteins. Genes
Dev. 13,1289
-1296.
Claycomb, J. M., MacAlpine, D. M., Evans, J. G., Bell, S. P. and
Orr-Weaver, T. L. (2002). Visualization of replication
initiation and elongation in Drosophila. J. Cell Biol.
159,225
-236.
Dawid, I. B., Wellauer, P. K. and Long, E. O.
(1978). Ribosomal DNA in D. melanogaster. I. Isolation and
characterization of cloned fragments. J. Mol. Biol.
126,749
-768.[CrossRef][Medline]
deCicco, D. V. and Spradling, A. C. (1984).
Localization of a cis-acting element responsible for the
developmentally regulated amplification of Drosophila chorion genes.
Cell 38,45
-54.[CrossRef][Medline]
Delidakis, C. and Kafatos, F. C. (1989).
Amplification enhancers and replication origins in the autosomal chorion gene
cluster of Drosophila. EMBO J.
8, 891-901.[Medline]
Gerasimova, T. I. and Corces, V. G. (2001).
Chromatin insulators and boundaries: effects on transcription and nuclear
organization. Annu. Rev. Genet.
35,193
-208.[CrossRef][Medline]
Gossen, M., Pak, D. T., Hansen, S. K., Acharya, J. K. and
Botchan, M. R. (1995). A Drosophila homolog of the yeast
origin recognition complex. Science
270,1674
-1677.
Heck, M. M. S. and Spradling, A. C. (1990).
Multiple replication origins are used during Drosophila chorion gene
amplification. J. Cell Biol.
110,903
-914.
Landis, G. and Tower, J. (1999). The Drosophila
chiffon gene is required for chorion gene amplification, and is related to the
yeast Dbf4 regulator of DNA replication and cell cycle.
Development 126,4281
-4293.[Abstract]
Landis, G., Kelley, R., Spradling, A. C. and Tower, J.
(1997). The k43 gene, required for chorion gene amplification and
diploid cell chromosome replication, encodes the Drosophila homolog of yeast
origin recognition complex subunit 2. Proc. Natl. Acad. Sci.
USA 94,3888
-3892.
Levine, J. and Spradling, A. C. (1985). DNA
sequence of a 3.8 kilobase pair region controlling Drosophila chorion
gene amplification. Chromosoma
92,136
-142.[CrossRef][Medline]
Lilly, M. A. and Spradling, A. C. (1996). The
Drosophila endocycle is controlled by Cyclin E and lacks a checkpoint ensuring
S-phase completion. Genes Dev.
10,2514
-2526.
Lu, L. and Tower, J. (1997). A transcriptional
insulator element, the su(Hw) binding site, protects a chromosomal DNA
replication origin from position effects. Mol. Cell.
Biol. 17,2202
-2206.[Abstract]
Lu, L., Zhang, H. and Tower, J. (2001).
Functionally distinct, sequence-specific replicator and origin elements are
required for Drosophila chorion gene amplification. Genes
Dev. 15,134
-146.
Marahrens, Y. and Stillman, B. (1992). A yeast
chromosomal origin of DNA replication defined by multiple functional elements.
Science 255,817
-823.
Orr, W., Komitopoulou, K. and Kafatos, F. C.
(1984). Mutants suppressing in trans chorion gene amplification
in Drosophila. Proc. Natl. Acad. Sci. USA
81,3773
-3777.
Orr-Weaver, Y. L., Johnston, C. G. and Spradling, A. C.
(1989). The role of ACE3 in Drosophila chorion gene
amplification. EMBO J.
8,4153
-4162.[Medline]
Osheim, Y. N., Miller, O. L. and Beyer, A. L.
(1988). Visualization of Drosophila melanogaster chorion
genes undergoing amplification. Mol. Cell. Biol.
8,2811
-2821.
Quinn, L. M., Herr, A., McGarry, T. J. and Richardson, H.
(2001). The Drosophila Geminin homolog: roles for Geminin in
limiting DNA replication, in anaphase and in neurogenesis. Genes
Dev. 15,2741
-2754.
Royzman, I. and Orr-Weaver, T. L. (1998). S
phase and differential DNA replication during Drosophila oogenesis.
Genes Cells 3,767
-776.[Abstract]
Royzman, I., Austin, R. J., Bosco, G., Bell, S. P. and
Orr-Weaver, T. L. (1999). ORC localization in Drosophila
follicle cells and the effects of mutations in dE2F and dDP. Genes
Dev. 13,827
-840.
Rubin, G. M. and Spradling, A. C. (1982).
Genetic transformation of Drosophila with transposable element
vectors. Science 218,348
-353.
Schupbach, T. and Wieschaus, E. (1991). Female
sterile mutations on the second chromosome of Drosophila
melanogaster. II. Mutations blocking oogenesis or altering egg
morphology. Genetics
129,1119
-1136.[Abstract]
Schwed, G., May, N., Pechersky, Y. and Calvi, B. R.
(2002). Drosophila minichromosome maintenance 6 is required for
chorion gene amplification and genomic replication. Mol. Biol.
Cell 13,607
-620.
Spradling, A. C. and Leys, E. (1988). Slow
replication fork movement during Drosophila chorion gene
amplification. In Cancer Cells 6/Eukaryotic DNA
Replication, pp. 305-309. Cold Spring
Harbor: Cold Spring Harbor Laboratory Press.
Spradling, A. C. and Mahowald, A. P. (1981). A
chromosome inversion alters the pattern of specific DNA replication in
Drosophila follicle cells. Cell
27,203
-209.[CrossRef][Medline]
Stillman, B. (1993). Replicator renaissance.
Nature 366,506
-507.[CrossRef][Medline]
Swimmer, C., Fenerjian, M. G., Martinez-Cruzado, J. C. and
Kafatos, K. C. (1990). Evolution of the autosomal chorion
gene cluster in Drosophila III. Comparison of the s18 gene in
evolutionarily distant species and interspecific control of chorion gene
amplification. J. Mol. Biol.
215,225
-235.[CrossRef][Medline]
Whittaker, A. J., Royzman, I. and Orr-Weaver, T. L.
(2000). Drosophila double parked: a conserved essential
replication protein that colocalizes with the origin recognition complex an
links DNA replication with mitosis and the down-regulation of S phase
transcripts. Genes Dev.
14,1765
-1776.
This article has been cited by other articles:
![]() |
H.-C. Lin, J.-T. Wu, B. C.-M. Tan, and C.-T. Chien Cul4 and DDB1 regulate Orc2 localization, BrdU incorporation and Dup stability during gene amplification in Drosophila follicle cells J. Cell Sci., July 15, 2009; 122(14): 2393 - 2401. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Heaney, M. V. Michelson, K. K. Youngren, M.-Y. J. Lam, and J. H. Nadeau Deletion of eIF2beta suppresses testicular cancer incidence and causes recessive lethality in agouti-yellow mice Hum. Mol. Genet., April 15, 2009; 18(8): 1395 - 1404. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Marilley, P. Milani, J. Thimonier, J. Rocca-Serra, and G. Baldacci Atomic force microscopy of DNA in solution and DNA modelling show that structural properties specify the eukaryotic replication initiation site Nucleic Acids Res., November 29, 2007; 35(20): 6832 - 6845. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. R. Calvi, B. A. Byrnes, and A. J. Kolpakas Conservation of Epigenetic Regulation, ORC Binding and Developmental Timing of DNA Replication Origins in the Genus Drosophila Genetics, November 1, 2007; 177(3): 1291 - 1301. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Park, D. M. MacAlpine, and T. L. Orr-Weaver Inaugural Article: Drosophila follicle cell amplicons as models for metazoan DNA replication: A cyclinE mutant exhibits increased replication fork elongation PNAS, October 23, 2007; 104(43): 16739 - 16746. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Silva, R. H. Bradley, Y. Gao, and M. Coue Xenopus CDC7/DRF1 Complex Is Required for the Initiation of DNA Replication J. Biol. Chem., April 28, 2006; 281(17): 11569 - 11576. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||