|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online April 22, 2004
doi: 10.1242/10.1242/dev.01045



1 Division of Developmental Biology, National Institute for Medical Research,
The Ridgeway, Mill Hill, London NW7 1AA, UK
2 Division of Developmental Neurobiology, National Institute for Medical
Research, The Ridgeway, Mill Hill, London NW7 1AA, UK
Author for correspondence (e-mail:
jim{at}welc.cam.ac.uk)
Accepted 17 December 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Xenopus, CTGF, CCN family, Wnt signalling, LRP6
| Introduction |
|---|
|
|
|---|
The four domains of CTGF resemble those found in other secreted proteins
(Bork, 1993
). Domain 1 exhibits
homology with the N-terminal region of the low-molecular-weight insulin-like
growth factor binding proteins (IGFBPs) and with Twisted gastrulation (Tsg),
which modulates signalling by BMP family members
(Chang et al., 2001
;
Mason et al., 1994
;
Oelgeschlager et al., 2000
).
Domain 2 includes a von Willebrand factor type C repeat (VWC), and also
displays similarities with the cysteine repeats in the BMP antagonist Short
gastrulation (Sog)/Chordin (Abreu et al.,
2002
; Sasai et al.,
1994
). Domain 3 has homology with the thrombospondin type 1 repeat
superfamily of ECM associated proteins
(Adams, 2001
). Finally, domain
4, or the C-terminal (CT) domain, shows similarity to the C terminus of Slit,
a protein involved in axon guidance and cell migration
(Bork, 1993
;
Brose and Tessier-Lavigne,
2000
; Rothberg et al.,
1990
). This domain contains a cystine knot structure, which is
also present in growth factors including the TGFß superfamily, platelet
derived growth factor (PDGF) and nerve growth factors (NGFs). It is believed
to mediate protein-protein interactions or dimerisation
(Bork, 1993
;
Schlunegger and Grutter, 1993
;
Vitt et al., 2001
). The same
motif is found in Wise (WNT modulator in surface ectoderm), a recently
identified modulator of WNT signalling
(Itasaki et al., 2003
). A
comparison of the CT domains of CTGF and of Cyr61, Slit and Wise is shown in
Fig. 1A.
|
2-macroglobulin receptor
(Segarini et al., 2001| Materials and methods |
|---|
|
|
|---|
Ctgf and Ctgf
CT RNA were transcribed from
the plasmids pSP64T-CTGF and pSP64T-CTGF
CT (see below). Plasmids were
linearised with XbaI and transcribed with SP6 RNA polymerase. RNA
encoding Xwnt8 or Dsh was transcribed as described
(Christian et al., 1991
;
Sokol, 1996
).
Reverse transcription-polymerase chain reaction (RT-PCR) analysis was
performed as described (Wilson and Melton,
1994
). Primers for EF1
, Muscle-specific actin,
N-CAM, Xnr3 and Siamois were as described
(Domingos et al., 2001
;
Hemmati-Brivanlou and Melton,
1994
). Ctgf primers were 5' CTC CTC ACA GAA CCG CTA
CC 3' (upstream) and 5' GGC TTG TTT TGT GCC AAT TT 3'
(downstream).
Antisense morpholino oligonucleotides
An antisense morpholino oligonucleotide with the sequence 5'
GTACAGCAGCAGATTAGTTCTCTTC 3', designed to inhibit translation of
Xenopus CTGF, was purchased from GeneTools.
Expression constructs
To create constructs for expression in Xenopus embryos,
Ctgf was cloned by PCR from stage 25 Xenopus embryo cDNA
using primers designed against the Ctgf open reading frame (GenBank
accession number U43524). The upstream primer was 5' GCT AGA
TCT ATG TCT GCA GGA AAA GTG ACA GC 3', which corresponds to
the first ATG (bold) and includes a BglII site (underlined). The
downstream primer was 5' CAG TCT CGA GTG CTA TGT CTC
CAT ACA TTT TCC G 3', which includes a stop codon (bold) and an
XhoI site (underlined). The resulting fragments were cloned into a
modified form of pSP64T (Tada et al.,
1998
). An alternative version of pSP64T-CTGF, which included 18
extra amino acids at its C-terminus, was used in some experiments. Similar
results were obtained with both constructs. Ctgf
CT was cloned
using the same upstream primer and a downstream primer that included an
XhoI site (underlined) and a stop codon (bold). Its sequence
was 5' G GGC CTC GAG TTA TTC ACA GGG CCT GAC CAT GC
3'. The resulting fragment was cloned into pSP64T
(Tada et al., 1998
) to create
pSP64T-CTGF
CT.
For expression of constructs in mammalian cells, IgG
(Hsieh et al., 1999b
),
Frizzled8CRD-IgG (Hsieh et al.,
1999b
), LRP6N-IgG (Tamai et
al., 2000
) and DKK1-Flag (Mao
et al., 2001
) were as described. LRP6N
1,2-IgG and
LRP6N
3,4-IgG, which lack EGF repeats 1 and 2 or 3 and 4, respectively,
were generated by PCR as described previously
(Itasaki et al., 2003
;
Mao et al., 2001
). For
expression in S2 insect cells, Ctgf and
Ctgf
CT cDNAs were cloned into pMT/V5-HisB
(Invitrogen) and the proteins were HA tagged at their C-termini, creating
pMT/CTGF-HA and pMT/CTGF
CT-HA.
In situ hybridization and X-gal staining
Embryos were fixed and processed for in situ hybridization essentially as
described (Harland, 1991
).
Minor modifications included the use of BM purple (Boehringer Mannheim) as
substrate. Sense and antisense Ctgf probes were made from a 700 base
pair cDNA that includes the 3' untranslated region. Other probes were
Xsox3 (Koyano et al.,
1997
), N-tubulin
(Chitnis and Kintner, 1995
),
Slug (Mayor et al.,
1995
), MLC1 (Theze et
al., 1995
), Pax6
(Hirsch and Harris, 1997
) and
Otx2 (Pannese et al.,
1995
).
For X-gal staining, fixed embryos were rinsed several times in PBS containing 0.1% Tween 20 (PBST), washed for 5 minutes in developing solution [7.2 mM Na2HPO4, 2.8 mM NaH2PO4, 150 mM NaCl, 0.1% Tween 20, 1 mM MgCl2, 3 mM K3Fe(CN)6, 3 mM K4Fe(CN)6, pH 7.2] and transferred to fresh developing solution containing 0.027% X-gal for approximately 20 minutes at room temperature until adequate blue staining was achieved. They were then washed in PBST and stored in 100% methanol at 20°C until processed for in situ hybridisation.
Luciferase assays for TOPFLASH reporter activity
To measure the ability of CTGF and CTGF
CT to inhibit Xwnt8 or
Dishevelled activation of a TCF-dependent reporter construct, the TOPFLASH
reporter plasmid (Korinek et al.,
1998
) was injected into Xenopus embryos together with
pRLTK (Promega) as a reference plasmid, and with RNA encoding Xwnt8 or
Dishevelled, either alone or in combination with RNA encoding CTGF or
CTGF
CT.
Luciferase activity was detected using the Promega Dual Luciferase Kit. Twenty animal caps were lysed in 200 µl of Passive Lysis Buffer (Promega) and 5 µl was assayed for luminescence.
Immunoprecipitation
S2 cells were grown as described in the Drosophila Expression
System protocol (Invitrogen) and HEK293 cells were cultured in Dulbecco's
modified Eagle's medium (DMEM) supplemented with 10% foetal calf serum.
Conditioned medium containing CTGF-HA or CTGF
CT-HA was produced in S2
cells transiently transfected by the calcium phosphate method with pMT/CTGF-HA
or pMT/CTGF
CT-HA. One day after transfection, cells were transferred to
serum-free medium (Invitrogen) and expression of CTGF-HA and CTGF
CT-HA
was induced by addition of copper sulphate to a final concentration of 500
µM. Medium was collected two days after induction and centrifuged at 20,000
g at 4°C for 30 minutes. Conditioned medium containing
Frizzled8CRD-IgG, LRP6N-IgG, LRP6N
1,2-IgG, LRP6N
3,4-IgG or IgG
was obtained from HEK293 cells (Hsieh et
al., 1999b
; Tamai et al.,
2000
) transiently transfected with the appropriate constructs
using the Superfect transfection reagent (Qiagen) as described in the
manufacturer's instructions. Cells were transferred to serum-free medium
(Optimem, Gibco) one day after transfection and conditioned medium was
collected 48 hours later.
Media were concentrated by ultrafiltration, combined as appropriate, and adjusted to the same volume by addition of control medium derived from untransfected cells. Mixtures were incubated overnight at 4°C and Protein A Sepharose beads were then added for 2 hours at 4°C. The beads were pelleted by centrifugation and, for low stringency experiments, were washed 5-6 times over 30 minutes in a buffer containing 150 mM NaCl, 50 mM Tris-HCl pH 7.5, 0.1% Triton X-100 and proteinase inhibitors. High stringency conditions involved an additional 3 washes in high stringency wash buffer (0.5 M NaCl, 50 mM Tris-HCl pH 7.5, 0.1% Triton X-100, 0.1% NP40, proteinase inhibitors). Unless otherwise indicated, experiments used high stringency conditions. Bound protein was eluted by boiling in SDS-sample buffer. Proteins were subjected to SDS-polyacrylamide gel electrophoresis and immunoblotted with the following antibodies according to the manufacturer's instructions: anti-IgG-HRP (Sigma), anti-HA-HRP (Roche) and anti-Flag-HRP (Sigma). The ECL+ detection technique (Amersham) was used for detection.
| Results |
|---|
|
|
|---|
Overexpression of CTGF mimics the effects of inhibiting components of the WNT signalling pathway
Injection into Xenopus embryos of an antisense morpholino
oligonucleotide designed to inhibit translation of CTGF (see Materials and
methods) caused no disruption of development (data not shown). A similar
observation has been reported by Abreu and colleagues
(Abreu et al., 2002
). We note
that mouse embryos in which the Ctgf gene is disrupted survive to
birth and that mutant and wild-type embryos are indistinguishable at 12.5 days
post-coitum (Ivkovic et al.,
2003
). This suggests that CTGF is essential only for later stages
of development (see Discussion).
As an alternative approach to studying the function of CTGF in
Xenopus, we overexpressed the protein by RNA injection at the
one-cell stage. In 29% of embryos (n=55) this caused a disruption of
gastrulation, whereas 56% displayed antero-posterior defects, with embryos
forming a short trunk, enlarged cement gland, and reduced eyes
(Fig. 2A-C). These defects were
observed only rarely in embryos injected with the same amount of lacZ
RNA. To characterise this phenotype in more detail, RNA encoding
Xenopus CTGF, together with lacZ RNA to act as a lineage
marker, was injected into one cell of Xenopus embryos at the two-cell
stage, and the expression of neural and mesodermal markers was examined at
neurula stages, when endogenous Ctgf is first expressed. We found
that expression of Otx2, an anterior neural marker for forebrain and
midbrain (Pannese et al.,
1995
), was expanded posteriorly on the injected side
(Fig. 2D). Pax6, which
at this stage is expressed in the prospective forebrain and in two
dorso-lateral stripes that will form parts of the hindbrain
(Hirsch and Harris, 1997
),
showed slight expansion of the forebrain domain, whereas the future hindbrain
expression domain was decreased (Fig.
2E). These data indicate that CTGF is able to expand the territory
of anterior neural structures.
|
We next examined the effect of overexpression of CTGF on axial mesoderm;
Ctgf is strongly expressed in somite tissue by the late neurula
stage. The skeletal muscle-specific gene myosin light chain 1
(MLC1) (Theze et al.,
1995
) is down-regulated by Ctgf
(Fig. 2K). This will probably
represent a delay in expression rather than a complete inhibition, because at
later stages somites do form and appear relatively normal. Overall, the
results described in Fig. 2
indicate that overexpression of CTGF anteriorises the neural tube, and
inhibits or delays primary neurogenesis, neural crest formation and muscle
development.
Some of the effects caused by overexpression of CTGF, such as the expansion
of Otx2 and Xsox3, and the occasional induction of partial
secondary axes (Abreu et al.,
2002
) (data not shown), may be because of inhibition of BMP
signalling. We note, however, that the actions of CTGF are also reminiscent of
the effects observed upon inhibition of WNT signalling. For example,
dominant-negative Xwnt8 (Hoppler et al.,
1996
) and the WNT antagonist Frzb
(Leyns et al., 1997
;
Wang et al., 1997
;
Xu et al., 1998
) all cause
axial shortening and a decrease in somitic muscle. In neural crest formation,
WNT1, WNT3A and positive components of the WNT signalling pathway such as
Frizzled3, ß-catenin and LRP6 all increase the production of neural crest
cells (Wu et al., 2003
). In
contrast, inhibition of Frizzled3 function, like overexpression of CTGF
(Fig. 2I), reduces
Slug expression (Deardorff et
al., 2001
). Furthermore, overexpression of GSK3, a negative
regulator of WNT signalling, causes enlargement of the cement gland and an
impairment of eye formation (Itoh et al.,
1995
; Pierce and Kimelman,
1996
), as does CTGF.
CTGF inhibits the effects of overexpression of XWNT8
To address more directly the question of whether CTGF affects WNT
signalling, and in particular the canonical WNT signalling pathway, we first
asked whether CTGF influences the induction of secondary axes in
Xenopus embryos by Xwnt8 (Smith
and Harland, 1991
; Sokol et
al., 1991
). RNA encoding Xwnt8 was injected ventrally into
Xenopus embryos at the 4- to 8-cell stage in the presence or absence
of RNA encoding CTGF. CTGF inhibited secondary axis induction by
Xwnt8 (Fig. 3A-D) and
also inhibited activation of the direct WNT targets Siamois and
Xnr3 (Brannon et al.,
1997
; McKendry et al.,
1997
) in ventral marginal zone tissue
(Fig. 3E). Similarly, CTGF
reduced activation of the TOPFLASH TCF reporter
(Korinek et al., 1998
) in
Xenopus animal caps, suggesting that it interferes directly with the
canonical WNT pathway (Fig.
3F).
|
Activin treatment of animal caps derived from control embryos causes them
to elongate, in a manner resembling the convergent extension movements of
gastrulation and neurulation, whereas untreated caps remain spherical
(Fig. 3H,I). Interference with
the WNT/planar cell polarity pathway inhibits convergent extension
(Tada and Smith, 2000
), and
indeed animal caps derived from embryos overexpressing CTGF do not elongate in
response to activin (Fig. 3J) and the elongation of isolated dorsal marginal zone regions is also reduced
(Fig. 3K-N;
Table 1). Significantly, CTGF
does not inhibit muscle differentiation in activin-treated animal caps,
consistent with the idea that it affects the planar polarity pathway in this
assay (Fig. 3O, lanes 1-5).
|
The ability of CTGF to modulate WNT signalling resides in the CT domain
The ability of CTGF to modulate BMP signalling resides in the second domain
of the protein, which contains Chordin-like repeats
(Abreu et al., 2002
). We
speculated that its ability to modulate WNT signalling resides in the fourth
or CT domain. This region contains a cystine knot
(Bork, 1993
) and is a potential
binding site for heparan sulphate proteoglycans (HSPGs)
(Ball et al., 2003
;
Brigstock et al., 1997
;
Kireeva et al., 1997
), which
play a role in the regulation of WNT signalling
(Baeg et al., 2001
;
Chen et al., 2000
;
Lin and Perrimon, 1999
;
Ohkawara et al., 2003
;
Tsuda et al., 1999
).
Consistent with this observation, we find that a deleted form of CTGF which
lacks the CT domain (CTGF
CT) (Fig.
4A) cannot interfere with Xwnt8-induced secondary axis formation
(Fig. 4B-D) and was less
effective in inhibiting Xwnt8-induced activation of the TOPFLASH reporter
(Fig. 4E). It was also unable
to inhibit activin-induced elongation of Xenopus animal caps
(Fig. 4F-H). However, like the
wild-type protein (Fig. 2J),
CTGF
CT was still capable of blocking expression of N-tubulin (data not
shown), confirming that the truncated protein retains some activity and
suggesting that regions of the protein other than the CT domain are involved
in the regulation of primary neurogenesis. Like the wild-type protein
(Fig. 3O, lanes 1-5),
CTGF
CT does not inhibit muscle differentiation in activin-treated
animal caps (Fig. 3O, lanes 3,
6, 7).
|
To ask whether CTGF can interact with Frizzled8 or LRP6, we combined conditioned medium containing HA-tagged CTGF with conditioned medium containing secreted IgG-tagged versions of LRP6 (LRP6N) or Frizzled8 (Frizzled8CRD). Co-immunoprecipitation experiments showed that CTGF can interact with the extracellular regions of both LRP6 and Frizzled8 under conditions of low stringency (150 mM NaCl), but that interaction with Frizzled8 is abolished when the precipitates were washed at high stringency (500 mM NaCl) (Fig. 5A). We conclude that CTGF can interact with LRP6 in solution and that this interaction is not disrupted by high salt washes. CTGF can also interact with Frizzled8, but this interaction is weaker and may require additional components. In support of this idea, we note that when the above constructs are co-transfected into HEK293 cells (rather than being analysed by mixing conditioned media), CTGF and Frizzled8 interact as strongly as CTGF and LRP6 (data not shown).
|
CT is unable to bind LRP6
in this assay (Fig. 5B). This
result is consistent with experiments described above indicating that the CT
domain is required for complete inhibition of WNT signalling by CTGF
(Fig. 4). We note that the CT
domain is also required for interaction of CTGF with Frizzled8 (data not
shown).
In an attempt to understand the molecular mechanism by which CTGF inhibits
WNT signalling, we asked if it recognises the same domains of LRP6 as are
recognised by Xwnt8 or whether, like Dickkopf (Dkk), it interacts with
distinct sites. The LRP6 extracellular domain contains four epidermal growth
factor (EGF)-like repeats. Repeats 1 and 2 are required for interaction with
WNT proteins, whereas Dkk interacts with EGF repeats 3 and 4
(Mao et al., 2001
).
Experiments involving immunoprecipitation of mixed conditioned media indicate
that CTGF can interact both with EGF repeats 1 and 2 (LRP6N
3,4) and
with EGF repeats 3 and 4 (LRP6N
1,2)
(Fig. 5C). In the same assay
DKK1 interacts specifically with the region containing EGF repeats 3 and 4
(Fig. 5D), as previously
reported (Mao et al., 2001
).
Interestingly, co-transfection experiments indicate that CTGF binds
preferentially to EGF repeats 1 and 2 (data not shown). The significance of
the latter observation is not clear, but together our results indicate that
the structural basis of the interaction of CTGF with LRP6 differs from that of
DKK1, suggesting that the two molecules inhibit WNT signalling by different
mechanisms.
| Discussion |
|---|
|
|
|---|
Regulation of WNT and TGFß signalling by CTGF
Some of the effects of overexpression of CTGF in the Xenopus
embryo, such as the upregulation of Otx2 and Xsox3 and the
induction of partial secondary axes (Abreu
et al., 2002
; data not shown), may be because of inhibition of BMP
signalling. Others, however, such as the inhibition of neural crest cell
migration, might be better explained by inhibition of the WNT pathway
(Deardorff et al., 2001
;
Garcia-Castro et al., 2002
)
(Fig. 2 and see Results).
Consistent with this idea, we observe that CTGF can inhibit the ability of
Xwnt8 to induce secondary axes in the Xenopus embryo
(Fig. 3A-D), that it can
inhibit induction of the direct WNT targets Siamois and Xnr3
(Fig. 3E), and that it can
inhibit activation of the TOPFLASH reporter construct
(Fig. 3F). CTGF will probably
act extracellularly, because activation of the TOPFLASH reporter by Dsh is not
prevented by CTGF (Fig. 4E),
and indeed we have demonstrated that CTGF can interact stably with LRP6 and
weakly with Frizzled8, two components of the WNT receptor complex
(Fig. 5).
How might CTGF inhibit WNT signalling? One possibility is that CTGF, like
Wise (Itasaki et al., 2003
),
competes with WNT family members for binding to LRP6. Preliminary results are
consistent with this possibility, but interpretation of such experiments is
complicated by the weak interaction of WNT8 with LRP6 in our assay conditions
(data not shown). Other mechanisms include the idea that CTGF inhibits WNT
signalling by inducing conformational changes within LRP6 that might displace
Dkk or alter interactions with other components
(Boyden et al., 2002
;
Liu et al., 2003
), by binding
to heparan sulphate proteoglycans, by binding to both LRP and LRP5/6 or by
interacting with the WNT inhibitor Kremen (see below).
The ability of CTGF to regulate both TGFß signalling
(Abreu et al., 2002
) and WNT
signalling is reminiscent of the activity of Cerberus, which regulates BMP and
WNT signalling through interactions with the respective ligands
(Piccolo et al., 1999
).
CTGF and other WNT inhibitors
Many secreted inhibitors of WNT signalling have been identified. Some, like
Cerberus, WIF-1 and Frzb, function by binding to WNT ligands themselves and
may thereby inhibit interaction between ligand and receptor
(Bafico et al., 1999
;
Hsieh et al., 1999a
;
Leyns et al., 1997
;
Piccolo et al., 1999
;
Wang et al., 1997
;
Xu et al., 1998
). In contrast,
DKK1 functions by binding to LRP6 and preventing the formation of a complex
comprising WNT, Frizzled and LRP6 (Semenov
et al., 2001
). DKK1 can also form a ternary complex with Kremen,
its high affinity receptor, which induces rapid internalisation and removal of
LRP6 from the cell surface (Davidson et
al., 2002
; Mao et al.,
2002
).
Although both CTGF and DKK1 bind to LRP6 to inhibit WNT signalling, there
are some differences in the modes of action of these two antagonists. First,
DKK1 binds preferentially to the region of LRP6 containing EGF repeats 3 and 4
(Mao et al., 2001
), whereas
CTGF can interact with both EGF repeats 1, 2 and 3, 4
(Fig. 5C,D). Second, DKK1 is
specific for the canonical WNT pathway, which exerts its effect through the
stabilization of ß-catenin (Semenov
et al., 2001
), whereas CTGF also appears to affect the
non-canonical WNT pathway, which regulates gastrulation movements
(Fig. 3G-N). And finally, CTGF
appears to be a much weaker antagonist of the WNT pathway than is DKK1;
overexpression of DKK1 causes embryos to develop with extremely short trunks
and enlarged heads and cement glands
(Glinka et al., 1998
), whereas
comparable or higher doses of CTGF cause much milder anteriorised
phenotypes.
Another member of the CCN family, Cyr61, also regulates WNT signalling
(Latinkic et al., 2003
), as
does Wise, a novel CT domain protein
(Itasaki et al., 2003
),
although these proteins can stimulate the pathway as well as antagonise it.
These observations suggest that this class of cystine knot domain proteins may
generally be involved in the modulation of WNT activity. Indeed, our
experiments demonstrate that the interaction of CTGF with LRP6 requires the CT
domain, and overexpression of just the CT domain of Cyr61, albeit at high
levels, is sufficient to inhibit Xwnt8-induced secondary axis induction in
Xenopus (Latinkic et al.,
2003
). The same will probably be true for the highly conserved CT
domain of CTGF (Fig. 1A). We
note that the CTGF CT domain plays a major role in binding to heparin and
possibly to HSPGs (Ball et al.,
2003
; Brigstock et al.,
1997
). It is possible that HSPGs stabilise the binding of CTGF to
Frizzled, because this interaction is strong in experiments involving
co-transfection but weak in experiments in which conditioned media are
combined (Fig. 5A).
CTGF and the non-canonical WNT pathway
CTGF differs from DKK1 in that it is able to inhibit convergent extension
movements in animal caps. LRP6 signals exclusively through the canonical WNT
pathway involving ß-catenin (Semenov
et al., 2001
), so the ability of CTGF to modulate the WNT-mediated
planar cell polarity pathway must occur through another route, perhaps
involving interaction with Frizzled receptors (such as Frizzled7)
(Djiane et al., 2000
), or
through cooperation with HSPGs such as Glypican 4
(Ohkawara et al., 2003
). The
latter suggestion is supported by the observation that the ability of CTGF to
block the elongation of activin-treated animal caps resides in the CT domain.
An alternative possibility, however, is that CTGF modulates convergent
extension through interactions with integrins. CTGF binds to integrin
receptors (Lau and Lam, 1999
),
and integrins are involved in the recruitment of Dishevelled to the plasma
membrane, a key step in the WNT planar cell polarity pathway
(Marsden and DeSimone,
2001
).
The function of CTGF
Disruption of the mouse Ctgf gene causes impaired chondrogenesis
and angiogenesis (Ivkovic et al.,
2003
), but mutant embryos develop rather normally until
mid-gestation stages. This result is consistent with the observation that
antisense morpholino oligonucleotides cause no defect in early
Xenopus embryos (Abreu et al.,
2002
) (data not shown). It is possible that another CCN family
member, Cyr61, compensates for some aspects of loss of CTGF, because they are
co-expressed in many tissues and have similar biochemical activities
(Lau and Lam, 1999
).
Finally, are any of the functions of CTGF in the embryo mediated through
WNT signalling? We note that the expression patterns of Ctgf and
Lrp5 and Lrp6 during Xenopus development are
strikingly similar, suggesting that the interactions we observe in vitro may
also be significant in vivo (Houston and
Wylie, 2002
). Other components of the WNT signalling pathways are
also present in the Ctgf expression domain, including
Frizzled family members (Borello
et al., 1999
; Deardorff and
Klein, 1999
) and, in the floorplate, Wnt4
(McGrew et al., 1992
;
Ungar et al., 1995
). It may
also be significant that mouse embryos lacking Lrp5, like those
deficient in Ctgf, display abnormalities in bone formation and
angiogenesis (Gong et al.,
2001
; Kato et al.,
2002
; Little et al.,
2002
), suggesting that modulation of the WNT pathway is
compromised in Ctgf-/- embryos.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Present address: School of Biosciences, Cardiff University, PO Box 911,
Cardiff CF10 3US, UK ![]()
Present address: Stowers Institute for Medical Research, 1000 East 50th
Street, Kansas City, MO 64110, USA ![]()
| REFERENCES |
|---|
|
|
|---|
Abreu, J. G., Ketpura, N. I., Reversade, B. and De Robertis, E. M. (2002). Connective-tissue growth factor (CTGF) modulates cell signalling by BMP and TGF-beta. Nat. Cell Biol. 4, 599-604.[Medline]
Adams, J. C. (2001). Thrombospondins: multifunctional regulators of cell interactions. Annu. Rev. Cell Dev. Biol. 17,25 -51.[CrossRef][Medline]
Babic, A. M., Chen, C. C. and Lau, L. F.
(1999). Fisp12/mouse connective tissue growth factor mediates
endothelial cell adhesion and migration through integrin alphavbeta3, promotes
endothelial cell survival, and induces angiogenesis in vivo. Mol.
Cell. Biol. 19,2958
-2966.
Baeg, G. H., Lin, X., Khare, N., Baumgartner, S. and Perrimon, N. (2001). Heparan sulfate proteoglycans are critical for the organization of the extracellular distribution of Wingless. Development 128,87 -94.[Abstract]
Bafico, A., Gazit, A., Pramila, T., Finch, P. W., Yaniv, A. and
Aaronson, S. A. (1999). Interaction of frizzled related
protein (FRP) with Wnt ligands and the frizzled receptor suggests alternative
mechanisms for FRP inhibition of Wnt signaling. J. Biol.
Chem. 274,16180
-16187.
Bafico, A., Liu, G., Yaniv, A., Gazit, A. and Aaronson, S. A. (2001). Novel mechanism of Wnt signalling inhibition mediated by Dickkopf-1 interaction with LRP6/Arrow. Nat. Cell Biol. 3,683 -686.[CrossRef][Medline]
Ball, D. K., Rachfal, A. W., Kemper, S. A. and Brigstock, D. R. (2003). The heparin-binding 10 kDa fragment of connective tissue growth factor (CTGF) containing module 4 alone stimulates cell adhesion. J. Endocrinol. 176, R1-R7.[Abstract]
Borello, U., Buffa, V., Sonnino, C., Melchionna, R., Vivarelli, E. and Cossu, G. (1999). Differential expression of the Wnt putative receptors Frizzled during mouse somitogenesis. Mech. Dev. 89,173 -177.[CrossRef][Medline]
Bork, P. (1993). The modular architecture of a new family of growth regulators related to connective tissue growth factor. FEBS Lett. 327,125 -130.[CrossRef][Medline]
Boyden, L. M., Mao, J., Belsky, J., Mitzner, L., Farhi, A.,
Mitnick, M. A., Wu, D., Insogna, K. and Lifton, R. P. (2002).
High bone density due to a mutation in LDL-receptor-related protein 5.
New Engl. J. Med. 346,1513
-1521.
Brannon, M., Gomperts, M., Sumoy, L., Moon, R. T. and Kimelman,
D. (1997). A beta-catenin/XTcf-3 complex binds to the siamois
promoter to regulate dorsal axis specification in Xenopus. Genes
Dev. 11,2359
-2370.
Brigstock, D. R., Steffen, C. L., Kim, G. Y., Vegunta, R. K.,
Diehl, J. R. and Harding, P. A. (1997). Purification and
characterization of novel heparin-binding growth factors in uterine secretory
fluids. Identification as heparin-regulated Mr 10,000 forms of connective
tissue growth factor. J. Biol. Chem.
272,20275
-20282.
Brose, K. and Tessier-Lavigne, M. (2000). Slit proteins: key regulators of axon guidance, axonal branching, and cell migration. Curr. Opin. Neurobiol. 10, 95-102.[CrossRef][Medline]
Chang, C., Holtzman, D. A., Chau, S., Chickering, T., Woolf, E. A., Holmgren, L. M., Bodorova, J., Gearing, D. P., Holmes, W. E. and Brivanlou, A. H. (2001). Twisted gastrulation can function as a BMP antagonist. Nature 410,483 -487.[CrossRef][Medline]
Chen, C. C., Chen, N. and Lau, L. F. (2001).
The angiogenic factors Cyr61 and connective tissue growth factor induce
adhesive signaling in primary human skin fibroblasts. J. Biol.
Chem. 276,10443
-10452.
Chen, N., Chen, C. C. and Lau, L. F. (2000).
Adhesion of human skin fibroblasts to Cyr61 is mediated through integrin
alpha6beta1 and cell surface heparan sulfate proteoglycans. J.
Biol. Chem. 275,24953
-24961.
Chitnis, A. and Kintner, C. (1995). Neural induction and neurogenesis in amphibian embryos. Perspect. Dev. Neurobiol. 3,3 -15.[Medline]
Christian, J. L., McMahon, J. A., McMahon, A. P. and Moon, R.
T. (1991). Xwnt-8, a Xenopus Wnt-1/int-1-related
gene responsive to mesoderm-inducing growth factors, may play a role in
ventral mesodermal patterning during embryogenesis.
Development 111,1045
-1055.
Cooke, J., Smith, J. C., Smith, E. J. and Yaqoob, M.
(1987). The organization of mesodermal pattern in Xenopus
laevis: experiments using a Xenopus mesoderm-inducing factor.
Development 101,893
-908.
Davidson, G., Mao, B., Del Barco Barrantes, I. and Niehrs, C. (2002). Kremen proteins interact with Dickkopf1 to regulate anteroposterior CNS patterning. Development 129,5587 -5596.
Deardorff, M. A. and Klein, P. S. (1999). Xenopus frizzled-2 is expressed highly in the developing eye, otic vesicle and somites. Mech. Dev. 87,229 -233.[CrossRef][Medline]
Deardorff, M. A., Tan, C., Saint-Jeannet, J. P. and Klein, P.
S. (2001). A role for frizzled 3 in neural crest development.
Development 128,3655
-3663.
Djiane, A., Riou, J., Umbhauer, M., Boucaut, J. and Shi, D. (2000). Role of frizzled 7 in the regulation of convergent extension movements during gastrulation in Xenopus laevis.Development 127,3091 -3100.[Abstract]
Domingos, P. M., Itasaki, N., Jones, C. M., Mercurio, S., Sargent, M. G., Smith, J. C. and Krumlauf, R. (2001). The Wnt/beta-catenin pathway posteriorizes neural tissue in Xenopus by an indirect mechanism requiring FGF signalling. Dev. Biol. 239,148 -160.[CrossRef][Medline]
Garcia-Castro, M. I., Marcelle, C. and Bronner-Fraser, M.
(2002). Ectodermal Wnt function as a neural crest inducer.
Science 297,848
-851.
Glinka, A., Wu, W., Delius, H., Monaghan, A. P., Blumenstock, C. and Niehrs, C. (1998). Dickkopf-1 is a member of a new family of secreted proteins and functions in head induction. Nature 391,357 -362.[CrossRef][Medline]
Gong, Y., Slee, R. B., Fukai, N., Rawadi, G., Roman-Roman, S., Reginato, A. M., Wang, H., Cundy, T., Glorieux, F. H., Lev, D. et al. (2001). LDL receptor-related protein 5 (LRP5) affects bone accrual and eye development. Cell 107,513 -523.[CrossRef][Medline]
Harland, R. M. (1991). In Situ Hybridization: An Improved Whole-mount Method For Xenopus Embryos. San Diego, CA: Academic Press.
Hemmati-Brivanlou, A. and Melton, D. (1994). Inhibition of activin receptor signalling promotes neuralization in Xenopus. Cell 77,273 -281.[CrossRef][Medline]
Hirsch, N. and Harris, W. A. (1997). Xenopus Pax-6 and retinal development. J. Neurobiol. 32,45 -61.[CrossRef][Medline]
Hoppler, S., Brown, J. D. and Moon, R. T.
(1996). Expression of a dominant-negative Wnt blocks induction of
MyoD in Xenopus embryos. Genes Dev.
10,2805
-2817.
Houston, D. W. and Wylie, C. (2002). Cloning and expression of Xenopus Lrp5 and Lrp6 genes. Mech. Dev. 117,337 -342.[CrossRef][Medline]
Hsieh, J. C., Kodjabachian, L., Rebbert, M. L., Rattner, A., Smallwood, P. M., Samos, C. H., Nusse, R., Dawid, I. B. and Nathans, J. (1999a). A new secreted protein that binds to Wnt proteins and inhibits their activities. Nature 398,431 -436.[CrossRef][Medline]
Hsieh, J. C., Rattner, A., Smallwood, P. M. and Nathans, J.
(1999b). Biochemical characterization of Wnt-frizzled
interactions using a soluble, biologically active vertebrate Wnt protein.
Proc. Natl. Acad. Sci. USA
96,3546
-3551.
Inoki, I., Shiomi, T., Hashimoto, G., Enomoto, H., Nakamura, H.,
Makino, K., Ikeda, E., Takata, S., Kobayashi, K. and Okada, Y.
(2002). Connective tissue growth factor binds vascular
endothelial growth factor (VEGF) and inhibits VEGF-induced angiogenesis.
FASEB J. 16,219
-221.
Itasaki, N., Jones, C. M., Mercurio, S., Rowe, A., Domingos, P.
M., Smith, J. C. and Krumlauf, R. (2003). Wise, a
context-dependent activator or inhibitor of Wnt signalling.
Development 130,4295
-4305.
Itoh, K., Tang, T. L., Neel, B. G. and Sokol, S. Y. (1995). Specific modulation of ectodermal cell fates in Xenopus embryos by glycogen synthase kinase. Development 121,3979 -3988.[Abstract]
Ivkovic, S., Yoon, B. S., Popoff, S. N., Safadi, F. F., Libuda,
D. E., Stephenson, R. C., Daluiski, A. and Lyons, K. M.
(2003). Connective tissue growth factor coordinates
chondrogenesis and angiogenesis during skeletal development.
Development 130,2779
-2791.
Jedsadayanmata, A., Chen, C. C., Kireeva, M. L., Lau, L. F. and
Lam, S. C. (1999). Activation-dependent adhesion of human
platelets to Cyr61 and Fisp12/mouse connective tissue growth factor is
mediated through integrin alpha(IIb)beta(3). J. Biol.
Chem. 274,24321
-24327.
Kato, M., Patel, M. S., Levasseur, R., Lobov, I., Chang, B. H.,
Glass, D. A., 2nd, Hartmann, C., Li, L., Hwang, T. H., Brayton, C. F. et
al. (2002). Cbfa1-independent decrease in osteoblast
proliferation, osteopenia, and persistent embryonic eye vascularization in
mice deficient in Lrp5, a Wnt coreceptor. J. Cell
Biol. 157,303
-314.
Kawano, Y. and Kypta, R. (2003). Secreted
antagonists of the Wnt signalling pathway. J. Cell
Sci. 116,2627
-2634.
Kireeva, M. L., Latinkic, B. V., Kolesnikova, T. V., Chen, C. C., Yang, G. P., Abler, A. S. and Lau, L. F. (1997). Cyr61 and Fisp12 are both ECM-associated signaling molecules: activities, metabolism, and localization during development. Exp. Cell Res. 233,63 -77.[CrossRef][Medline]
Korinek, V., Barker, N., Willert, K., Molenaar, M., Roose, J.,
Wagenaar, G., Markman, M., Lamers, W., Destree, O. and Clevers, H.
(1998). Two members of the Tcf family implicated in
Wnt/beta-catenin signaling during embryogenesis in the mouse. Mol.
Cell. Biol. 18,1248
-1256.
Koyano, S., Ito, M., Takamatsu, N., Takiguchi, S. and Shiba, T. (1997). The Xenopus Sox3 gene expressed in oocytes of early stages. Gene 188,101 -107.[CrossRef][Medline]
Latinkic, B. V., Mercurio, S., Bennett, B., Hirst, E. M. A., Xu,
Q., Lau, L. F., Mohun, T. J. and Smith, J. C. (2003).
Xenopus Cyr61 regulates gastrulation movements and modulates Wnt
signalling. Development
130,2429
-2441.
Lau, L. F. and Lam, S. C. (1999). The CCN family of angiogenic regulators: the integrin connection. Exp. Cell Res. 248,44 -57.[CrossRef][Medline]
Leyns, L., Bouwmeester, T., Kim, S. H., Piccolo, S. and De Robertis, E. M. (1997). Frzb-1 is a secreted antagonist of Wnt signalling expressed in the Spemann organizer. Cell 88,747 -756.[CrossRef][Medline]
Lin, X. and Perrimon, N. (1999). Dally cooperates with Drosophila Frizzled 2 to transduce Wingless signalling. Nature 400,281 -284.[CrossRef][Medline]
Little, R. D., Carulli, J. P., Del Mastro, R. G., Dupuis, J., Osborne, M., Folz, C., Manning, S. P., Swain, P. M., Zhao, S. C., Eustace, B. et al. (2002). A mutation in the LDL receptor-related protein 5 gene results in the autosomal dominant high-bone-mass trait. Am. J. Hum. Genet. 70,11 -19.[CrossRef][Medline]
Liu, G., Bafico, A., Harris, V. K. and Aaronson, S. A.
(2003). A novel mechanism for Wnt activation of canonical
signaling through the LRP6 receptor. Mol. Cell. Biol.
23,5825
-5835.
Mao, B., Wu, W., Davidson, G., Marhold, J., Li, M., Mechler, B. M., Delius, H., Hoppe, D., Stannek, P., Walter, C. et al. (2002). Kremen proteins are Dickkopf receptors that regulate Wnt/beta-catenin signalling. Nature 417,664 -667.[CrossRef][Medline]
Mao, B., Wu, W., Li, Y., Hoppe, D., Stannek, P., Glinka, A. and Niehrs, C. (2001). LDL-receptor-related protein 6 is a receptor for Dickkopf proteins. Nature 411,321 -325.[CrossRef][Medline]
Marsden, M. and DeSimone, D. W. (2001). Regulation of cell polarity, radial intercalation and epiboly in Xenopus: novel roles for integrin and fibronectin. Development 128,3635 -3647.
Mason, E. D., Konrad, K. D., Webb, C. D. and Marsh, J. L.
(1994). Dorsal midline fate in Drosophila embryos
requires twisted gastrulation, a gene encoding a secreted protein related to
human connective tissue growth factor. Genes Dev.
8,1489
-1501.
Mayor, R., Morgan, R. and Sargent, M. G. (1995). Induction of the prospective neural crest of Xenopus.Development 121,767 -777.[Abstract]
McGrew, L. L., Otte, A. P. and Moon, R. T. (1992). Analysis of Xwnt-4 in embryos of Xenopus laevis: a Wnt family member expressed in the brain and floor plate. Development 115,463 -473.[Abstract]
McKendry, R., Hsu, S. C., Harland, R. M. and Grosschedl, R. (1997). LEF-1/TCF proteins mediate wnt-inducible transcription from the Xenopus nodal-related 3 promoter. Dev. Biol. 192,420 -431.[CrossRef][Medline]
Moussad, E. E. and Brigstock, D. R. (2000). Connective tissue growth factor: what's in a name? Mol. Genet. Metab. 71,276 -292.[CrossRef][Medline]
Nieuwkoop, P. D. and Faber, J. (1975).Normal Table of Xenopus laevis (Daudin) . Amsterdam: North Holland.
Oelgeschlager, M., Larrain, J., Geissert, D. and De Robertis, E. M. (2000). The evolutionarily conserved BMP-binding protein Twisted gastrulation promotes BMP signalling. Nature 405,757 -762.[CrossRef][Medline]
Ohkawara, B., Yamamoto, T. S., Tada, M. and Ueno, N.
(2003). Role of glypican 4 in the regulation of convergent
extension movements during gastrulation in Xenopus laevis.Development 130,2129
-2138.
Pannese, M., Polo, C., Andreazzoli, M., Vignali, R., Kablar, B., Barsacchi, G. and Boncinelli, E. (1995). The Xenopus homologue of Otx2 is a maternal homeobox gene that demarcates and specifies anterior body regions. Development 121,707 -720.[Abstract]
Penzel, R., Oschwald, R., Chen, Y., Tacke, L. and Grunz, H. (1997). Characterization and early embryonic expression of a neural specific transcription factor xSOX3 in Xenopus laevis. Int. J. Dev. Biol. 41,667 -677.[Medline]
Penzo-Mendez, A., Umbhauer, M., Djiane, A., Boucaut, J. C. and Riou, J. F. (2003). Activation of Gbetagamma signaling downstream of Wnt-11/Xfz7 regulates Cdc42 activity during Xenopus gastrulation. Dev. Biol. 257,302 -314.[CrossRef][Medline]
Perbal, B. (2001). NOV (nephroblastoma
overexpressed) and the CCN family of genes: structural and functional issues.
Mol. Pathol. 54,57
-79.
Piccolo, S., Agius, E., Leyns, L., Bhattacharyya, S., Grunz, H., Bouwmeester, T. and De Robertis, E. M. (1999). The head inducer Cerberus is a multifunctional antagonist of Nodal, BMP and Wnt signals. Nature 397,707 -710.[CrossRef][Medline]
Pierce, S. B. and Kimelman, D. (1996). Overexpression of Xgsk-3 disrupts anterior ectodermal patterning in Xenopus. Dev. Biol. 175,256 -264.[CrossRef][Medline]
Rothberg, J. M., Jacobs, J. R., Goodman, C. S. and
Artavanis-Tsakonas, S. (1990). slit: an extracellular protein
necessary for development of midline glia and commissural axon pathways
contains both EGF and LRR. Genes Dev.
4,2169
-2187.
Sasai, Y., Lu, B., Steinbeisser, H., Geissert, D., Gont, L. K. and De Robertis, E. M. (1994). Xenopus chordin: a novel dorsalizing factor activated by organizer-specific homeobox genes. Cell 79,779 -790.[CrossRef][Medline]
Schlunegger, M. P. and Grutter, M. G. (1993). Refined crystal structure of human transforming growth factor beta 2 at 1.95 A resolution. J. Mol. Biol. 231,445 -458.[CrossRef][Medline]
Segarini, P. R., Nesbitt, J. E., Li, D., Hays, L. G., Yates, J.
R., 3rd and Carmichael, D. F. (2001). The low density
lipoprotein receptor-related protein/alpha2-macroglobulin receptor is a
receptor for connective tissue growth factor. J. Biol.
Chem. 276,40659
-40667.
Semenov, M. V., Tamai, K., Brott, B. K., Kuhl, M., Sokol, S. and He, X. (2001). Head inducer Dickkopf-1 is a ligand for Wnt coreceptor LRP6. Curr. Biol. 11,951 -961.[CrossRef][Medline]
Slack, J. M. W. (1984). Regional biosynthetic markers in the early amphibian embryo. J. Embryol. Exp. Morphol. 80,289 -319.[Medline]
Smith, J. C. (1993). Purifying and assaying mesoderm-inducing factors from vertebrate embryos. In Cellular Interactions in Development A Practical Approach, pp.181 -204. Oxford: IRL Press.
Smith, W. C. and Harland, R. M. (1991). Injected Xwnt-8 RNA acts early in Xenopus embryos to promote formation of a vegetal dorsalizing center. Cell 67,753 -765.[CrossRef][Medline]
Sokol, S. (1996). Analysis of Dishevelled signalling pathways during Xenopus development. Curr. Biol. 6,1456 -1467.[CrossRef][Medline]
Sokol, S., Christian, J. L., Moon, R. T. and Melton, D. A. (1991). Injected Wnt RNA induces a complete body axis in Xenopus embryos. Cell 67,741 -752.[CrossRef][Medline]
Tada, M., Casey, E., Fairclough, L. and Smith, J. C. (1998). Bix1, a direct target of Xenopus T-box genes, causes formation of ventral mesoderm and endoderm. Development 125,3997 -4006.[Abstract]
Tada, M., Concha, M. L. and Heisenberg, C. P. (2002). Non-canonical Wnt signalling and regulation of gastrulation movements. Semin. Cell Dev. Biol. 13,251 -260.[CrossRef][Medline]
Tada, M. and Smith, J. C. (2000). Xwnt11 is a target of Xenopus Brachyury: regulation of gastrulation movements via Dishevelled, but not through the canonical Wnt pathway. Development 127,2227 -2238.[Abstract]
Tamai, K., Semenov, M., Kato, Y., Spokony, R., Liu, C., Katsuyama, Y., Hess, F., Saint-Jeannet, J. P. and He, X. (2000). LDL-receptor-related proteins in Wnt signal transduction. Nature 407,530 -535.[CrossRef][Medline]
Theze, N., Hardy, S., Wilson, R., Allo, M. R., Mohun, T. and Thiebaud, P. (1995). The MLC1f/3f gene is an early marker of somitic muscle differentiation in Xenopus laevis embryo. Dev. Biol. 171,352 -362.[CrossRef][Medline]
Tsuda, M., Kamimura, K., Nakato, H., Archer, M., Staatz, W., Fox, B., Humphrey, M., Olson, S., Futch, T., Kaluza, V. et al. (1999). The cell-surface proteoglycan Dally regulates Wingless signalling in Drosophila. Nature 400,276 -280.[CrossRef][Medline]
Ungar, A. R., Kelly, G. M. and Moon, R. T. (1995). Wnt4 affects morphogenesis when misexpressed in the zebrafish embryo. Mech. Dev. 52,153 -164.[CrossRef][Medline]
Veeman, M. T., Axelrod, J. D. and Moon, R. T. (2003a). A second canon. Functions and mechanisms of beta-catenin-independent Wnt signaling. Dev. Cell 5, 367-377.[CrossRef][Medline]
Veeman, M. T., Slusarski, D. C., Kaykas, A., Louie, S. H. and Moon, R. T. (2003b). Zebrafish prickle, a modulator of noncanonical wnt/fz signaling, regulates gastrulation movements. Curr. Biol. 13,680 -685.[CrossRef][Medline]
Vitt, U. A., Hsu, S. Y. and Hsueh, A. J.
(2001). Evolution and classification of cystine knot-containing
hormones and related extracellular signaling molecules. Mol.
Endocrinol. 15,681
-694.
Wang, S., Krinks, M., Lin, K., Luyten, F. P. and Moos, M. J. (1997). Frzb, a secreted protein expressed in the Spemann organizer, binds and inhibits Wnt8. Cell 88,757 -766.[CrossRef][Medline]
Wilson, P. A. and Melton, D. A. (1994). Mesodermal patterning by an inducer gradient depends on secondary cell-cell communication. Curr. Biol. 4, 676-686.[CrossRef][Medline]
Wodarz, A. and Nusse, R. (1998). Mechanisms of Wnt signaling in development. Annu. Rev. Cell Dev. Biol. 14,59 -88.[CrossRef][Medline]
Wu, J., Saint-Jeannet, J. P. and Klein, P. S. (2003). Wnt-frizzled signaling in neural crest formation. Trends Neurosci. 26,40 -45.[CrossRef][Medline]
Xu, Q., D'Amore, P. A. and Sokol, S. Y. (1998). Functional and biochemical interactions of Wnts with FrzA, a secreted Wnt antagonist. Development 125,4767 -4776.[Abstract]
Zygar, C. A., Cook, T. L. and Grainger, R. M. (1998). Gene activation during early stages of lens induction in Xenopus. Development 125,3509 -3519.[Abstract]
This article has been cited by other articles:
![]() |
L. A. Crawford, M. A. Guney, Y. A. Oh, R. A. DeYoung, D. M. Valenzuela, A. J. Murphy, G. D. Yancopoulos, K. M. Lyons, D. R. Brigstock, A. Economides, et al. Connective Tissue Growth Factor (CTGF) Inactivation Leads to Defects in Islet Cell Lineage Allocation and {beta}-Cell Proliferation during Embryogenesis Mol. Endocrinol., March 1, 2009; 23(3): 324 - 336. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Smerdel-Ramoya, S. Zanotti, L. Stadmeyer, D. Durant, and E. Canalis Skeletal Overexpression of Connective Tissue Growth Factor Impairs Bone Formation and Causes Osteopenia Endocrinology, September 1, 2008; 149(9): 4374 - 4381. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Smerdel-Ramoya, S. Zanotti, V. Deregowski, and E. Canalis Connective Tissue Growth Factor Enhances Osteoblastogenesis in Vitro J. Biol. Chem., August 15, 2008; 283(33): 22690 - 22699. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Hoek, O. M. Eichhoff, N. C. Schlegel, U. Dobbeling, N. Kobert, L. Schaerer, S. Hemmi, and R. Dummer In vivo Switching of Human Melanoma Cells between Proliferative and Invasive States Cancer Res., February 1, 2008; 68(3): 650 - 656. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Rydziel, L. Stadmeyer, S. Zanotti, D. Durant, A. Smerdel-Ramoya, and E. Canalis Nephroblastoma Overexpressed (Nov) Inhibits Osteoblastogenesis and Causes Osteopenia J. Biol. Chem., July 6, 2007; 282(27): 19762 - 19772. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Sala-Torra, H. M. Gundacker, D. L. Stirewalt, P. A. Ladne, E. L. Pogosova-Agadjanyan, M. L. Slovak, C. L. Willman, S. Heimfeld, D. H. Boldt, and J. P. Radich Connective tissue growth factor (CTGF) expression and outcome in adult patients with acute lymphoblastic leukemia Blood, April 1, 2007; 109(7): 3080 - 3083. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Clines, K. S. Mohammad, Y. Bao, O. W. Stephens, L. J. Suva, J. D. Shaughnessy Jr., J. W. Fox, J. M. Chirgwin, and T. A. Guise Dickkopf Homolog 1 Mediates Endothelin-1-Stimulated New Bone Formation Mol. Endocrinol., February 1, 2007; 21(2): 486 - 498. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Leask and D. J. Abraham All in the CCN family: essential matricellular signaling modulators emerge from the bunker J. Cell Sci., December 1, 2006; 119(23): 4803 - 4810. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Crean, F. Furlong, D. Mitchell, E. McArdle, C. Godson, and F. Martin Connective tissue growth factor/CCN2 stimulates actin disassembly through Akt/protein kinase B-mediated phosphorylation and cytoplasmic translocation of p27Kip-1 FASEB J, August 1, 2006; 20(10): 1712 - 1714. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Chien, D. Yin, D. Gui, A. Mori, J. M. Frank, J. Said, D. Kusuanco, A. Marchevsky, R. McKenna, and H. P. Koeffler Suppression of Cell Proliferation and Signaling Transduction by Connective Tissue Growth Factor in Non-Small Cell Lung Cancer Cells Mol. Cancer Res., August 1, 2006; 4(8): 591 - 598. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Dornhofer, S. Spong, K. Bennewith, A. Salim, S. Klaus, N. Kambham, C. Wong, F. Kaper, P. Sutphin, R. Nacalumi, et al. Connective Tissue Growth Factor-Specific Monoclonal Antibody Therapy Inhibits Pancreatic Tumor Growth and Metastasis Cancer Res., June 1, 2006; 66(11): 5816 - 5827. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-S. Nam, T. J. Turcotte, P. F. Smith, S. Choi, and J. K. Yoon Mouse Cristin/R-spondin Family Proteins Are Novel Ligands for the Frizzled 8 and LRP6 Receptors and Activate beta-Catenin-dependent Gene Expression J. Biol. Chem., May 12, 2006; 281(19): 13247 - 13257. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, J. Chen, W. Lu, L. M. McCormick, J. Wang, and G. Bu Mesd binds to mature LDL-receptor-related protein-6 and antagonizes ligand binding J. Cell Sci., November 15, 2005; 118(22): 5305 - 5314. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Gazzerro, V. Deregowski, S. Vaira, and E. Canalis Overexpression of Twisted Gastrulation Inhibits Bone Morphogenetic Protein Action and Prevents Osteoblast Cell Differentiation in Vitro Endocrinology, September 1, 2005; 146(9): 3875 - 3882. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Ben-Shlomo and A. J. W. Hsueh Three's Company: Two or More Unrelated Receptors Pair with the Same Ligand Mol. Endocrinol., May 1, 2005; 19(5): 1097 - 1109. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Luo, Q. Kang, W. Si, W. Jiang, J. K. Park, Y. Peng, X. Li, H. H. Luu, J. Luo, A. G. Montag, et al. Connective Tissue Growth Factor (CTGF) Is Regulated by Wnt and Bone Morphogenetic Proteins Signaling in Osteoblast Differentiation of Mesenchymal Stem Cells J. Biol. Chem., December 31, 2004; 279(53): 55958 - 55968. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wang, N. Adhikari, Q. Li, and J. L. Hall LDL receptor-related protein LRP6 regulates proliferation and survival through the Wnt cascade in vascular smooth muscle cells Am J Physiol Heart Circ Physiol, December 1, 2004; 287(6): H2376 - H2383. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||