spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online April 22, 2004
doi: 10.1242/10.1242/dev.01045


Development 131, 2137-2147 (2004)
Published by The Company of Biologists 2004


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mercurio, S.
Right arrow Articles by Smith, J. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mercurio, S.
Right arrow Articles by Smith, J. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Connective-tissue growth factor modulates WNT signalling and interacts with the WNT receptor complex

Sara Mercurio1,*, Branko Latinkic1,{dagger}, Nobue Itasaki2, Robb Krumlauf2,{ddagger} and J. C. Smith1,*,§

1 Division of Developmental Biology, National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, UK
2 Division of Developmental Neurobiology, National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, UK

§ Author for correspondence (e-mail: jim{at}welc.cam.ac.uk)

Accepted 17 December 2003


    SUMMARY
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Connective-tissue growth factor (CTGF) is a member of the CCN family of secreted proteins. CCN family members contain four characteristic domains and exhibit multiple activities: they associate with the extracellular matrix, they can mediate cell adhesion, cell migration and chemotaxis, and they can modulate the activities of peptide growth factors. Many of the effects of CTGF are thought to be mediated by binding to integrins, whereas others may be because of its recently identified ability to interact with BMP4 and TGFß. We demonstrate, using Xenopus embryos, that CTGF also regulates signalling through the Wnt pathway, in accord with its ability to bind to the Wnt co-receptor LDL receptor-related protein 6 (LRP6). This interaction is likely to occur through the C-terminal (CT) domain of CTGF, which is distinct from the BMP- and TGFß-interacting domain. Our results define new activities of CTGF and add to the variety of routes through which cells regulate growth factor activity in development, disease and tissue homeostasis.

Key words: Xenopus, CTGF, CCN family, Wnt signalling, LRP6


    Introduction
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
The control of cell division, cell differentiation and morphogenesis during embryonic development requires the coordinated regulation of a variety of extracellular signals. In Xenopus, for example, head formation requires the suppression of nodal, BMP and WNT signalling and this is achieved in part by the secreted protein Cerberus (Piccolo et al., 1999Go). Connective tissue growth factor (CTGF) is a member of the CCN family of secreted proteins, of which CTGF itself, Cyr61 and Nov are the founder members (Bork, 1993Go; Moussad and Brigstock, 2000Go; Perbal, 2001Go). CCN family members contain four characteristic domains encoded by separate exons and, like Cerberus, they exhibit multiple activities: they associate with the extracellular matrix, they can mediate cell adhesion, cell migration and chemotaxis (Babic et al., 1999Go; Chen et al., 2001Go; Jedsadayanmata et al., 1999Go; Lau and Lam, 1999Go), and they can modulate the activities of peptide growth factors (Abreu et al., 2002Go; Inoki et al., 2002Go). Disruption of the Ctgf gene in the mouse embryo indicates that CTGF is required for the coordination of chondrogenesis and angiogenesis during the development of the skeleton (Ivkovic et al., 2003Go).

The four domains of CTGF resemble those found in other secreted proteins (Bork, 1993Go). Domain 1 exhibits homology with the N-terminal region of the low-molecular-weight insulin-like growth factor binding proteins (IGFBPs) and with Twisted gastrulation (Tsg), which modulates signalling by BMP family members (Chang et al., 2001Go; Mason et al., 1994Go; Oelgeschlager et al., 2000Go). Domain 2 includes a von Willebrand factor type C repeat (VWC), and also displays similarities with the cysteine repeats in the BMP antagonist Short gastrulation (Sog)/Chordin (Abreu et al., 2002Go; Sasai et al., 1994Go). Domain 3 has homology with the thrombospondin type 1 repeat superfamily of ECM associated proteins (Adams, 2001Go). Finally, domain 4, or the C-terminal (CT) domain, shows similarity to the C terminus of Slit, a protein involved in axon guidance and cell migration (Bork, 1993Go; Brose and Tessier-Lavigne, 2000Go; Rothberg et al., 1990Go). This domain contains a cystine knot structure, which is also present in growth factors including the TGFß superfamily, platelet derived growth factor (PDGF) and nerve growth factors (NGFs). It is believed to mediate protein-protein interactions or dimerisation (Bork, 1993Go; Schlunegger and Grutter, 1993Go; Vitt et al., 2001Go). The same motif is found in Wise (WNT modulator in surface ectoderm), a recently identified modulator of WNT signalling (Itasaki et al., 2003Go). A comparison of the CT domains of CTGF and of Cyr61, Slit and Wise is shown in Fig. 1A.



View larger version (54K):
[in this window]
[in a new window]
 
Fig. 1. CTGF and its expression pattern. (A) Schematic representation of the domain structure of CTGF. Shown below is an alignment of the CT domains of xCTGF, XCyr61, XSlit and XWiseA. The eight conserved cysteines are indicated by a dot and amino acids conserved in at least three out of the four proteins are shaded grey. The CT domain of xCTGF shows 52% amino acid identity with XCyr61, 27% with Xslit, and 19% with XWiseA. (B) Temporal expression pattern of Ctgf studied by reverse transcription-polymerase chain reaction. Stages are according to Nieuwkoop and Faber (Nieuwkoop and Faber, 1975Go). Ornithine decarboxylase (ODC) acts as a loading control. Note the absence of maternal expression of CTGF. (C-H) In situ hybridisation analysis of CTGF expression. (C) Stage 20. Expression is detectable in the somites and axial midline. (D) Stage 25. Expression persists in somites and axial midline. (E) Stage 28. Expression is detectable in brain and branchial arches. (F) Stage 32. CTGF is expressed in the heart, in distinct domains in the brain, in the floorplate and in the hypochord. (G,H) Sections through a stage 32 embryo confirm expression of Ctgf in floorplate, heart and somites. CT, C-terminal cystine knot; IGFB, Insulin growth factor binding domain; Signal, signal peptide; TSP-1, thromospondin type 1 repeat; CR, Von Willebrand type C repeat.

 
Many of the effects of CTGF arise through its ability to bind integrins (Lau and Lam, 1999Go) or to modulate signalling by transforming growth factor type ß (TGFß) and bone morphogenetic proteins (BMPs) (Abreu et al., 2002Go), but it is likely that this multi-domain protein has other activities, and indeed it is known that CTGF binds to the low density lipoprotein receptor-related protein/{alpha}2-macroglobulin receptor (Segarini et al., 2001Go). We show, using Xenopus embryos, that CTGF regulates signalling through the WNT pathway, probably because of its ability to bind to the WNT co-receptor LRP6. This interaction involves the CT domain of CTGF, which is distinct from the TGFß and BMP-interacting domain. This observation defines new activities of CTGF and adds to the variety of routes through which cells might regulate growth factor activity in development, disease and tissue homeostasis.


    Materials and methods
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Embryo manipulations and RT-PCR
Embryos of Xenopus laevis were obtained as described (Smith, 1993Go). They were staged according to Nieuwkoop and Faber (Nieuwkoop and Faber, 1975Go) and cultured in 10% Normal Amphibian Medium (NAM) (Slack, 1984Go). Microinjections were performed in 75% NAM containing 4% Ficoll. For animal cap assays, embryos at the two-cell stage were injected into both blastomeres at the animal pole. Animal caps were dissected at late blastula stage 8-9 and cultured until the relevant stage. To examine the effects of CTGF on early development, embryos were injected with Ctgf RNA in the animal pole of one or both blastomeres. They were cultured in 75% NAM until the late blastula stage and subsequently in 10% NAM. When necessary, animal caps were treated with partially purified activin at a concentration of 8 units/ml (Cooke et al., 1987Go). Dorsal marginal zone regions were dissected at early gastrula stage 10 from embryos previously injected in the marginal zone with 1.0 or 2.5 ng Ctgf RNA. They were cultured until sibling embryos reached neurula stage 15.

Ctgf and Ctgf{Delta}CT RNA were transcribed from the plasmids pSP64T-CTGF and pSP64T-CTGF{Delta}CT (see below). Plasmids were linearised with XbaI and transcribed with SP6 RNA polymerase. RNA encoding Xwnt8 or Dsh was transcribed as described (Christian et al., 1991Go; Sokol, 1996Go).

Reverse transcription-polymerase chain reaction (RT-PCR) analysis was performed as described (Wilson and Melton, 1994Go). Primers for EF1{alpha}, Muscle-specific actin, N-CAM, Xnr3 and Siamois were as described (Domingos et al., 2001Go; Hemmati-Brivanlou and Melton, 1994Go). Ctgf primers were 5' CTC CTC ACA GAA CCG CTA CC 3' (upstream) and 5' GGC TTG TTT TGT GCC AAT TT 3' (downstream).

Antisense morpholino oligonucleotides
An antisense morpholino oligonucleotide with the sequence 5' GTACAGCAGCAGATTAGTTCTCTTC 3', designed to inhibit translation of Xenopus CTGF, was purchased from GeneTools.

Expression constructs
To create constructs for expression in Xenopus embryos, Ctgf was cloned by PCR from stage 25 Xenopus embryo cDNA using primers designed against the Ctgf open reading frame (GenBank accession number U43524). The upstream primer was 5' GCT AGA TCT ATG TCT GCA GGA AAA GTG ACA GC 3', which corresponds to the first ATG (bold) and includes a BglII site (underlined). The downstream primer was 5' CAG TCT CGA GTG CTA TGT CTC CAT ACA TTT TCC G 3', which includes a stop codon (bold) and an XhoI site (underlined). The resulting fragments were cloned into a modified form of pSP64T (Tada et al., 1998Go). An alternative version of pSP64T-CTGF, which included 18 extra amino acids at its C-terminus, was used in some experiments. Similar results were obtained with both constructs. Ctgf{Delta}CT was cloned using the same upstream primer and a downstream primer that included an XhoI site (underlined) and a stop codon (bold). Its sequence was 5' G GGC CTC GAG TTA TTC ACA GGG CCT GAC CAT GC 3'. The resulting fragment was cloned into pSP64T (Tada et al., 1998Go) to create pSP64T-CTGF{Delta}CT.

For expression of constructs in mammalian cells, IgG (Hsieh et al., 1999bGo), Frizzled8CRD-IgG (Hsieh et al., 1999bGo), LRP6N-IgG (Tamai et al., 2000Go) and DKK1-Flag (Mao et al., 2001Go) were as described. LRP6N{Delta}1,2-IgG and LRP6N{Delta}3,4-IgG, which lack EGF repeats 1 and 2 or 3 and 4, respectively, were generated by PCR as described previously (Itasaki et al., 2003Go; Mao et al., 2001Go). For expression in S2 insect cells, Ctgf and Ctgf{Delta}CT cDNAs were cloned into pMT/V5-HisB (Invitrogen) and the proteins were HA tagged at their C-termini, creating pMT/CTGF-HA and pMT/CTGF{Delta}CT-HA.

In situ hybridization and X-gal staining
Embryos were fixed and processed for in situ hybridization essentially as described (Harland, 1991Go). Minor modifications included the use of BM purple (Boehringer Mannheim) as substrate. Sense and antisense Ctgf probes were made from a 700 base pair cDNA that includes the 3' untranslated region. Other probes were Xsox3 (Koyano et al., 1997Go), N-tubulin (Chitnis and Kintner, 1995Go), Slug (Mayor et al., 1995Go), MLC1 (Theze et al., 1995Go), Pax6 (Hirsch and Harris, 1997Go) and Otx2 (Pannese et al., 1995Go).

For X-gal staining, fixed embryos were rinsed several times in PBS containing 0.1% Tween 20 (PBST), washed for 5 minutes in developing solution [7.2 mM Na2HPO4, 2.8 mM NaH2PO4, 150 mM NaCl, 0.1% Tween 20, 1 mM MgCl2, 3 mM K3Fe(CN)6, 3 mM K4Fe(CN)6, pH 7.2] and transferred to fresh developing solution containing 0.027% X-gal for approximately 20 minutes at room temperature until adequate blue staining was achieved. They were then washed in PBST and stored in 100% methanol at –20°C until processed for in situ hybridisation.

Luciferase assays for TOPFLASH reporter activity
To measure the ability of CTGF and CTGF{Delta}CT to inhibit Xwnt8 or Dishevelled activation of a TCF-dependent reporter construct, the TOPFLASH reporter plasmid (Korinek et al., 1998Go) was injected into Xenopus embryos together with pRLTK (Promega) as a reference plasmid, and with RNA encoding Xwnt8 or Dishevelled, either alone or in combination with RNA encoding CTGF or CTGF{Delta}CT.

Luciferase activity was detected using the Promega Dual Luciferase Kit. Twenty animal caps were lysed in 200 µl of Passive Lysis Buffer (Promega) and 5 µl was assayed for luminescence.

Immunoprecipitation
S2 cells were grown as described in the Drosophila Expression System protocol (Invitrogen) and HEK293 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% foetal calf serum. Conditioned medium containing CTGF-HA or CTGF{Delta}CT-HA was produced in S2 cells transiently transfected by the calcium phosphate method with pMT/CTGF-HA or pMT/CTGF{Delta}CT-HA. One day after transfection, cells were transferred to serum-free medium (Invitrogen) and expression of CTGF-HA and CTGF{Delta}CT-HA was induced by addition of copper sulphate to a final concentration of 500 µM. Medium was collected two days after induction and centrifuged at 20,000 g at 4°C for 30 minutes. Conditioned medium containing Frizzled8CRD-IgG, LRP6N-IgG, LRP6N{Delta}1,2-IgG, LRP6N{Delta}3,4-IgG or IgG was obtained from HEK293 cells (Hsieh et al., 1999bGo; Tamai et al., 2000Go) transiently transfected with the appropriate constructs using the Superfect transfection reagent (Qiagen) as described in the manufacturer's instructions. Cells were transferred to serum-free medium (Optimem, Gibco) one day after transfection and conditioned medium was collected 48 hours later.

Media were concentrated by ultrafiltration, combined as appropriate, and adjusted to the same volume by addition of control medium derived from untransfected cells. Mixtures were incubated overnight at 4°C and Protein A Sepharose beads were then added for 2 hours at 4°C. The beads were pelleted by centrifugation and, for low stringency experiments, were washed 5-6 times over 30 minutes in a buffer containing 150 mM NaCl, 50 mM Tris-HCl pH 7.5, 0.1% Triton X-100 and proteinase inhibitors. High stringency conditions involved an additional 3 washes in high stringency wash buffer (0.5 M NaCl, 50 mM Tris-HCl pH 7.5, 0.1% Triton X-100, 0.1% NP40, proteinase inhibitors). Unless otherwise indicated, experiments used high stringency conditions. Bound protein was eluted by boiling in SDS-sample buffer. Proteins were subjected to SDS-polyacrylamide gel electrophoresis and immunoblotted with the following antibodies according to the manufacturer's instructions: anti-IgG-HRP (Sigma), anti-HA-HRP (Roche) and anti-Flag-HRP (Sigma). The ECL+ detection technique (Amersham) was used for detection.


    Results
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Expression of CTGF
Ctgf transcripts in the Xenopus embryo are first detectable by the RT-PCR technique at the early neurula stage (Fig. 1B). Subsequently, expression is detected by in situ hybridisation in somites, floorplate, hypochord, olfactory placode and heart (Fig. 1C-H) (Abreu et al., 2002Go). Weak expression is also detectable in the pronephros (data not shown). Unlike Abreu and colleagues (Abreu et al., 2002Go), we have not been able to detect maternal expression of Ctgf, either by RT-PCR or by RNAase protection (Fig. 1B and data not shown).

Overexpression of CTGF mimics the effects of inhibiting components of the WNT signalling pathway
Injection into Xenopus embryos of an antisense morpholino oligonucleotide designed to inhibit translation of CTGF (see Materials and methods) caused no disruption of development (data not shown). A similar observation has been reported by Abreu and colleagues (Abreu et al., 2002Go). We note that mouse embryos in which the Ctgf gene is disrupted survive to birth and that mutant and wild-type embryos are indistinguishable at 12.5 days post-coitum (Ivkovic et al., 2003Go). This suggests that CTGF is essential only for later stages of development (see Discussion).

As an alternative approach to studying the function of CTGF in Xenopus, we overexpressed the protein by RNA injection at the one-cell stage. In 29% of embryos (n=55) this caused a disruption of gastrulation, whereas 56% displayed antero-posterior defects, with embryos forming a short trunk, enlarged cement gland, and reduced eyes (Fig. 2A-C). These defects were observed only rarely in embryos injected with the same amount of lacZ RNA. To characterise this phenotype in more detail, RNA encoding Xenopus CTGF, together with lacZ RNA to act as a lineage marker, was injected into one cell of Xenopus embryos at the two-cell stage, and the expression of neural and mesodermal markers was examined at neurula stages, when endogenous Ctgf is first expressed. We found that expression of Otx2, an anterior neural marker for forebrain and midbrain (Pannese et al., 1995Go), was expanded posteriorly on the injected side (Fig. 2D). Pax6, which at this stage is expressed in the prospective forebrain and in two dorso-lateral stripes that will form parts of the hindbrain (Hirsch and Harris, 1997Go), showed slight expansion of the forebrain domain, whereas the future hindbrain expression domain was decreased (Fig. 2E). These data indicate that CTGF is able to expand the territory of anterior neural structures.



View larger version (85K):
[in this window]
[in a new window]
 
Fig. 2. The effects of overexpression of CTGF resemble those caused by inhibition of WNT signalling. (A) Overexpression of CTGF (bottom embryo) causes a shortening of Xenopus embryos. Three independent experiments were performed with similar results each time. (B,C) Compared with controls (B), CTGF-injected embryos have an enlarged cement gland (C). (D-K) Unilateral overexpression of CTGF causes changes in gene expression that resemble those caused by inhibition of WNT signalling. (D) The expression domain of Otx2 is expanded. (E) CTGF causes a down-regulation of the future hindbrain domain of Pax6 and slightly expands the anterior domain. (F) CTGF causes down-regulation of N-tubulin in the neural plate. (G) The expression domain of Xsox3 in the neural plate is expanded. (H,I) Compared with the control side of the embryo (H), CTGF causes down-regulation of XSox3 in the dorsolateral placode (I). (J) CTGF causes down-regulation of Slug. (K) The muscle-specific gene myosin light chain 1 (MLC1) is down-regulated by Ctgf. I: injected; NI: Not injected. The injected sides of embryos are identified by pale blue lacZ staining.

 
Overexpression of CTGF in the neural tube decreases numbers of terminally differentiated primary neurons, as judged by reduced expression of N-tubulin (Chitnis and Kintner, 1995Go) (Fig. 2F), and this is accompanied by an expansion of the domain of expression of Xsox3, a marker of undifferentiated neurons (Penzel et al., 1997Go; Zygar et al., 1998Go) (Fig. 2G). Together, these results indicate that widespread expression of CTGF causes an expansion of the neural plate and an inhibition or delay of primary neurogenesis. We also noted that although Xsox3-positive cells are increased in the neural plate, they are reduced in the dorsolateral placode (Fig. 2H,I). CTGF also affected the production of migrating neural crest cells as revealed by reduced Slug expression (Fig. 2J).

We next examined the effect of overexpression of CTGF on axial mesoderm; Ctgf is strongly expressed in somite tissue by the late neurula stage. The skeletal muscle-specific gene myosin light chain 1 (MLC1) (Theze et al., 1995Go) is down-regulated by Ctgf (Fig. 2K). This will probably represent a delay in expression rather than a complete inhibition, because at later stages somites do form and appear relatively normal. Overall, the results described in Fig. 2 indicate that overexpression of CTGF anteriorises the neural tube, and inhibits or delays primary neurogenesis, neural crest formation and muscle development.

Some of the effects caused by overexpression of CTGF, such as the expansion of Otx2 and Xsox3, and the occasional induction of partial secondary axes (Abreu et al., 2002Go) (data not shown), may be because of inhibition of BMP signalling. We note, however, that the actions of CTGF are also reminiscent of the effects observed upon inhibition of WNT signalling. For example, dominant-negative Xwnt8 (Hoppler et al., 1996Go) and the WNT antagonist Frzb (Leyns et al., 1997Go; Wang et al., 1997Go; Xu et al., 1998Go) all cause axial shortening and a decrease in somitic muscle. In neural crest formation, WNT1, WNT3A and positive components of the WNT signalling pathway such as Frizzled3, ß-catenin and LRP6 all increase the production of neural crest cells (Wu et al., 2003Go). In contrast, inhibition of Frizzled3 function, like overexpression of CTGF (Fig. 2I), reduces Slug expression (Deardorff et al., 2001Go). Furthermore, overexpression of GSK3, a negative regulator of WNT signalling, causes enlargement of the cement gland and an impairment of eye formation (Itoh et al., 1995Go; Pierce and Kimelman, 1996Go), as does CTGF.

CTGF inhibits the effects of overexpression of XWNT8
To address more directly the question of whether CTGF affects WNT signalling, and in particular the canonical WNT signalling pathway, we first asked whether CTGF influences the induction of secondary axes in Xenopus embryos by Xwnt8 (Smith and Harland, 1991Go; Sokol et al., 1991Go). RNA encoding Xwnt8 was injected ventrally into Xenopus embryos at the 4- to 8-cell stage in the presence or absence of RNA encoding CTGF. CTGF inhibited secondary axis induction by Xwnt8 (Fig. 3A-D) and also inhibited activation of the direct WNT targets Siamois and Xnr3 (Brannon et al., 1997Go; McKendry et al., 1997Go) in ventral marginal zone tissue (Fig. 3E). Similarly, CTGF reduced activation of the TOPFLASH TCF reporter (Korinek et al., 1998Go) in Xenopus animal caps, suggesting that it interferes directly with the canonical WNT pathway (Fig. 3F).



View larger version (79K):
[in this window]
[in a new window]
 
Fig. 3. CTGF inhibits WNT signalling. (A-D) Induction of duplicated axes by Xwnt8 is inhibited by CTGF. (A) Control embryos at stage 28. (B-D) Embryos were injected at the 4-8-cell stage into one ventral-vegetal blastomere with RNA encoding CTGF alone (B), Xwnt8 alone (C), or both (D). Secondary axis induction is inhibited by CTGF. (E) CTGF inhibits induction of Xnr3 and Siamois by Xwnt8. Ventral marginal zone (VMZ) or dorsal marginal zone (DMZ) tissue was isolated from Xenopus embryos at early gastrula stage 10. Some embryos had previously been injected with RNA encoding Xwnt8 or CTGF or both, as indicated. Expression of Xnr3, Siamois or, as a loading control, ornithine decarboxylase (ODC) was assayed by RT-PCR. –RT: No reverse transcription control. (F) CTGF inhibits induction of the TOPFLASH reporter by Xwnt8. Xenopus embryos at the 2-cell-stage were injected into both blastomeres with 20 pg TOPFLASH (firefly luciferase) DNA, 10 pg pRLTK (Renilla luciferase) DNA and, where indicated, 1 ng CTGF RNA or 50 pg Xwnt8 RNA or a combination of the two. Animal caps were dissected at stage 8, and 20 caps per sample were assayed for Luciferase activities 3 hours later. Firefly luciferase activities were then normalised to Renilla activities. This experiment represents a typical result out of three independent experiments. (G-J) CTGF inhibits activin-induced elongation of animal caps. (G) Control embryo at stage 18. (H) Control animal caps at the equivalent of stage 18 remain spherical. (I) Activin-treated animal caps elongate. (J) Elongation is inhibited by overexpression of CTGF. (K-N) CTGF inhibits the elongation of isolated dorsal marginal zone regions. Dorsal marginal zone regions were isolated from control embryos (K) or from embryos injected with 1 ng (M) or 2.5 ng (N) Ctgf RNA. Ventral marginal zone regions (L) acted as controls. Explants were cultured to the equivalent of stage 15 and scored as described in Table 1. Note that CTGF causes a reduction in the elongation of dorsal marginal zone regions. (O) CTGF and CTGF{Delta}CT do not inhibit activin-induced expression of muscle-specific actin in Xenopus animal caps. Expression of muscle-specific actin and ODC was assessed by RT-PCR. –RT: No reverse transcription control.

 
CTGF and non-canonical WNT signalling
The above experiments indicate that CTGF can inhibit the canonical WNT signalling pathway involving ß-catenin. We next asked whether CTGF can also interfere with ß-catenin-independent WNT signalling. Non-canonical WNT signalling has been implicated in the regulation of gastrulation in vertebrate embryos, and it involves, at least in part, a mechanism resembling the Drosophila planar cell polarity (PCP) pathway. In Xenopus this pathway includes recently identified vertebrate homologues of Drosophila PCP genes such as Strabismus, as well as ligands such as WNT11, Frizzled receptors such as Fz7, and Dishevelled (Tada et al., 2002Go; Veeman et al., 2003aGo). Non-canonical WNT signalling also regulates gastrulation through modulation of intracellular calcium release (Veeman et al., 2003bGo), and other mediators of non-canonical WNT signalling include heterotrimeric G proteins that are thought to act upstream of Dishevelled (Penzo-Mendez et al., 2003Go).

Activin treatment of animal caps derived from control embryos causes them to elongate, in a manner resembling the convergent extension movements of gastrulation and neurulation, whereas untreated caps remain spherical (Fig. 3H,I). Interference with the WNT/planar cell polarity pathway inhibits convergent extension (Tada and Smith, 2000Go), and indeed animal caps derived from embryos overexpressing CTGF do not elongate in response to activin (Fig. 3J) and the elongation of isolated dorsal marginal zone regions is also reduced (Fig. 3K-N; Table 1). Significantly, CTGF does not inhibit muscle differentiation in activin-treated animal caps, consistent with the idea that it affects the planar polarity pathway in this assay (Fig. 3O, lanes 1-5).


View this table:
[in this window]
[in a new window]
 
Table 1. Inhibition of elongation of dorsal marginal zone tissue by CTGF

 
Together, these results suggest that CTGF can interfere with non-canonical WNT pathway as well as the canonical pathway. In this respect CTGF resembles WNT antagonists such as sFRP but differs from others such as DKK1, which does not block activin-induced elongation of animal caps (Semenov et al., 2001Go; Xu et al., 1998Go).

The ability of CTGF to modulate WNT signalling resides in the CT domain
The ability of CTGF to modulate BMP signalling resides in the second domain of the protein, which contains Chordin-like repeats (Abreu et al., 2002Go). We speculated that its ability to modulate WNT signalling resides in the fourth or CT domain. This region contains a cystine knot (Bork, 1993Go) and is a potential binding site for heparan sulphate proteoglycans (HSPGs) (Ball et al., 2003Go; Brigstock et al., 1997Go; Kireeva et al., 1997Go), which play a role in the regulation of WNT signalling (Baeg et al., 2001Go; Chen et al., 2000Go; Lin and Perrimon, 1999Go; Ohkawara et al., 2003Go; Tsuda et al., 1999Go). Consistent with this observation, we find that a deleted form of CTGF which lacks the CT domain (CTGF{Delta}CT) (Fig. 4A) cannot interfere with Xwnt8-induced secondary axis formation (Fig. 4B-D) and was less effective in inhibiting Xwnt8-induced activation of the TOPFLASH reporter (Fig. 4E). It was also unable to inhibit activin-induced elongation of Xenopus animal caps (Fig. 4F-H). However, like the wild-type protein (Fig. 2J), CTGF{Delta}CT was still capable of blocking expression of N-tubulin (data not shown), confirming that the truncated protein retains some activity and suggesting that regions of the protein other than the CT domain are involved in the regulation of primary neurogenesis. Like the wild-type protein (Fig. 3O, lanes 1-5), CTGF{Delta}CT does not inhibit muscle differentiation in activin-treated animal caps (Fig. 3O, lanes 3, 6, 7).



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 4. Inhibition of WNT signalling requires the CT domain of CTGF. (A) Domain structures of CTGF and CTGF{Delta}CT. (B-D) CTGF{Delta}CT cannot inhibit induction of secondary axes by Xwnt8. (B) Secondary axis induced by Xwnt8. (C) Inhibition of secondary axis formation by CTGF. (D) CTGF{Delta}CT cannot inhibit secondary axis formation. (E) CTGF{Delta}CT is a poor inhibitor of Xwnt8-induced activation of the TOPFLASH reporter; CTGF cannot inhibit activation of the TOPFLASH reporter by Dishevelled. Both blastomeres of Xenopus embryos at the 2-cell stage received injections of 20 pg TOPFLASH DNA, 10 pg pRLTK DNA and the indicated combinations of 1 ng CTGF RNA, 1 ng CTGF{Delta}CT RNA, 50 pg Xwnt8 RNA and 1 ng Dishevelled RNA. Animal caps were dissected at stage 8, and 20 caps per sample were assayed for Firefly and Renilla luciferase activities 3 hours later. Firefly luciferase activities were then normalised to Renilla activities. This experiment represents a typical result out of three independent experiments. (F-H) CTGF{Delta}CT cannot inhibit activin-induced elongation of Xenopus animal caps. (F) Animal caps treated with 8 units/ml of activin protein undergo elongation. (G) Animal caps derived from embryos injected with 1 ng Ctgf RNA do not undergo elongation. (H) Elongation of animal caps is not inhibited by 1 ng of Ctgf{Delta}CT RNA.

 
CTGF interacts with the WNT receptor complex
CTGF is a secreted protein, and it seems probable that it inhibits WNT activity by interacting with extracellular components of the WNT signal transduction pathway. Consistent with this idea, we observe that CTGF cannot inhibit activation of the TOPFLASH reporter by Dsh, which acts downstream of the WNT receptor (Fig. 4E). WNT family members signal through complexes comprising members of the Frizzled family of seven transmembrane domain receptors together with the low-density lipoprotein receptor-related proteins LRP5 and LRP6 (Bafico et al., 2001Go; Mao et al., 2001Go; Tamai et al., 2000Go; Wodarz and Nusse, 1998Go). The known WNT antagonists Cerberus and WIF-1 (Hsieh et al., 1999aGo; Piccolo et al., 1999Go) and the secreted Frizzled-related protein (Kawano and Kypta, 2003Go) inhibit signalling by binding to WNT ligands. In contrast, the WNT antagonist DKK1 acts by binding to LRP6 (Mao et al., 2001Go; Semenov et al., 2001Go), as does Wise (Wnt modulator in surface ectoderm), which shows homology with the CT domain of CCN family members (Itasaki et al., 2003Go) (Fig. 1A). The latter observation, together with previous work indicating that CTGF can bind to the related receptor LRP (Segarini et al., 2001Go), suggested that CTGF might function by interacting with the WNT receptor complex.

To ask whether CTGF can interact with Frizzled8 or LRP6, we combined conditioned medium containing HA-tagged CTGF with conditioned medium containing secreted IgG-tagged versions of LRP6 (LRP6N) or Frizzled8 (Frizzled8CRD). Co-immunoprecipitation experiments showed that CTGF can interact with the extracellular regions of both LRP6 and Frizzled8 under conditions of low stringency (150 mM NaCl), but that interaction with Frizzled8 is abolished when the precipitates were washed at high stringency (500 mM NaCl) (Fig. 5A). We conclude that CTGF can interact with LRP6 in solution and that this interaction is not disrupted by high salt washes. CTGF can also interact with Frizzled8, but this interaction is weaker and may require additional components. In support of this idea, we note that when the above constructs are co-transfected into HEK293 cells (rather than being analysed by mixing conditioned media), CTGF and Frizzled8 interact as strongly as CTGF and LRP6 (data not shown).



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 5. CTGF interacts with the WNT receptor complex. In all experiments, proteins were provided in the form of conditioned medium, prepared as described in Materials and methods. Media were mixed as indicated, precipitated by Protein A Sepharose beads, and visualised by immunoblotting with the indicated antibodies. (A) CTGF interacts with LRP6 and Frizzled8 extracellular domains (LRP6N and FzCRD) under low stringency conditions (150 mM NaCl). Binding to LRP6, but not to Frizzled8, resists more stringent washing (500 mM NaCl) (top panel). Input levels of CTGF (middle panel) and the IgG-tagged proteins (bottom panel) are shown. (B) The CT domain is required for the interaction of CTGF with LRP6. CTGF but not CTGF{Delta}CT is precipitated by LRP6N (top panel). Levels of CTGF and CTGF{Delta}CT (middle panel) and of control IgG, Fz8CRD and LRP6N (bottom panel) prior to immunoprecipitation are shown. (C) CTGF binds to both EGF repeats 1, 2 and 3, 4 of LRP6. LRP6 extracellular domain (LRP6N) and two deletion constructs, LRP6N{Delta}1,2 and LRP6N{Delta}3,4, all interacted with CTGF whereas control IgG did not (top panel). Note that whereas CTGF protein levels are comparable in all lanes prior to immunoprecipitation (middle panel), LRP6N{Delta}3,4 protein levels are lower than both LRP6N and LRP6N{Delta}1,2 (bottom panel), indicating that the interaction of CTGF with this deletion is stronger than appears in the top panel. (D) DKK1 interacts with EGF repeats 3 and 4 of LRP6. DKK1 binds to LRP6N and LRP6N{Delta}1,2, but not to LRP6N{Delta}3,4 (top panel). Dkk-(middle panel) and IgG-tagged protein levels (bottom panel) prior to immunoprecipitation are shown.

 
Further experiments demonstrated that CTGF{Delta}CT is unable to bind LRP6 in this assay (Fig. 5B). This result is consistent with experiments described above indicating that the CT domain is required for complete inhibition of WNT signalling by CTGF (Fig. 4). We note that the CT domain is also required for interaction of CTGF with Frizzled8 (data not shown).

In an attempt to understand the molecular mechanism by which CTGF inhibits WNT signalling, we asked if it recognises the same domains of LRP6 as are recognised by Xwnt8 or whether, like Dickkopf (Dkk), it interacts with distinct sites. The LRP6 extracellular domain contains four epidermal growth factor (EGF)-like repeats. Repeats 1 and 2 are required for interaction with WNT proteins, whereas Dkk interacts with EGF repeats 3 and 4 (Mao et al., 2001Go). Experiments involving immunoprecipitation of mixed conditioned media indicate that CTGF can interact both with EGF repeats 1 and 2 (LRP6N{Delta}3,4) and with EGF repeats 3 and 4 (LRP6N {Delta}1,2) (Fig. 5C). In the same assay DKK1 interacts specifically with the region containing EGF repeats 3 and 4 (Fig. 5D), as previously reported (Mao et al., 2001Go). Interestingly, co-transfection experiments indicate that CTGF binds preferentially to EGF repeats 1 and 2 (data not shown). The significance of the latter observation is not clear, but together our results indicate that the structural basis of the interaction of CTGF with LRP6 differs from that of DKK1, suggesting that the two molecules inhibit WNT signalling by different mechanisms.


    Discussion
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
The data we describe indicate that CTGF can inhibit signalling through the WNT pathway. This will probably occur through its ability to interact with the WNT receptor complex, and in particular with LRP6. Our data add to the diversity of mechanisms through which WNT signalling can be regulated during development and they identify another role for CTGF as a coordinator of multiple signalling pathways.

Regulation of WNT and TGFß signalling by CTGF
Some of the effects of overexpression of CTGF in the Xenopus embryo, such as the upregulation of Otx2 and Xsox3 and the induction of partial secondary axes (Abreu et al., 2002Go; data not shown), may be because of inhibition of BMP signalling. Others, however, such as the inhibition of neural crest cell migration, might be better explained by inhibition of the WNT pathway (Deardorff et al., 2001Go; Garcia-Castro et al., 2002Go) (Fig. 2 and see Results). Consistent with this idea, we observe that CTGF can inhibit the ability of Xwnt8 to induce secondary axes in the Xenopus embryo (Fig. 3A-D), that it can inhibit induction of the direct WNT targets Siamois and Xnr3 (Fig. 3E), and that it can inhibit activation of the TOPFLASH reporter construct (Fig. 3F). CTGF will probably act extracellularly, because activation of the TOPFLASH reporter by Dsh is not prevented by CTGF (Fig. 4E), and indeed we have demonstrated that CTGF can interact stably with LRP6 and weakly with Frizzled8, two components of the WNT receptor complex (Fig. 5).

How might CTGF inhibit WNT signalling? One possibility is that CTGF, like Wise (Itasaki et al., 2003Go), competes with WNT family members for binding to LRP6. Preliminary results are consistent with this possibility, but interpretation of such experiments is complicated by the weak interaction of WNT8 with LRP6 in our assay conditions (data not shown). Other mechanisms include the idea that CTGF inhibits WNT signalling by inducing conformational changes within LRP6 that might displace Dkk or alter interactions with other components (Boyden et al., 2002Go; Liu et al., 2003Go), by binding to heparan sulphate proteoglycans, by binding to both LRP and LRP5/6 or by interacting with the WNT inhibitor Kremen (see below).

The ability of CTGF to regulate both TGFß signalling (Abreu et al., 2002Go) and WNT signalling is reminiscent of the activity of Cerberus, which regulates BMP and WNT signalling through interactions with the respective ligands (Piccolo et al., 1999Go).

CTGF and other WNT inhibitors
Many secreted inhibitors of WNT signalling have been identified. Some, like Cerberus, WIF-1 and Frzb, function by binding to WNT ligands themselves and may thereby inhibit interaction between ligand and receptor (Bafico et al., 1999Go; Hsieh et al., 1999aGo; Leyns et al., 1997Go; Piccolo et al., 1999Go; Wang et al., 1997Go; Xu et al., 1998Go). In contrast, DKK1 functions by binding to LRP6 and preventing the formation of a complex comprising WNT, Frizzled and LRP6 (Semenov et al., 2001Go). DKK1 can also form a ternary complex with Kremen, its high affinity receptor, which induces rapid internalisation and removal of LRP6 from the cell surface (Davidson et al., 2002Go; Mao et al., 2002Go).

Although both CTGF and DKK1 bind to LRP6 to inhibit WNT signalling, there are some differences in the modes of action of these two antagonists. First, DKK1 binds preferentially to the region of LRP6 containing EGF repeats 3 and 4 (Mao et al., 2001Go), whereas CTGF can interact with both EGF repeats 1, 2 and 3, 4 (Fig. 5C,D). Second, DKK1 is specific for the canonical WNT pathway, which exerts its effect through the stabilization of ß-catenin (Semenov et al., 2001Go), whereas CTGF also appears to affect the non-canonical WNT pathway, which regulates gastrulation movements (Fig. 3G-N). And finally, CTGF appears to be a much weaker antagonist of the WNT pathway than is DKK1; overexpression of DKK1 causes embryos to develop with extremely short trunks and enlarged heads and cement glands (Glinka et al., 1998Go), whereas comparable or higher doses of CTGF cause much milder anteriorised phenotypes.

Another member of the CCN family, Cyr61, also regulates WNT signalling (Latinkic et al., 2003Go), as does Wise, a novel CT domain protein (Itasaki et al., 2003Go), although these proteins can stimulate the pathway as well as antagonise it. These observations suggest that this class of cystine knot domain proteins may generally be involved in the modulation of WNT activity. Indeed, our experiments demonstrate that the interaction of CTGF with LRP6 requires the CT domain, and overexpression of just the CT domain of Cyr61, albeit at high levels, is sufficient to inhibit Xwnt8-induced secondary axis induction in Xenopus (Latinkic et al., 2003Go). The same will probably be true for the highly conserved CT domain of CTGF (Fig. 1A). We note that the CTGF CT domain plays a major role in binding to heparin and possibly to HSPGs (Ball et al., 2003Go; Brigstock et al., 1997Go). It is possible that HSPGs stabilise the binding of CTGF to Frizzled, because this interaction is strong in experiments involving co-transfection but weak in experiments in which conditioned media are combined (Fig. 5A).

CTGF and the non-canonical WNT pathway
CTGF differs from DKK1 in that it is able to inhibit convergent extension movements in animal caps. LRP6 signals exclusively through the canonical WNT pathway involving ß-catenin (Semenov et al., 2001Go), so the ability of CTGF to modulate the WNT-mediated planar cell polarity pathway must occur through another route, perhaps involving interaction with Frizzled receptors (such as Frizzled7) (Djiane et al., 2000Go), or through cooperation with HSPGs such as Glypican 4 (Ohkawara et al., 2003Go). The latter suggestion is supported by the observation that the ability of CTGF to block the elongation of activin-treated animal caps resides in the CT domain. An alternative possibility, however, is that CTGF modulates convergent extension through interactions with integrins. CTGF binds to integrin receptors (Lau and Lam, 1999Go), and integrins are involved in the recruitment of Dishevelled to the plasma membrane, a key step in the WNT planar cell polarity pathway (Marsden and DeSimone, 2001Go).

The function of CTGF
Disruption of the mouse Ctgf gene causes impaired chondrogenesis and angiogenesis (Ivkovic et al., 2003Go), but mutant embryos develop rather normally until mid-gestation stages. This result is consistent with the observation that antisense morpholino oligonucleotides cause no defect in early Xenopus embryos (Abreu et al., 2002Go) (data not shown). It is possible that another CCN family member, Cyr61, compensates for some aspects of loss of CTGF, because they are co-expressed in many tissues and have similar biochemical activities (Lau and Lam, 1999Go).

Finally, are any of the functions of CTGF in the embryo mediated through WNT signalling? We note that the expression patterns of Ctgf and Lrp5 and Lrp6 during Xenopus development are strikingly similar, suggesting that the interactions we observe in vitro may also be significant in vivo (Houston and Wylie, 2002Go). Other components of the WNT signalling pathways are also present in the Ctgf expression domain, including Frizzled family members (Borello et al., 1999Go; Deardorff and Klein, 1999Go) and, in the floorplate, Wnt4 (McGrew et al., 1992Go; Ungar et al., 1995Go). It may also be significant that mouse embryos lacking Lrp5, like those deficient in Ctgf, display abnormalities in bone formation and angiogenesis (Gong et al., 2001Go; Kato et al., 2002Go; Little et al., 2002Go), suggesting that modulation of the WNT pathway is compromised in Ctgf-/- embryos.


    ACKNOWLEDGMENTS
 
This work was funded by MRC Core support to J.C.S. and R.K., by an EU Biotechnology Network grant (#BIO4 CT-960378) to R.K. and by a Wellcome Trust Programme grant to J.C.S. NI was supported by the HFSP. We thank Eddy De Robertis for informing us of his results before publication and members of our laboratories for critical comments. We are grateful to Elena Casey, Tristan Rodriguez, Sara Ricardo, Shankar Srinivas and Lyle Zimmerman for helpful discussions and to Sonia Guidato for advice on immunoblotting. We thank the following people for plasmids: Nancy Papalopulu for Xsox3, Maria Pannese for Otx2, Tim Mohun for MLC1, J.-C. Hsieh for IgG, Fz8-IgG and Xwnt8-Myc, X. He for LRP6-IgG and Christof Niehrs for DKK1-Flag and LRP deletion constructs.


    Footnotes
 
* Present address: Wellcome Trust/Cancer Research UK Institute and Department of Zoology, University of Cambridge, Tennis Court Road, Cambridge CB2 1QR, UK Back

{dagger} Present address: School of Biosciences, Cardiff University, PO Box 911, Cardiff CF10 3US, UK Back

{ddagger} Present address: Stowers Institute for Medical Research, 1000 East 50th Street, Kansas City, MO 64110, USA Back


    REFERENCES
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 


Abreu, J. G., Ketpura, N. I., Reversade, B. and De Robertis, E. M. (2002). Connective-tissue growth factor (CTGF) modulates cell signalling by BMP and TGF-beta. Nat. Cell Biol. 4, 599-604.[Medline]
Adams, J. C. (2001). Thrombospondins: multifunctional regulators of cell interactions. Annu. Rev. Cell Dev. Biol. 17,25 -51.[CrossRef][Medline]
Babic, A. M., Chen, C. C. and Lau, L. F. (1999). Fisp12/mouse connective tissue growth factor mediates endothelial cell adhesion and migration through integrin alphavbeta3, promotes endothelial cell survival, and induces angiogenesis in vivo. Mol. Cell. Biol. 19,2958 -2966.[Abstract/Free Full Text]
Baeg, G. H., Lin, X., Khare, N., Baumgartner, S. and Perrimon, N. (2001). Heparan sulfate proteoglycans are critical for the organization of the extracellular distribution of Wingless. Development 128,87 -94.[Abstract]
Bafico, A., Gazit, A., Pramila, T., Finch, P. W., Yaniv, A. and Aaronson, S. A. (1999). Interaction of frizzled related protein (FRP) with Wnt ligands and the frizzled receptor suggests alternative mechanisms for FRP inhibition of Wnt signaling. J. Biol. Chem. 274,16180 -16187.[Abstract/Free Full Text]
Bafico, A., Liu, G., Yaniv, A., Gazit, A. and Aaronson, S. A. (2001). Novel mechanism of Wnt signalling inhibition mediated by Dickkopf-1 interaction with LRP6/Arrow. Nat. Cell Biol. 3,683 -686.[CrossRef][Medline]
Ball, D. K., Rachfal, A. W., Kemper, S. A. and Brigstock, D. R. (2003). The heparin-binding 10 kDa fragment of connective tissue growth factor (CTGF) containing module 4 alone stimulates cell adhesion. J. Endocrinol. 176, R1-R7.[Abstract]
Borello, U., Buffa, V., Sonnino, C., Melchionna, R., Vivarelli, E. and Cossu, G. (1999). Differential expression of the Wnt putative receptors Frizzled during mouse somitogenesis. Mech. Dev. 89,173 -177.[CrossRef][Medline]
Bork, P. (1993). The modular architecture of a new family of growth regulators related to connective tissue growth factor. FEBS Lett. 327,125 -130.[CrossRef][Medline]
Boyden, L. M., Mao, J., Belsky, J., Mitzner, L., Farhi, A., Mitnick, M. A., Wu, D., Insogna, K. and Lifton, R. P. (2002). High bone density due to a mutation in LDL-receptor-related protein 5. New Engl. J. Med. 346,1513 -1521.[Abstract/Free Full Text]
Brannon, M., Gomperts, M., Sumoy, L., Moon, R. T. and Kimelman, D. (1997). A beta-catenin/XTcf-3 complex binds to the siamois promoter to regulate dorsal axis specification in Xenopus. Genes Dev. 11,2359 -2370.[Abstract/Free Full Text]
Brigstock, D. R., Steffen, C. L., Kim, G. Y., Vegunta, R. K., Diehl, J. R. and Harding, P. A. (1997). Purification and characterization of novel heparin-binding growth factors in uterine secretory fluids. Identification as heparin-regulated Mr 10,000 forms of connective tissue growth factor. J. Biol. Chem. 272,20275 -20282.[Abstract/Free Full Text]
Brose, K. and Tessier-Lavigne, M. (2000). Slit proteins: key regulators of axon guidance, axonal branching, and cell migration. Curr. Opin. Neurobiol. 10, 95-102.[CrossRef][Medline]
Chang, C., Holtzman, D. A., Chau, S., Chickering, T., Woolf, E. A., Holmgren, L. M., Bodorova, J., Gearing, D. P., Holmes, W. E. and Brivanlou, A. H. (2001). Twisted gastrulation can function as a BMP antagonist. Nature 410,483 -487.[CrossRef][Medline]
Chen, C. C., Chen, N. and Lau, L. F. (2001). The angiogenic factors Cyr61 and connective tissue growth factor induce adhesive signaling in primary human skin fibroblasts. J. Biol. Chem. 276,10443 -10452.[Abstract/Free Full Text]
Chen, N., Chen, C. C. and Lau, L. F. (2000). Adhesion of human skin fibroblasts to Cyr61 is mediated through integrin alpha6beta1 and cell surface heparan sulfate proteoglycans. J. Biol. Chem. 275,24953 -24961.[Abstract/Free Full Text]
Chitnis, A. and Kintner, C. (1995). Neural induction and neurogenesis in amphibian embryos. Perspect. Dev. Neurobiol. 3,3 -15.[Medline]
Christian, J. L., McMahon, J. A., McMahon, A. P. and Moon, R. T. (1991). Xwnt-8, a Xenopus Wnt-1/int-1-related gene responsive to mesoderm-inducing growth factors, may play a role in ventral mesodermal patterning during embryogenesis. Development 111,1045 -1055.[Abstract/Free Full Text]
Cooke, J., Smith, J. C., Smith, E. J. and Yaqoob, M. (1987). The organization of mesodermal pattern in Xenopus laevis: experiments using a Xenopus mesoderm-inducing factor. Development 101,893 -908.[Abstract/Free Full Text]
Davidson, G., Mao, B., Del Barco Barrantes, I. and Niehrs, C. (2002). Kremen proteins interact with Dickkopf1 to regulate anteroposterior CNS patterning. Development 129,5587 -5596.
Deardorff, M. A. and Klein, P. S. (1999). Xenopus frizzled-2 is expressed highly in the developing eye, otic vesicle and somites. Mech. Dev. 87,229 -233.[CrossRef][Medline]
Deardorff, M. A., Tan, C., Saint-Jeannet, J. P. and Klein, P. S. (2001). A role for frizzled 3 in neural crest development. Development 128,3655 -3663.[Abstract/Free Full Text]
Djiane, A., Riou, J., Umbhauer, M., Boucaut, J. and Shi, D. (2000). Role of frizzled 7 in the regulation of convergent extension movements during gastrulation in Xenopus laevis.Development 127,3091 -3100.[Abstract]
Domingos, P. M., Itasaki, N., Jones, C. M., Mercurio, S., Sargent, M. G., Smith, J. C. and Krumlauf, R. (2001). The Wnt/beta-catenin pathway posteriorizes neural tissue in Xenopus by an indirect mechanism requiring FGF signalling. Dev. Biol. 239,148 -160.[CrossRef][Medline]
Garcia-Castro, M. I., Marcelle, C. and Bronner-Fraser, M. (2002). Ectodermal Wnt function as a neural crest inducer. Science 297,848 -851.[Abstract/Free Full Text]
Glinka, A., Wu, W., Delius, H., Monaghan, A. P., Blumenstock, C. and Niehrs, C. (1998). Dickkopf-1 is a member of a new family of secreted proteins and functions in head induction. Nature 391,357 -362.[CrossRef][Medline]
Gong, Y., Slee, R. B., Fukai, N., Rawadi, G., Roman-Roman, S., Reginato, A. M., Wang, H., Cundy, T., Glorieux, F. H., Lev, D. et al. (2001). LDL receptor-related protein 5 (LRP5) affects bone accrual and eye development. Cell 107,513 -523.[CrossRef][Medline]
Harland, R. M. (1991). In Situ Hybridization: An Improved Whole-mount Method For Xenopus Embryos. San Diego, CA: Academic Press.
Hemmati-Brivanlou, A. and Melton, D. (1994). Inhibition of activin receptor signalling promotes neuralization in Xenopus. Cell 77,273 -281.[CrossRef][Medline]
Hirsch, N. and Harris, W. A. (1997). Xenopus Pax-6 and retinal development. J. Neurobiol. 32,45 -61.[CrossRef][Medline]
Hoppler, S., Brown, J. D. and Moon, R. T. (1996). Expression of a dominant-negative Wnt blocks induction of MyoD in Xenopus embryos. Genes Dev. 10,2805 -2817.[Abstract/Free Full Text]
Houston, D. W. and Wylie, C. (2002). Cloning and expression of Xenopus Lrp5 and Lrp6 genes. Mech. Dev. 117,337 -342.[CrossRef][Medline]
Hsieh, J. C., Kodjabachian, L., Rebbert, M. L., Rattner, A., Smallwood, P. M., Samos, C. H., Nusse, R., Dawid, I. B. and Nathans, J. (1999a). A new secreted protein that binds to Wnt proteins and inhibits their activities. Nature 398,431 -436.[CrossRef][Medline]
Hsieh, J. C., Rattner, A., Smallwood, P. M. and Nathans, J. (1999b). Biochemical characterization of Wnt-frizzled interactions using a soluble, biologically active vertebrate Wnt protein. Proc. Natl. Acad. Sci. USA 96,3546 -3551.[Abstract/Free Full Text]
Inoki, I., Shiomi, T., Hashimoto, G., Enomoto, H., Nakamura, H., Makino, K., Ikeda, E., Takata, S., Kobayashi, K. and Okada, Y. (2002). Connective tissue growth factor binds vascular endothelial growth factor (VEGF) and inhibits VEGF-induced angiogenesis. FASEB J. 16,219 -221.[Free Full Text]
Itasaki, N., Jones, C. M., Mercurio, S., Rowe, A., Domingos, P. M., Smith, J. C. and Krumlauf, R. (2003). Wise, a context-dependent activator or inhibitor of Wnt signalling. Development 130,4295 -4305.[Abstract/Free Full Text]
Itoh, K., Tang, T. L., Neel, B. G. and Sokol, S. Y. (1995). Specific modulation of ectodermal cell fates in Xenopus embryos by glycogen synthase kinase. Development 121,3979 -3988.[Abstract]
Ivkovic, S., Yoon, B. S., Popoff, S. N., Safadi, F. F., Libuda, D. E., Stephenson, R. C., Daluiski, A. and Lyons, K. M. (2003). Connective tissue growth factor coordinates chondrogenesis and angiogenesis during skeletal development. Development 130,2779 -2791.[Abstract/Free Full Text]
Jedsadayanmata, A., Chen, C. C., Kireeva, M. L., Lau, L. F. and Lam, S. C. (1999). Activation-dependent adhesion of human platelets to Cyr61 and Fisp12/mouse connective tissue growth factor is mediated through integrin alpha(IIb)beta(3). J. Biol. Chem. 274,24321 -24327.[Abstract/Free Full Text]
Kato, M., Patel, M. S., Levasseur, R., Lobov, I., Chang, B. H., Glass, D. A., 2nd, Hartmann, C., Li, L., Hwang, T. H., Brayton, C. F. et al. (2002). Cbfa1-independent decrease in osteoblast proliferation, osteopenia, and persistent embryonic eye vascularization in mice deficient in Lrp5, a Wnt coreceptor. J. Cell Biol. 157,303 -314.[Abstract/Free Full Text]
Kawano, Y. and Kypta, R. (2003). Secreted antagonists of the Wnt signalling pathway. J. Cell Sci. 116,2627 -2634.[Abstract/Free Full Text]
Kireeva, M. L., Latinkic, B. V., Kolesnikova, T. V., Chen, C. C., Yang, G. P., Abler, A. S. and Lau, L. F. (1997). Cyr61 and Fisp12 are both ECM-associated signaling molecules: activities, metabolism, and localization during development. Exp. Cell Res. 233,63 -77.[CrossRef][Medline]
Korinek, V., Barker, N., Willert, K., Molenaar, M., Roose, J., Wagenaar, G., Markman, M., Lamers, W., Destree, O. and Clevers, H. (1998). Two members of the Tcf family implicated in Wnt/beta-catenin signaling during embryogenesis in the mouse. Mol. Cell. Biol. 18,1248 -1256.[Abstract/Free Full Text]
Koyano, S., Ito, M., Takamatsu, N., Takiguchi, S. and Shiba, T. (1997). The Xenopus Sox3 gene expressed in oocytes of early stages. Gene 188,101 -107.[CrossRef][Medline]
Latinkic, B. V., Mercurio, S., Bennett, B., Hirst, E. M. A., Xu, Q., Lau, L. F., Mohun, T. J. and Smith, J. C. (2003). Xenopus Cyr61 regulates gastrulation movements and modulates Wnt signalling. Development 130,2429 -2441.[Abstract/Free Full Text]
Lau, L. F. and Lam, S. C. (1999). The CCN family of angiogenic regulators: the integrin connection. Exp. Cell Res. 248,44 -57.[CrossRef][Medline]
Leyns, L., Bouwmeester, T., Kim, S. H., Piccolo, S. and De Robertis, E. M. (1997). Frzb-1 is a secreted antagonist of Wnt signalling expressed in the Spemann organizer. Cell 88,747 -756.[CrossRef][Medline]
Lin, X. and Perrimon, N. (1999). Dally cooperates with Drosophila Frizzled 2 to transduce Wingless signalling. Nature 400,281 -284.[CrossRef][Medline]
Little, R. D., Carulli, J. P., Del Mastro, R. G., Dupuis, J., Osborne, M., Folz, C., Manning, S. P., Swain, P. M., Zhao, S. C., Eustace, B. et al. (2002). A mutation in the LDL receptor-related protein 5 gene results in the autosomal dominant high-bone-mass trait. Am. J. Hum. Genet. 70,11 -19.[CrossRef][Medline]
Liu, G., Bafico, A., Harris, V. K. and Aaronson, S. A. (2003). A novel mechanism for Wnt activation of canonical signaling through the LRP6 receptor. Mol. Cell. Biol. 23,5825 -5835.[Abstract/Free Full Text]
Mao, B., Wu, W., Davidson, G., Marhold, J., Li, M., Mechler, B. M., Delius, H., Hoppe, D., Stannek, P., Walter, C. et al. (2002). Kremen proteins are Dickkopf receptors that regulate Wnt/beta-catenin signalling. Nature 417,664 -667.[CrossRef][Medline]
Mao, B., Wu, W., Li, Y., Hoppe, D., Stannek, P., Glinka, A. and Niehrs, C. (2001). LDL-receptor-related protein 6 is a receptor for Dickkopf proteins. Nature 411,321 -325.[CrossRef][Medline]
Marsden, M. and DeSimone, D. W. (2001). Regulation of cell polarity, radial intercalation and epiboly in Xenopus: novel roles for integrin and fibronectin. Development 128,3635 -3647.
Mason, E. D., Konrad, K. D., Webb, C. D. and Marsh, J. L. (1994). Dorsal midline fate in Drosophila embryos requires twisted gastrulation, a gene encoding a secreted protein related to human connective tissue growth factor. Genes Dev. 8,1489 -1501.[Abstract/Free Full Text]
Mayor, R., Morgan, R. and Sargent, M. G. (1995). Induction of the prospective neural crest of Xenopus.Development 121,767 -777.[Abstract]
McGrew, L. L., Otte, A. P. and Moon, R. T. (1992). Analysis of Xwnt-4 in embryos of Xenopus laevis: a Wnt family member expressed in the brain and floor plate. Development 115,463 -473.[Abstract]
McKendry, R., Hsu, S. C., Harland, R. M. and Grosschedl, R. (1997). LEF-1/TCF proteins mediate wnt-inducible transcription from the Xenopus nodal-related 3 promoter. Dev. Biol. 192,420 -431.[CrossRef][Medline]
Moussad, E. E. and Brigstock, D. R. (2000). Connective tissue growth factor: what's in a name? Mol. Genet. Metab. 71,276 -292.[CrossRef][Medline]
Nieuwkoop, P. D. and Faber, J. (1975).Normal Table of Xenopus laevis (Daudin) . Amsterdam: North Holland.
Oelgeschlager, M., Larrain, J., Geissert, D. and De Robertis, E. M. (2000). The evolutionarily conserved BMP-binding protein Twisted gastrulation promotes BMP signalling. Nature 405,757 -762.[CrossRef][Medline]
Ohkawara, B., Yamamoto, T. S., Tada, M. and Ueno, N. (2003). Role of glypican 4 in the regulation of convergent extension movements during gastrulation in Xenopus laevis.Development 130,2129 -2138.[Abstract/Free Full Text]
Pannese, M., Polo, C., Andreazzoli, M., Vignali, R., Kablar, B., Barsacchi, G. and Boncinelli, E. (1995). The Xenopus homologue of Otx2 is a maternal homeobox gene that demarcates and specifies anterior body regions. Development 121,707 -720.[Abstract]
Penzel, R., Oschwald, R., Chen, Y., Tacke, L. and Grunz, H. (1997). Characterization and early embryonic expression of a neural specific transcription factor xSOX3 in Xenopus laevis. Int. J. Dev. Biol. 41,667 -677.[Medline]
Penzo-Mendez, A., Umbhauer, M., Djiane, A., Boucaut, J. C. and Riou, J. F. (2003). Activation of Gbetagamma signaling downstream of Wnt-11/Xfz7 regulates Cdc42 activity during Xenopus gastrulation. Dev. Biol. 257,302 -314.[CrossRef][Medline]
Perbal, B. (2001). NOV (nephroblastoma overexpressed) and the CCN family of genes: structural and functional issues. Mol. Pathol. 54,57 -79.[Abstract/Free Full Text]
Piccolo, S., Agius, E., Leyns, L., Bhattacharyya, S., Grunz, H., Bouwmeester, T. and De Robertis, E. M. (1999). The head inducer Cerberus is a multifunctional antagonist of Nodal, BMP and Wnt signals. Nature 397,707 -710.[CrossRef][Medline]
Pierce, S. B. and Kimelman, D. (1996). Overexpression of Xgsk-3 disrupts anterior ectodermal patterning in Xenopus. Dev. Biol. 175,256 -264.[CrossRef][Medline]
Rothberg, J. M., Jacobs, J. R., Goodman, C. S. and Artavanis-Tsakonas, S. (1990). slit: an extracellular protein necessary for development of midline glia and commissural axon pathways contains both EGF and LRR. Genes Dev. 4,2169 -2187.[Abstract/Free Full Text]
Sasai, Y., Lu, B., Steinbeisser, H., Geissert, D., Gont, L. K. and De Robertis, E. M. (1994). Xenopus chordin: a novel dorsalizing factor activated by organizer-specific homeobox genes. Cell 79,779 -790.[CrossRef][Medline]
Schlunegger, M. P. and Grutter, M. G. (1993). Refined crystal structure of human transforming growth factor beta 2 at 1.95 A resolution. J. Mol. Biol. 231,445 -458.[CrossRef][Medline]
Segarini, P. R., Nesbitt, J. E., Li, D., Hays, L. G., Yates, J. R., 3rd and Carmichael, D. F. (2001). The low density lipoprotein receptor-related protein/alpha2-macroglobulin receptor is a receptor for connective tissue growth factor. J. Biol. Chem. 276,40659 -40667.[Abstract/Free Full Text]
Semenov, M. V., Tamai, K., Brott, B. K., Kuhl, M., Sokol, S. and He, X. (2001). Head inducer Dickkopf-1 is a ligand for Wnt coreceptor LRP6. Curr. Biol. 11,951 -961.[CrossRef][Medline]
Slack, J. M. W. (1984). Regional biosynthetic markers in the early amphibian embryo. J. Embryol. Exp. Morphol. 80,289 -319.[Medline]
Smith, J. C. (1993). Purifying and assaying mesoderm-inducing factors from vertebrate embryos. In Cellular Interactions in Development – A Practical Approach, pp.181 -204. Oxford: IRL Press.
Smith, W. C. and Harland, R. M. (1991). Injected Xwnt-8 RNA acts early in Xenopus embryos to promote formation of a vegetal dorsalizing center. Cell 67,753 -765.[CrossRef][Medline]
Sokol, S. (1996). Analysis of Dishevelled signalling pathways during Xenopus development. Curr. Biol. 6,1456 -1467.[CrossRef][Medline]
Sokol, S., Christian, J. L., Moon, R. T. and Melton, D. A. (1991). Injected Wnt RNA induces a complete body axis in Xenopus embryos. Cell 67,741 -752.[CrossRef][Medline]
Tada, M., Casey, E., Fairclough, L. and Smith, J. C. (1998). Bix1, a direct target of Xenopus T-box genes, causes formation of ventral mesoderm and endoderm. Development 125,3997 -4006.[Abstract]
Tada, M., Concha, M. L. and Heisenberg, C. P. (2002). Non-canonical Wnt signalling and regulation of gastrulation movements. Semin. Cell Dev. Biol. 13,251 -260.[CrossRef][Medline]
Tada, M. and Smith, J. C. (2000). Xwnt11 is a target of Xenopus Brachyury: regulation of gastrulation movements via Dishevelled, but not through the canonical Wnt pathway. Development 127,2227 -2238.[Abstract]
Tamai, K., Semenov, M., Kato, Y., Spokony, R., Liu, C., Katsuyama, Y., Hess, F., Saint-Jeannet, J. P. and He, X. (2000). LDL-receptor-related proteins in Wnt signal transduction. Nature 407,530 -535.[CrossRef][Medline]
Theze, N., Hardy, S., Wilson, R., Allo, M. R., Mohun, T. and Thiebaud, P. (1995). The MLC1f/3f gene is an early marker of somitic muscle differentiation in Xenopus laevis embryo. Dev. Biol. 171,352 -362.[CrossRef][Medline]
Tsuda, M., Kamimura, K., Nakato, H., Archer, M., Staatz, W., Fox, B., Humphrey, M., Olson, S., Futch, T., Kaluza, V. et al. (1999). The cell-surface proteoglycan Dally regulates Wingless signalling in Drosophila. Nature 400,276 -280.[CrossRef][Medline]
Ungar, A. R., Kelly, G. M. and Moon, R. T. (1995). Wnt4 affects morphogenesis when misexpressed in the zebrafish embryo. Mech. Dev. 52,153 -164.[CrossRef][Medline]
Veeman, M. T., Axelrod, J. D. and Moon, R. T. (2003a). A second canon. Functions and mechanisms of beta-catenin-independent Wnt signaling. Dev. Cell 5, 367-377.[CrossRef][Medline]
Veeman, M. T., Slusarski, D. C., Kaykas, A., Louie, S. H. and Moon, R. T. (2003b). Zebrafish prickle, a modulator of noncanonical wnt/fz signaling, regulates gastrulation movements. Curr. Biol. 13,680 -685.[CrossRef][Medline]
Vitt, U. A., Hsu, S. Y. and Hsueh, A. J. (2001). Evolution and classification of cystine knot-containing hormones and related extracellular signaling molecules. Mol. Endocrinol. 15,681 -694.[Abstract/Free Full Text]
Wang, S., Krinks, M., Lin, K., Luyten, F. P. and Moos, M. J. (1997). Frzb, a secreted protein expressed in the Spemann organizer, binds and inhibits Wnt8. Cell 88,757 -766.[CrossRef][Medline]
Wilson, P. A. and Melton, D. A. (1994). Mesodermal patterning by an inducer gradient depends on secondary cell-cell communication. Curr. Biol. 4, 676-686.[CrossRef][Medline]
Wodarz, A. and Nusse, R. (1998). Mechanisms of Wnt signaling in development. Annu. Rev. Cell Dev. Biol. 14,59 -88.[CrossRef][Medline]
Wu, J., Saint-Jeannet, J. P. and Klein, P. S. (2003). Wnt-frizzled signaling in neural crest formation. Trends Neurosci. 26,40 -45.[CrossRef][Medline]
Xu, Q., D'Amore, P. A. and Sokol, S. Y. (1998). Functional and biochemical interactions of Wnts with FrzA, a secreted Wnt antagonist. Development 125,4767 -4776.[Abstract]
Zygar, C. A., Cook, T. L. and Grainger, R. M. (1998). Gene activation during early stages of lens induction in Xenopus. Development 125,3509 -3519.[Abstract]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
L. A. Crawford, M. A. Guney, Y. A. Oh, R. A. DeYoung, D. M. Valenzuela, A. J. Murphy, G. D. Yancopoulos, K. M. Lyons, D. R. Brigstock, A. Economides, et al.
Connective Tissue Growth Factor (CTGF) Inactivation Leads to Defects in Islet Cell Lineage Allocation and {beta}-Cell Proliferation during Embryogenesis
Mol. Endocrinol., March 1, 2009; 23(3): 324 - 336.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Smerdel-Ramoya, S. Zanotti, L. Stadmeyer, D. Durant, and E. Canalis
Skeletal Overexpression of Connective Tissue Growth Factor Impairs Bone Formation and Causes Osteopenia
Endocrinology, September 1, 2008; 149(9): 4374 - 4381.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Smerdel-Ramoya, S. Zanotti, V. Deregowski, and E. Canalis
Connective Tissue Growth Factor Enhances Osteoblastogenesis in Vitro
J. Biol. Chem., August 15, 2008; 283(33): 22690 - 22699.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. S. Hoek, O. M. Eichhoff, N. C. Schlegel, U. Dobbeling, N. Kobert, L. Schaerer, S. Hemmi, and R. Dummer
In vivo Switching of Human Melanoma Cells between Proliferative and Invasive States
Cancer Res., February 1, 2008; 68(3): 650 - 656.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Rydziel, L. Stadmeyer, S. Zanotti, D. Durant, A. Smerdel-Ramoya, and E. Canalis
Nephroblastoma Overexpressed (Nov) Inhibits Osteoblastogenesis and Causes Osteopenia
J. Biol. Chem., July 6, 2007; 282(27): 19762 - 19772.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
O. Sala-Torra, H. M. Gundacker, D. L. Stirewalt, P. A. Ladne, E. L. Pogosova-Agadjanyan, M. L. Slovak, C. L. Willman, S. Heimfeld, D. H. Boldt, and J. P. Radich
Connective tissue growth factor (CTGF) expression and outcome in adult patients with acute lymphoblastic leukemia
Blood, April 1, 2007; 109(7): 3080 - 3083.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
G. A. Clines, K. S. Mohammad, Y. Bao, O. W. Stephens, L. J. Suva, J. D. Shaughnessy Jr., J. W. Fox, J. M. Chirgwin, and T. A. Guise
Dickkopf Homolog 1 Mediates Endothelin-1-Stimulated New Bone Formation
Mol. Endocrinol., February 1, 2007; 21(2): 486 - 498.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. Leask and D. J. Abraham
All in the CCN family: essential matricellular signaling modulators emerge from the bunker
J. Cell Sci., December 1, 2006; 119(23): 4803 - 4810.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
J. K. Crean, F. Furlong, D. Mitchell, E. McArdle, C. Godson, and F. Martin
Connective tissue growth factor/CCN2 stimulates actin disassembly through Akt/protein kinase B-mediated phosphorylation and cytoplasmic translocation of p27Kip-1
FASEB J, August 1, 2006; 20(10): 1712 - 1714.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
W. Chien, D. Yin, D. Gui, A. Mori, J. M. Frank, J. Said, D. Kusuanco, A. Marchevsky, R. McKenna, and H. P. Koeffler
Suppression of Cell Proliferation and Signaling Transduction by Connective Tissue Growth Factor in Non-Small Cell Lung Cancer Cells
Mol. Cancer Res., August 1, 2006; 4(8): 591 - 598.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. Dornhofer, S. Spong, K. Bennewith, A. Salim, S. Klaus, N. Kambham, C. Wong, F. Kaper, P. Sutphin, R. Nacalumi, et al.
Connective Tissue Growth Factor-Specific Monoclonal Antibody Therapy Inhibits Pancreatic Tumor Growth and Metastasis
Cancer Res., June 1, 2006; 66(11): 5816 - 5827.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-S. Nam, T. J. Turcotte, P. F. Smith, S. Choi, and J. K. Yoon
Mouse Cristin/R-spondin Family Proteins Are Novel Ligands for the Frizzled 8 and LRP6 Receptors and Activate beta-Catenin-dependent Gene Expression
J. Biol. Chem., May 12, 2006; 281(19): 13247 - 13257.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
Y. Li, J. Chen, W. Lu, L. M. McCormick, J. Wang, and G. Bu
Mesd binds to mature LDL-receptor-related protein-6 and antagonizes ligand binding
J. Cell Sci., November 15, 2005; 118(22): 5305 - 5314.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. Gazzerro, V. Deregowski, S. Vaira, and E. Canalis
Overexpression of Twisted Gastrulation Inhibits Bone Morphogenetic Protein Action and Prevents Osteoblast Cell Differentiation in Vitro
Endocrinology, September 1, 2005; 146(9): 3875 - 3882.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
I. Ben-Shlomo and A. J. W. Hsueh
Three's Company: Two or More Unrelated Receptors Pair with the Same Ligand
Mol. Endocrinol., May 1, 2005; 19(5): 1097 - 1109.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Q. Luo, Q. Kang, W. Si, W. Jiang, J. K. Park, Y. Peng, X. Li, H. H. Luu, J. Luo, A. G. Montag, et al.
Connective Tissue Growth Factor (CTGF) Is Regulated by Wnt and Bone Morphogenetic Proteins Signaling in Osteoblast Differentiation of Mesenchymal Stem Cells
J. Biol. Chem., December 31, 2004; 279(53): 55958 - 55968.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
X. Wang, N. Adhikari, Q. Li, and J. L. Hall
LDL receptor-related protein LRP6 regulates proliferation and survival through the Wnt cascade in vascular smooth muscle cells
Am J Physiol Heart Circ Physiol, December 1, 2004; 287(6): H2376 - H2383.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mercurio, S.
Right arrow Articles by Smith, J. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mercurio, S.
Right arrow Articles by Smith, J. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?