spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 8 April 2004
doi: 10.1242/dev.01053


Development 131, 2161-2171 (2004)
Published by The Company of Biologists 2004


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dev.01053v1
131/9/2161    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zelzer, E.
Right arrow Articles by Olsen, B. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zelzer, E.
Right arrow Articles by Olsen, B. R.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

VEGFA is necessary for chondrocyte survival during bone development

Elazar Zelzer1, Roni Mamluk2, Napoleone Ferrara3, Randall S. Johnson4, Ernestina Schipani5 and Bjorn R. Olsen1,*

1 Department of Cell Biology, Harvard Medical School, Boston, MA 02115, USA
2 Department of Surgical Research, Children's Hospital and Harvard Medical School, Boston, MA 02115, USA
3 Department of Molecular Oncology, Genentech, South San Francisco, CA 94080, USA
4 Molecular Biology Section, Division of Biology, University of California, San Diego, CA 92093, USA
5 Endocrine Unit, Massachusetts General Hospital and Harvard Medical School, Boston, MA 02114, USA

* Author for correspondence (e-mail: bjorn_olsen{at}hms.harvard.edu)

Accepted 30 December 2003


    SUMMARY
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
To directly examine the role of vascular endothelial growth factor (VEGFA) in cartilage development, we conditionally knocked out Vegfa in chondrocytes, using the Col2a1 promoter to drive expression of Cre recombinase. Our study of Vegfa conditional knockout (CKO) mice provides new in-vivo evidence for two important functions of VEGFA in bone formation. First, VEGFA plays a significant role in both early and late stages of cartilage vascularization, since Vegfa CKO mice showed delayed invasion of blood vessels into primary ossification centers and delayed removal of terminal hypertrophic chondrocytes. Second, VEGFA is crucial for chondrocyte survival, since massive cell death was seen in joint and epiphyseal regions of Vegfa CKO endochondral bones. Chondrocytes in these regions were found to upregulate expression of Vegfa in wild-type mice at the time when massive cell death occurred in the Vegfa CKO mice. The expression of the VEGFA receptors Npr1 and Npr2 in epiphyseal chondrocytes and lack of blood vessel reduction in the vicinity of the cartilaginous elements in the Vegfa CKO mice raise the possibility that the observed cell death is the result of a direct involvement of VEGFA in chondrocyte survival. Interestingly, the extensive cell death seen in Vegfa CKO null bones had a striking similarity to the cell death phenotype observed when hypoxia-inducible factor 1{alpha} (Hif1a) expression was abolished in developing cartilage. This similarity of cell death phenotypes and the deficient VEGFA production in Hif1a null epiphyseal chondrocytes demonstrate that HIF1{alpha} and VEGFA are components of a key pathway to support chondrocyte survival during embryonic bone development.

Key words: Conditional knockout mice, VEGFA, Chondrocyte survival, Bone development, Angiogenesis, HIF1, HIF1{alpha}, VEGF


    Introduction
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
The vertebral skeleton is formed by cells that originate from the cranial neural crest, somites, and the lateral plate mesoderm. Bones in the cranial vault, jaws, and part of the clavicle form by intramembranous ossification, a process in which mesenchymal cells differentiate into osteoblasts (Hall and Miyake, 1992Go). The rest of the skeleton develops by a process known as endochondral ossification. During endochondral ossification, mesenchymal cells differentiate into chondrocytes, which then proliferate and produce cartilage models (templates, anlagen) of the future bones. As development proceeds, chondrocytes in the center of each of the cartilage templates cease to proliferate and the post-mitotic cells differentiate to hypertrophy. The differentiation of chondrocytes to hypertrophy is followed by invasion of blood vessels, osteoclasts and other mesenchymal cells from the perichondrium into the cartilage, which is progressively eroded and replaced by bone marrow and trabecular bone in the socalled primary ossification centers (Karsenty, 1999Go; Olsen et al., 2000Go).

Vascular endothelial growth factor A (VEGFA) is an important regulator of angiogenesis during endochondral ossification. Inhibition of VEGFA by administration of soluble chimeric VEGFA receptor protein to 24-day-old mice inhibited blood vessel invasion into the hypertrophic zone of long bone growth plates and resulted in impaired trabecular bone formation and the expansion of the hypertrophic zone (Gerber et al., 1999Go). Further support for the role of VEGFA in angiogenesis of hypertrophic cartilage came from studies of mice expressing only the VEGFA120 isoform of VEGFA (Maes et al., 2002Go; Zelzer et al., 2002Go).

VEGFA120 is one of three isoforms of VEGFA in the mouse (Ferrara et al., 1992Go; Shima et al., 1996Go). VEGFA120 does not bind heparan sulfate, while the other two isoforms, VEGFA164 and VEGFA188, possess one or two heparin-binding domains, respectively, allowing interactions with heparan sulfate (Ferrara and Davis-Smyth, 1997Go; Park et al., 1993Go). Unlike heterozygous Vegfa null mice, mice that express only the 120 isoform survive through embryonic development (Carmeliet et al., 1999Go). Studies of blood vessel invasion into the primary ossification centers in VEGFA120 mice demonstrated a delay in vessel invasion and alterations in the extent of expression of cartilage differentiation markers at E14.5, indicating a role for VEGFA in cartilage angiogenesis and maturation (Maes et al., 2002Go; Zelzer et al., 2002Go). The skeletons of VEGFA120 mice showed decreased mineralization and a reduction in the expression of osteoblastic markers in membranous and endochondral bone. This suggests that VEGFA has a direct effect on the activity of osteoblasts (Zelzer et al., 2002Go). There is also evidence from in-vitro experiments that VEGFA may regulate bone formation through a direct effect on osteoblasts (Deckers et al., 2000Go; Midy and Plouet, 1994Go).

Thus, VEGFA appears to have several functions during bone formation. In this study, we report for the first time that VEGFA is critical for chondrocyte survival. We demonstrate that VEGFA, in addition to its upregulated expression in hypertrophic chondrocytes of long bone growth plates, is expressed at moderate levels in epiphyseal chondrocytes, and that these chondrocytes undergo massive cell death in the absence of VEGFA. Based on the striking similarity in the cartilage phenotypes resulting from inactivation of either Vegfa or hypoxia-inducible factor 1{alpha} (Hif1a) in chondrocytes, we conclude that the chondrocyte survival function of VEGFA is controlled by HIF1{alpha}.


    Materials and methods
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Animals
The generation of floxed-Vegfa (Gerber et al., 1999Go), floxed-Hif1a (Schipani et al., 2001Go), Col2-Cre (Schipani et al., 2001Go), and Prx1-Cre (Logan et al., 2002Go) mice have been described previously. In all timed pregnancies, plug date was defined as E0.5. For harvesting of embryos, timed-pregnant female mice were killed by exposure to CO2. The gravid uterus was dissected out and suspended in a bath of cold PBS and the embryos were delivered after amnionectomy and removal of the placenta. Genomic DNA, isolated using standard protocols from portions of the embryos (the tail in E15.5 and older embryos), was used for genotyping.

Skeletal preparations
Cartilage and bones in whole mouse embryos (E18.5) were visualized after staining with Alcian Blue and Alizarin Red S (Sigma) and clarification of soft tissue with potassium hydroxide (McLeod, 1980Go).

Histology and immunohistochemistry
For histological analysis, embryonic limbs and heads were fixed in 4% paraformaldehyde and embedded in paraffin for sectioning using standard procedures. Sections of 7 µm thickness were stained with hematoxylin and eosin (H & E). For CD31 immunohistochemistry, embryos were fixed in 4% paraformaldehyde, followed by 20% sucrose infiltration. Tissues were embedded in OCT (Tissue-Tek®) and 7 µm cryostat sections were made. Sections were incubated with monoclonal rat anti-mouse CD31 (BD PharMingen). Sections were incubated with biotinylated anti-rat IgG (Vector Laboratories), and an ABC kit (Vector Laboratories) was used for detection.

In situ hybridization and TUNEL assay
In situ hybridization was carried out on paraffin sections with 33P-labeled anti-sense RNA essentially as described (Hartmann and Tabin, 2000Go; Zelzer et al., 2002Go). For TUNEL assay, paraffin sections were permeabilized with 0.1% Triton X-100 in 0.1% sodium citrate. TUNEL assay was performed using a Roche In situ Cell Death Detection kit (Roche) according to the manufacturer's recommendations.

Culture of primary epiphyseal chondrocytes
Epiphyseal chondrocytes were isolated from the knee joint region of newborn mice. Skin, muscles and soft tissue were removed. DMEM containing 0.5 mg/ml hyaluronidase (Sigma H-3506) was added and the tissue was digested for 30 minutes at 37°C on a rotating shaker. The medium was then replaced by medium containing 1 mg/ml trypsin (Sigma T-1426) and incubation continued for 30 minutes at 37°C on a rotating shaker. The trypsin containing medium was removed and cartilage was incubated twice with medium containing 1 mg/ml bacterial collagenase (Sigma C-9263). Medium from the first incubation was discarded after 20 minutes and then chondrocytes were isolated by collagenase digestion for 2 hours at 37°C on a rotating shaker. The cells were passed through a cell strainer (Falcon 352340) and were centrifuged at 400 g for 5 minutes. The cells were suspended in DMEM containing 10% FBS and 2% Penicillin/Streptomycin/Glutamine, plated at a density of 5 x 105 cells/well in a 24-well plate and incubated at 37°C overnight.

Gene-specific RT-PCR analysis
Total RNA was extracted from cultured primary mouse epiphyseal chondrocytes using Rneasy kit (Qiagen 74104). Five micrograms of total RNA were treated with DNA-Free RNA Kit (Zymo Research) and reverse transcribed with Superscript II First Strand Synthesis System for RT-PCR (Invitrogen). All genes were amplified using Taq DNA polymerase (Roche) for 35 cycles and PCR products were fractionated by gel electrophoresis. The primers used for the PCR amplification were 5'CACAGATAAGCCCACCAGAG3' and 5'GACAACCACCGCAATGA3' for Cd31; 5'GGCTCAGGGTCGAAGTTAAAAGTGCCT3' and 5'TAGGATTGTATTGGTCTGCCGATGGGT3' for VEGFAr1; 5'CTCTGTGGGTTTGCCTGGCGATTTTCT3' and 5'GCGGATCACCACAGTTTTGTTCTTGTT3' for Vegfr2; 5'GCTGGCAGGAGGAGGAA3' and 5'TCCCGCTGTCTGTCTGGTTA3' for Vegfr3; 5'TCCCGCCTGAACTACCCTGAA3' and 5'GCCTTGCGCTTGCTGTCATC3' for neuropilin 1; 5'CCCCGAACCCAACCAGAAGA3' and 5'GAATGCCATCCCAGATGTCCA3' for neuropilin 2.


    Results
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Generation of mice lacking VEGFA in chondrocytes
In order to study the role of VEGFA in cartilage development we used the loxP-Cre recombination system with the chondrocyte specific Col2a1 promoter to drive expression of Cre recombinase. Previous attempts to conditionally delete the Vegfa allele in cells expressing collagen type II resulted in lethality at the heterozygous stage around E10 because of defects in development of the dorsal aorta and intersomitic blood vessels, along with defects in heart development (Haigh et al., 2000Go). We speculated that different Col2a1-Cre mouse lines might have different levels and tissue specificities of Cre expression and might therefore allow a conditional deletion of Vegfa in chondrocytes. We crossed floxed-Vegfa mice to animals with Cre expression under the control of the rat Col2a1 promoter (Schipani et al., 2001Go). Animals heterozygous for both floxed-Vegfa and Col2a1-Cre alleles were collected and mated to floxed-Vegfa homozygous animals. In contrast to what was reported by Haigh et al. (Haigh et al., 2000Go), we observed no embryonic lethality during these crosses and embryos could therefore be studied at different stages of development.

Lack of VEGFA in chondrocytes leads to impaired embryonic bone development
Staining of skeletons of mice that were heterozygous for both floxed-Vegfa and Col2a1-Cre alleles (unaffected) and mice that were heterozygous for Col2a1-Cre and homozygous for the floxed-Vegfa alleles (conditional knockout, CKO) with Alizarin Red and Alcian Blue showed that the Alizarin Red-stained zones were reduced in the Vegfa CKO mice at E18.5, suggesting a reduction in mineralization (Fig. 1). This reduction was observed in long bones in the limbs (Fig. 1B), in ribs (Fig. 1D), in sternum (Fig. 1F), and in the bones of the vertebral column (Fig. 1H). Furthermore, the cartilaginous parts were smaller and stained less intensely for Alcian Blue in the CKO tissues, suggesting a cartilage abnormality.



View larger version (48K):
[in this window]
[in a new window]
 
Fig. 1. Reduced skeletal mineralization in Vegfa conditional knockout (CKO) mice. A comparison of the skeletons of unaffected (A,C,E,G) and Vegfa CKO (B,D,F,H) mice reveals reduced size of areas stained with Alizarin Red, suggesting reduced mineralization of mutant bones. Regions significantly affected (arrows) include the bones in hind limbs (A,B), ribs (C,D), sternum (E,F), and vertebral column (G,H).

 
For more detailed analyses, histological sections were prepared from different skeletal elements at stages E15.5 to E18.5. As can be seen in Fig. 2A,B, in the unaffected mice at E15.5, we observed initiation of blood vessel invasion into the hypertrophic cartilage of long distal limb bones (tibia and fibula), whereas in the Vegfa CKO distal limb bones there was an expansion of the hypertrophic zone, so that it occupied most of the diaphysis, and no evidence of blood vessel invasion and trabecular bone formation could be seen. In order to document the differences in the invasion of blood vessels into the hypertrophic zone between unaffected and Vegfa CKO mice we stained for PECAM (CD31), an endothelial cell marker. At E16.0 (Fig. 2C,D), in unaffected tibia we observed abundant CD31 staining throughout the diaphysis and capillary network adjacent to the growth plate. In contrast, in tibia of Vegfa CKO mice there was clearly no vessel invasion into cartilage. At E16.5 (Fig. 2E,F), a marrow cavity was established in the distal limb bones of unaffected and Vegfa CKO mice, but despite this evidence of a normal architecture, the zones of hypertrophic chondrocytes remained larger in Vegfa CKO than in unaffected growth plates. Not only limb bones were affected in the Vegfa CKO mice; expansion of the hypertrophic zone could also be observed at E18.5 in ribs (Fig. 2G,H). These results suggest that VEGFA is important both for the initiation of blood vessel invasion into hypertrophic cartilage as well as later in the process of endochondral bone formation.



View larger version (150K):
[in this window]
[in a new window]
 
Fig. 2. Reduced angiogenesis in Vegfa conditional knockout (CKO) bones. Histology of unaffected and Vegfa CKO mice identifies marked differences in skeletal elements during development. In tibia and fibula at E15.5 in unaffected mice (A), blood vessel invasion into the hypertrophic cartilage and marrow cavity can be observed (arrowheads), while no invasion can be seen into hypertrophic cartilage in the Vegfa CKO mice (B). CD31 immunostaining of tibia at E16.0 in unaffected mice (C) shows vessels throughout the periosteum and in the marrow cavity. In the Vegfa CKO mice (D), there are vessels in the periosteum but no apparent invasion into the hypertrophic zone. In the radius and ulna at E16.5 in unaffected (E) mice, bone marrow and bone trabeculae are present below the hypertrophic zone (arrowhead). In Vegfa CKO mice the growth plate contains a much longer hypertrophic zone (F, arrowhead). At E18.5, unaffected ribs (G) contain a shorter hypertrophic zone. In contrast, the Vegfa CKO ribs contain a greatly expanded zone of hypertrophy (H, arrowhead).

 
Lack of VEGFA in chondrocytes leads to reduction in the removal of terminally differentiated hypertrophic chondrocytes
Expansion of the hypertrophic zone in the Vegfa null growth plates (Fig. 3A,B) could be a consequence of either accelerated chondrocyte differentiation or delayed removal of terminally differentiated hypertrophic chondrocytes. To distinguish between these possibilities, we studied chondrocyte differentiation by examining the expression of several chondrocyte differentiation markers in the humerus of E16.5 mice.



View larger version (146K):
[in this window]
[in a new window]
 
Fig. 3. Reduced removal of terminally differentiated chondrocytes in Vegfa conditional knockout (CKO) bones. Histological sections of E16.5 unaffected (A) and Vegfa CKO (B) humerus show the presence of an expanded hypertrophic zone in the Vegfa CKO growth plate (defined by brackets). Col2a1 expression is seen throughout the cartilage anlagen in both unaffected (C) and Vegfa CKO (D) mice. In unaffected (E) mice Col10a1 expression is seen in the hypertrophic zone (bracket) while in Vegfa CKO (F) mice, Col10a1 expression is seen only in part of the hypertrophic zone (bracket), suggesting that some of the hypertrophic chondrocytes are differentiated into terminal hypertrophic chondrocytes. Osp expression is seen in the last row of terminally differentiated hypertrophic chondrocytes and extensively in the osteoblasts under the growth plate in the unaffected mice (G), while in the Vegfa CKO growth plate, Osp expression is detected in several rows of terminally differentiated hypertrophic chondrocytes (H).

 
The expression of collagen II, a marker for resting and proliferating chondrocytes, did not show any difference between Vegfa CKO and unaffected mice (Fig. 3C,D). Expression of collagen X, a marker for hypertrophic chondrocytes, was similar in the unaffected and Vegfa CKO bones (Fig. 3E,F), although, as mentioned above, the hypertrophic zones in the mutant bones were larger than those of wild-type bones. This suggests that some of the hypertrophic chondrocytes in the mutant bones are differentiated to terminal hypertrophic chondrocytes (with a low level of collagen X expression) at E16.5. We also studied the expression of osteopontin (Osp), a marker for terminally differentiated chondrocytes. As can be seen in Fig. 3G,H, Vegfa CKO bones contained several rows of chondrocytes expressing Osp, whereas expression was restricted to only one row of chondrocytes in the unaffected bones. These results suggest that there is delayed removal of terminally differentiated hypertrophic chondrocytes in the Vegfa CKO growth plates. This is consistent with the overall decrease in cartilage angiogenesis in the Vegfa CKO mice (see above).

Loss of VEGFA in chondrocytes results in massive cell death
Histological studies of Vegfa CKO femurs at E16.5 revealed a zone of large, balloon-like cells, poorly stained and with a `ghost'-like appearance, at the center of the epiphysis (Fig. 4A,B). There was some variation in the severity of the abnormalities, with the distal limb bones showing the highest degree of abnormality. In the distal bones at E18.5, extensive regions of dead cells were observed (Fig. 4C,D). These regions of cell death were located in the central regions of the skeletal elements, starting at an articular surface and continuing through the resting to the proliferating zones of chondrocytes and ending in a misshapen growth plate. Depending on the severity of the phenotype, the growth plate was dramatically affected and hypertrophic chondrocytes of normal shape were almost completely missing. Outside the center of the growth plates, proliferating cells appeared to accumulate (Fig. 4D). These zones of proliferating cells were much more extended in Vegfa CKO than in unaffected growth plates.



View larger version (100K):
[in this window]
[in a new window]
 
Fig. 4. Cell death in Vegfa and Hif1a conditional knockout (CKO) bones. Histological sections of E16.5 Vegfa CKO humerus (B) show areas of cell death (arrow), unlike the unaffected bone (A). Compared with the femur and tibia of unaffected mice (C), the E18.5 Vegfa CKO bones (D) were misshapen with extensive regions of dead cells in the center of the bones, starting at the articular surface and continuing through the resting to the proliferating zones of chondrocytes and ending in a misshapen growth plate (arrows). Histological sections of unaffected (E) and Hif1a CKO (F) femur and tibia at E15.5 show misshapen bones with extensive regions of dead cells in the center of the bones (arrowheads).

 
In order to study the nature of the cell death, we assayed unaffected and Vegfa CKO bones for TUNEL-positive cells. As can be seen in Fig. 5, sections of Vegfa CKO growth plates revealed cells with shrunken cytoplasm and condensed nuclei, similar to that observed for apoptotic cells (Fig. 5A-D). Strong TUNEL-positive signals were seen in regions in which we observed dead cells histologically. Interestingly, many of the TUNEL-positive cells flanked the zones of dead cells (Fig. 5F,G). We failed to observe TUNEL-positive cells in growth plates of unaffected mice (Fig. 5E). Previous attempts to conditionally delete Vegfa in cells expressing collagen type II resulted in lethality and defects in heart development at stage E10 (Haigh et al., 2000Go). Malfunction of the heart can reduce the supply of nutrients and oxygen to the developing embryo, leading to indirect effects on skeletal development. To exclude such an indirect effect, we crossed the floxed-Vegfa mice to animals with Cre expression under the control of the rat Prx1 promoter. This line of Cre-mice expresses the Cre recombinase in limb bud mesenchyme (Logan et al., 2002Go). Heterozygous animals for both floxed-Vegfa and Prx1-Cre alleles were collected and mated to floxed-Vegfa homozygous animals. Animals homozygous for floxed-Vegfa and heterozygous for Prx1-Cre (Prx1/Vegfa CKO; a detailed description of these mice will be presented elsewhere) had dramatically smaller and misshapen bones. At E16.5 the epiphyses of limb bones of Prx1/Vegfa CKO mice contained extensive regions of dead cells. In some cases (Fig. 5H), the head of the humerus was composed entirely of dead cells. These results suggest that VEGFA is necessary for chondrocyte survival during endochondral bone formation.



View larger version (85K):
[in this window]
[in a new window]
 
Fig. 5. Apoptosis in Vegfa conditional knockout (CKO) bones. Histological sections through the center of E18.5 unaffected (A,C) and Vegfa CKO (B,D) humerus. Areas within the squares in A and B are shown at high magnification in C and D. In the affected epiphysis (D), the presence of apoptotic cells with shrunken cytoplasm and condensed nuclei is observed. TUNEL assay of E18.5 unaffected (E) and Vegfa CKO (F) humerus and Vegfa CKO tibia and femur (G) shows strong TUNEL-positive signals in regions of apoptotic cells (arrowheads) in the Vegfa CKO bones (E and F are serial sections of A and B, while G is serial section of Fig. 4 D). Histological sections of E16.5 Prx1/Vegfa CKO scapula and humerus show misshapen bones with extensive regions of dead cells (H, arrowheads).

 
Hif1a differentially regulates Vegfa expression during bone development
The extensive cell death in the epiphyses of Col2a1/Vegfa CKO and Prx1/Vegfa CKO null bones had a striking similarity to the phenotype previously observed when Hif1a expression was abolished in developing cartilage (Schipani et al., 2001Go). In the case of Hif1a CKO mice, it was also demonstrated that extensive apoptosis occurs in cartilage epiphyses. To study the similarities between the two phenotypes in more detail, we crossed floxed-Hif1a mice to Col2a1-Cre mice. Animals heterozygous for both floxed-Hif1a and Col2a1-Cre alleles were collected and mated to floxed-Hif1a homozygous animals. Histological sections of Hif1a CKO hind limbs at E15.5 revealed robust signs of cell death in the center of long bone epiphyses (Fig. 4E,F). Furthermore, we observed a delay in vessel invasion into primary ossification centers (Fig. 6A,B). Since Hif1a is a known regulator of Vegfa expression, one possibility to explain this delay in vessel invasion would be a reduction of Vegfa expression in Hif1a CKO primary ossification centers. To study the possibility that Hif1a regulates the expression of Vegfa in the developing bone, we examined Vegfa expression in unaffected and Hif1a CKO bones. During cartilage development, Vegfa shows a dynamic pattern of expression. During the establishment of primary ossification centers, Vegfa is expressed primarily in the hypertrophic zone (Fig. 6C). Later, as development proceeds, Vegfa expression in the hypertrophic zone is maintained, and a moderate level of Vegfa expression can be detected in the epiphyses (Fig. 6E). As can be seen in Fig. 6D, at E15.5 Vegfa expression is detectable in the hypertrophic zone of tibia of Hif1a CKO mice. In contrast, Vegfa expression in the Hif1a CKO epiphysis is dramatically reduced at E18.5 (Fig. 6F). This result suggests that at E15.5 the expression of Vegfa in hypertrophic chondrocytes is not Hif1a-dependent, while Vegfa expression in the epiphyses is Hif1a-dependent later in development. In order to identify a receptor that might mediate VEGFA signaling in epiphyseal chondrocytes, we examined the expression of the known receptors of VEGFA in these cells. We failed to detect expression of Vegfr1 and Vegfr2, but were able to identify expression of Vegfr3, neuropilin 1 (Nrp1) and neuropilin 2 (Nrp2) (Fig. 7), suggesting that these receptors might be involved in mediating the effects of VEGFA in epiphyseal chondrocytes.



View larger version (118K):
[in this window]
[in a new window]
 
Fig. 6. Analysis of Vegfa expression in Hif1a conditional knockout (CKO) mice. Histological sections of E15.5 tibia of unaffected (A) and Hif1a CKO mice (B) reveal a delay in vessel invasion into the Hif1a CKO primary ossification center (arrowheads). Vegfa expression in the primary ossification center of unaffected tibia at E15.5 (G) shows expression in hypertrophic chondrocytes but no detectable expression in the epiphysis. At E18.5 (E), the expression of Vegfa in the hypertrophic zone is maintained and it is possible to detect a moderate level of Vegfa expression in the epiphysis (arrows). At E15.5 in the primary ossification center of tibia there is no apparent difference in Vegfa expression in the hypertrophic chondrocytes of unaffected (C) and Hif1a CKO mice (D), although the shape of the hypertrophic region is abnormal in the Hif1a CKO section (D). At E18.5 (F) the expression of Vegfa in the Hif1a CKO is dramatically decreased. At this stage, the extensive cell death in the Hif1a tissue makes it almost impossible to see any hypertrophic zone of chondrocytes and all remaining viable cells are proliferating Col2a1-positive cells (H).

 



View larger version (67K):
[in this window]
[in a new window]
 
Fig. 7. Gene specific RT-PCR analyses of VEGFA receptors in epiphyseal chondrocytes. Total RNA was extracted from epiphyseal chondrocytes. RT-PCR reactions were performed in the presence of reverse transcriptase (RT) (+) or in its absence (–) (as a control for genomic DNA contamination). Cd31 was also amplified as a control for endothelial cell contamination. Nucleotide size markers are indicated at left. Amplified bands are only seen in the Vegfr3, Nrp1 and Nrp2 lanes, as indicated by asterisks.

 
HIF1{alpha} is involved in chondrocyte differentiation
Studying sections of E15.5 Hif1a CKO tissues revealed, as was mentioned above, a delay in vessel invasion into primary ossification centers (Fig. 6A,B). The detectable Vegfa expression in Hif1a CKO hypertrophic chondrocytes (Fig. 6D) suggests that delay in vessel invasion into the Hif1a CKO hypertrophic cartilage template is not a simple consequence of a reduction in Vegfa expression. HIF1{alpha} may therefore play a role in chondrocyte differentiation. To analyze this possibility further, we studied chondrocyte differentiation in Hif1a CKO mice by following the temporal expression of cartilage differentiation markers (Fig. 8). At E15.5, Col10a1 expression was reduced in the most mature (terminally differentiated) hypertrophic chondrocytes of unaffected bones. In contrast, in the Hif1a CKO tissue the expression of Col10a1 was still prominent in the hypertrophic zone (Fig. 8A,B). Differences in the expression of Pthr1 and Ihh further support the possibility that differentiation is delayed in Hif1a CKO chondrocytes. In the unaffected bones, the expression of these two markers was reduced in the terminally differentiated hypertrophic chondrocytes, but most of the hypertrophic chondrocytes still expressed Pthr1 and Ihh in the Hif1a CKO bones (Fig. 8C-F). These results indicate that HIF1{alpha} has a role in chondrocyte differentiation within long bone growth plates.



View larger version (163K):
[in this window]
[in a new window]
 
Fig. 8. Analysis of chondrocyte differentiation in Hif1a conditional knockout (CKO) mice. Col10a1, Ihh and Pthr1 expression domains are divided by cells that have lost the expression of these markers in the growth plates of unaffected (A,C,E) mice, while the Hif1a CKO (B,D,F) mice cells in the center of the hypertrophic domains express all three markers.

 
Normal vascularization outside Vegfa null cartilaginous templates
The extensive cell death in the Vegfa CKO epiphyses could be the result of a reduced vascularization in the vicinity of developing bones. In order to study this possibility we performed immunohistochemical studies of blood vessels surrounding the knee joint. This region was selected because it showed a strong cell death phenotype (Fig. 4D). We chose to study sections of E16.0 embryos since we wanted to insure that any difference in vascularization would precede the cell death phenotype. Serial sections of unaffected and Vegfa CKO knee joints at stage E16.0 were stained with CD31 antibodies for visualization of blood vessels (Fig. 9). Analysis of comparable sections did not reveal any apparent differences between unaffected and Vegfa CKO sections (Fig. 9A,B). Moreover, we were able to identify regions with extensive vascularization in the vicinity of both diaphyses and epiphyses. In some cases we were able to observe blood vessels in rather close proximity to areas showing the typical appearance of cell death (Fig. 9B,D). These results suggest that in Vegfa CKO bones there is no apparent reduction in the vascularization of tissues surrounding the cell death regions of cartilaginous templates.



View larger version (148K):
[in this window]
[in a new window]
 
Fig. 9. Vascularization in the vicinity of Vegfa conditional knockout (CKO) cartilaginous elements. CD31 immunostaining of unaffected (A) and Vegfa CKO (B,C,D) tibias at E16.0. Comparison of histologically comparable sections of unaffected (A) and Vegfa CKO (B) knee joint regions reveals no major difference in CD31 immunostaining (arrowheads). Extensive vascularization in the vicinity of the diaphyses and the epiphyses of Vegfa CKO knee joint region (C, arowheads). In D, an area indicated by a square in B shown at high magnification, CD31-positive blood vessels are seen in the vicinity of a region of initial cell death between the femur (f), tibia (t), and the anterior cruciate ligament (l).

 
Abnormal pattern of expression of Ihh and Pthr1 in Vegfa null growth plates
Further similarities between the Hif1a and Vegfa conditional null phenotypes could be observed by histological examination of growth plates at E18.5. In both cases, the proliferating zones were divided by a zone of dead cells. In unaffected growth plates, the proliferating zone was clearly defined and extended to the center of the epiphysis. In contrast, in the Hif1a and Vegfa CKO growth plates, the proliferating cells extended further into the epiphysis (Fig. 10A,B) (Schipani et al., 2001Go). In order to get insights into a possible mechanism for this abnormality, we examined the Vegfa CKO growth plates for expression of Ihh and Pthr1, two genes that are known to have roles in the regulation of chondrocyte proliferation and differentiation to hypertrophy.



View larger version (94K):
[in this window]
[in a new window]
 
Fig. 10. Expression of Col2a1, Ihh, and Pthr1, in the E18.5 humerus. In Vegfa conditional knockout (CKO) mice (A), areas of increased proliferation (square) can be seen surrounding areas of cell death; square in A seen at higher magnification in B, arrowheads indicate proliferating cells. Col2a1 expression is seen throughout the cartilage in unaffected mice (C) while in Vegfa CKO (D) mice Col2a1 expression is lacking in the center of the cartilage (arrowhead). Ihh and Pthr1 expression in the unaffected humerus (E,G) is restricted to a narrow strip of prehypertrophic cells. In the Vegfa CKO growth plate the domain of expression of both Ihh and Pthr1 is expanded (F,H).

 
As can be seen in Fig. 10C,D, the expression of Col2a1 at E18.5 in the humerus of Vegfa CKO mice defined the cell death region as the zone in which Col2a1 expression was lost. These dying or dead cells also lost the expression of Pthr1 and Ihh. Flanking the regions of dead cells, we identified expanded regions of proliferating cells that also expressed Ihh and Pthr1 (Fig. 10E-H). It is possible that this change in the expression pattern of Ihh and Pthr1 may lead to the formation of an extended zone of proliferating chondrocytes that flanks the regions of dead cells in the Vegfa CKO growth plates.


    Discussion
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
In this paper we provide, for the first time, evidence that VEGFA is necessary for chondrocyte survival in addition to its known role in regulating angiogenesis during endochondral bone formation. Comparing the skeletal phenotypes of mice with chondrocyte specific deletion of either Vegfa or Hif1a reveals a large similarity between the phenotypes. This suggests that HIF1{alpha}, a well-known regulator of VEGFA, and VEGFA are critical for chondrocyte survival during bone formation.

Hif1{alpha} and Vegfa are part of a chondrocyte survival pathway
HIF1{alpha} regulates the transcription of a broad range of genes that are involved in a variety of processes such as glucose metabolism, angiogenesis and cell survival (Pugh and Ratcliffe, 2003Go; Semenza, 2003Go). Several stimuli, such as hypoxia, hormones and growth factors, induce stabilization of the HIF1 heterodimeric transcription complex. This complex is composed of HIF1{alpha} and HIF1ß. HIF1ß is constitutively expressed, whereas HIF1{alpha} is tightly regulated (Maxwell et al., 1993Go; Semenza and Wang, 1992Go; Wang and Semenza, 1993Go; Wang and Semenza, 1995Go; Zelzer et al., 1998Go); the tumor-suppressor protein von Hippel-Lindau (VHL) protein is a key element in this regulation (Bruick and McKnight, 2001Go; Ivan et al., 2001Go; Jaakkola et al., 2001Go; Masson et al., 2001Go; Yu et al., 2001Go).

HIF1{alpha} is known to be a regulator of VEGFA in many systems (Shima et al., 1995Go). However, in hypertrophic chondrocytes of Hif1a CKO growth plates, Vegfa expression was comparable to the expression in unaffected, control growth plates at E15.5 (Fig. 6). This suggests that Vegfa expression is not dependent on Hif1a in hypertrophic chondrocytes, at least at that stage of development. Runx2 and Ctgf are two genes that may be involved in the regulation of VEGFA at that stage or later, since Vegfa expression in the hypertrophic zones of Runx2 and Ctgf null embryos is decreased (Ivkovic et al., 2003Go; Zelzer et al., 2001Go) (Fig. 11). In epiphyseal chondrocytes Hif1a may well be a major regulator of Vegfa expression, since the expression of Vegfa was dramatically reduced at E18.5 in Hif1a CKO bones (Fig. 6F). The important role of Hif1a in regulating expression of Vegfa in epiphyseal chondrocytes is further demonstrated by the recent analysis of the phenotype of mice that are homozygous for VHL null alleles in chondrocytes (Pfander et al., 2004Go). In these VHL conditional knockout mice, levels of hydroxylated HIF1{alpha} protein are elevated and expression of Vegfa is enhanced in epiphyseal cartilage.



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 11. Two distinct roles of VEGFA during endochondral bone formation are regulated by different pathways. Diagram showing major components of the pathways that regulate expression of Vegfa in hypertrophic chondrocytes (right) and epiphyseal chondrocytes (left) during endochondral ossification. Angiogenesis into hypertrophic cartilage and establishment of the primary ossification center in developing long bones depend on a high level of Vegfa expression, controlled by the transcription factor Runx2, in hypertrophic chondrocytes (Zelzer et al., 2001Go). Since a reduction in the level of Vegfa was also observed in Ctgf null mice (Ivkovic et al., 2003Go), it is possible that Runx2 and Ctgf may be components of two independent or dependent regulatory pathways for control of Vegfa expression. In epiphyseal cartilage, cell survival depends on expression of Vegfa at a moderate level under the control of HIF1 and von Hippel-Lindau (VHL) protein. Whether Vegfa is the only critical target gene for HIF1 regulation in this chondrocyte survival pathway is not known, and it is possible that other genes may also play a role.

 
The striking homology between the Hif1a and Vegfa CKO cartilage phenotypes (Fig. 4) and the loss of VEGFA production under hypoxic conditions in cultured Hif1a-null epiphyseal chondrocytes (Pfander et al., 2003Go) further support the hypothesis that HIF1{alpha} regulates Vegfa expression in a chondrocyte survival pathway (Fig. 11). Interestingly, there is a time difference in the appearance of the cell death phenotype in the two conditional knockouts. The cell death phenotype appears at E14.5 in bones of Hif1a CKO mice (Schipani et al., 2001Go) but becomes apparent two days later in Vegfa CKO animals (Fig. 4). There can be several explanations for this difference. First, HIF1{alpha} is known to regulate the expression of many genes that have a role in cell survival, including Igf2 and Tgfa (Feldser et al., 1999Go; Krishnamachary et al., 2003Go) and Vegfa could be one of these genes required for cell survival at E14.5, even at low, almost undetectable, levels of expression. A second possibility is that the cell survival function of HIF1{alpha} is independent of VEGFA at E14.5 but becomes dependent on VEGFA later at E16.5, when Vegfa expression in epiphyseal chondrocytes can be detected (Fig. 6).

Although VEGFA is best known for its activity as an angiogenic factor (Ferrara et al., 2003Go), it has been shown to be a survival factor for endothelial and hematopoietic stem cells (Benjamin et al., 1999Go; Gerber et al., 1998aGo; Gerber et al., 2002Go; Gerber et al., 1998bGo), and here we describe a role for VEGFA in supporting chondrocyte survival. We cannot at present rule out the possibility that Vegfa expression in the epiphyseal chondrocytes regulates some aspect of vascularization in the vicinity of the epiphysis (with secondary consequences for the survival of epiphyseal chondrocytes), but we favor the view that VEGFA has a direct role in chondrocyte survival. First, epiphyseal chondrocytes express three receptors for VEGFA, namely Vegfr3, Nrp1 and Nrp2, suggesting that VEGFA can initiate signaling in these cells. Interestingly, it was recently demonstrated that Nrp1 can, independently of other receptors, initiate cell signaling (Bachelder et al., 2001Go; Foster et al., 2003Go; Wang et al., 2003Go). Secondly, cell death in the Prx1/Vegfa CKO epiphyseal cartilage was observed at E16.5 (Fig. 5H), the stage at which we identified cell death in the Col2a1/Vegfa CKO mice, suggesting that VEGFA is needed for chondrocyte survival at a specific developmental time. This finding is particularly important, since the cartilaginous elements in the Prx1/Vegfa CKO are significantly smaller than in the Col2a1/Vegfa CKO mice, suggesting that the cell death cannot be a simple consequence of a deficient diffusion of nutrients and oxygen into the epiphysis. Consistent with this interpretation is the recent report that incubation of chondrocytes in hypoxic conditions did not cause cell death (Pfander et al., 2003Go). Finally, when we analyzed vascularization in the vicinity of the cartilaginous elements to examine a possible reduction in vessel numbers before cell death occurs in the Vegfa CKO mice, we failed to observe any obvious difference between unaffected and Vegfa CKO limbs.

Several studies have recently suggested a role for VEGFA during organ development as a mediator of cell-cell interactions between endothelial and parenchymal cells (Cleaver and Melton, 2003Go). We have therefore considered the possibility that the role of VEGFA in supporting survival of epiphyseal chondrocytes may somehow involve an interaction with endothelial cells in the vicinity of the cartilage. During development of pancreas and liver there is a close physical interaction between endothelial and endodermal cells and VEGFA was demonstrated to have an important role in interactions that led to development of these organs (Lammert et al., 2001Go; Matsumoto et al., 2001Go). Since chondrocyte differentiation and cartilage formation take place in an endothelium-free environment, any involvement of endothelial cells in the HIF1{alpha}/VEGFA chondrocyte survival pathway would have to include long-range interactions.

VEGFA regulation of bone vascularity
Blood vessel invasion into the primary ossification center is a key step in bone development. In this study we have provided further in-vivo evidence that VEGFA is required for angiogenesis into the primary ossification center and the maintenance of blood vessel growth in developing bones. At E15, vessels are invading hypertrophic cartilage, and as development proceeds, the vessels continue to grow under the growth plates as hypertrophic chondrocytes are being removed. In the Vegfa CKO bones, there is a delay in blood vessel invasion into the primary ossification center (Fig. 2), and accumulation of terminally differentiated chondrocytes in growth plates suggests a reduction of vessel sprouting and cartilage removal (Fig. 3). Since the angiogenic process in the Vegfa CKO bones was not completely abolished, we consider the possibility that VEGFA is not the only factor regulating the process of endochondral angiogenesis, although it is also possible that the Cre was less than fully efficient in generating a chondrocyte-specific Vegfa null phenotype. However, comparing the phenotypes of the Vegfa CKO and the Vegfa120 mice clearly demonstrates that the 120 isoform cannot compensate for the loss of the other VEGFA isoforms as an angiogenic regulator in endochondral bones, since the conditional loss of Vegfa in chondrocytes results in an angiogenic phenotype similar to the phenotype observed in mice that express only the 120 isoform (Fig. 2) (Maes et al., 2002Go; Zelzer et al., 2002Go). In contrast, the 120 isoform is clearly sufficient to compensate for the loss of other isoforms as a survival factor for chondrocytes, since the massive cell death observed in Vegfa CKO bones was not observed in Vegfa120 mice (Maes et al., 2002Go; Zelzer et al., 2002Go). Runx2 null bones represent the most severe example of a deficient angiogenic process in developing bones, since the hypertrophic zone is not invaded by blood vessels (Zelzer et al., 2001Go). This lack of endochondral angiogenesis in Runx2 null mice makes the mice useful for further studies aimed at identifying other components of the mechanism that regulates skeletal vascularization.

In conclusion, in this study we provide further in-vivo evidence for the important role of VEGFA in blood vessel invasion into hypertrophic cartilage during bone development. More importantly, we describe for the first time a connection between VEGFA and chondrocyte survival during skeletal development. The similarities in the phenotypes of Hif1a and Vegfa null bones, together with the in-vivo finding that HIF1{alpha} is a regulator of Vegfa expression, establishes that these two genes are part of a pathway that regulates chondrocyte survival.


    ACKNOWLEDGMENTS
 
We are grateful to Dr C. Tabin for the Prx1-Cre mice and Drs H. Kronenberg and T. Kobayashi for the Col2a1-Cre mice. We thank Ms S. Plotkina for expert technical support, Ms Y. Pittel for editorial assistance, and Dr W. McLean and other members of the Olsen laboratory for continuous advice and suggestions. The work was supported by NIH grants AR36819 and AR36820 (to B.R.O.)


    REFERENCES
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 

Bachelder, R. E., Crago, A., Chung, J., Wendt, M. A., Shaw, L. M., Robinson, G. and Mercurio, A. M. (2001). Vascular endothelial growth factor is an autocrine survival factor for neuropilin-expressing breast carcinoma cells. Cancer Res. 61,5736 -5740.[Abstract/Free Full Text]

Benjamin, L. E., Golijanin, D., Itin, A., Pode, D. and Keshet, E. (1999). Selective ablation of immature blood vessels in established human tumors follows vascular endothelial growth factor withdrawal. J. Clin. Invest. 103,159 -165.[Medline]

Bruick, R. K. and McKnight, S. L. (2001). A conserved family of prolyl-4-hydroxylases that modify HIF. Science 294,1337 -1340.[Abstract/Free Full Text]

Carmeliet, P., Ng, Y. S., Nuyens, D., Theilmeier, G., Brusselmans, K., Cornelissen, I., Ehler, E., Kakkar, V. V., Stalmans, I., Mattot, V. et al. (1999). Impaired myocardial angiogenesis and ischemic cardiomyopathy in mice lacking the vascular endothelial growth factor isoforms Vegf164 and Vegf188. Nat. Med. 5, 495-502.[CrossRef][Medline]

Cleaver, O. and Melton, D. A. (2003). Endothelial signaling during development. Nat. Med. 9, 661-668.[CrossRef][Medline]

Deckers, M. M., Karperien, M., van der Bent, C., Yamashita, T., Papapoulos, S. E. and Lowik, C. W. (2000). Expression of vascular endothelial growth factors and their receptors during osteoblast differentiation. Endocrinology 141,1667 -1674.[Abstract/Free Full Text]

Feldser, D., Agani, F., Iyer, N. V., Pak, B., Ferreira, G. and Semenza, G. L. (1999). Reciprocal positive regulation of hypoxia-inducible factor 1slpha and insulin-like growth factor 2. Cancer Res. 59,3915 -3918.[Abstract/Free Full Text]

Ferrara, N. and Davis-Smyth, T. (1997). The biology of vascular endothelial growth factor. Endocr. Rev. 18,4 -25.[Abstract/Free Full Text]

Ferrara, N., Gerber, H. P. and LeCouter, J. (2003). The biology of Vegf and its receptors. Nat. Med. 9,669 -676.[CrossRef][Medline]

Ferrara, N., Houck, K., Jakeman, L. and Leung, D. W. (1992). Molecular and biological properties of the vascular endothelial growth factor family of proteins. Endocr. Rev. 13,18 -32.[Abstract/Free Full Text]

Foster, R. R., Hole, R., Anderson, K., Satchell, S. C., Coward, R. J., Mathieson, P. W., Gillatt, D. A., Saleem, M. A., Bates, D. O. and Harper, S. J. (2003). Functional evidence that vascular endothelial growth factor may act as an autocrine factor on human podocytes. Am. J. Physiol. Renal Physiol. 284,F1263 -F1273.[Abstract/Free Full Text]

Gerber, H. P., Dixit, V. and Ferrara, N. (1998a). Vascular endothelial growth factor induces expression of the antiapoptotic proteins Bcl-2 and A1 in vascular endothelial cells. J. Biol. Chem. 273,13313 -13316.[Abstract/Free Full Text]

Gerber, H. P., Hillan, K. J., Ryan, A. M., Kowalski, J., Keller, G. A., Rangell, L., Wright, B. D., Radtke, F., Aguet, M. and Ferrara, N. (1999). Vegf is required for growth and survival in neonatal mice. Development 126,1149 -1159.[Abstract]

Gerber, H. P., Malik, A. K., Solar, G. P., Sherman, D., Liang, X. H., Meng, G., Hong, K., Marsters, J. C. and Ferrara, N. (2002). Vegf regulates haematopoietic stem cell survival by an internal autocrine loop mechanism. Nature 417,954 -958.[CrossRef][Medline]

Gerber, H. P., McMurtrey, A., Kowalski, J., Yan, M., Keyt, B. A., Dixit, V. and Ferrara, N. (1998b). Vascular endothelial growth factor regulates endothelial cell survival through the phosphatidylinositol 3'-kinase/Akt signal transduction pathway. Requirement for Flk-1/KDR activation. J. Biol. Chem. 273,30336 -30343.[Abstract/Free Full Text]

Haigh, J. J., Gerber, H. P., Ferrara, N. and Wagner, E. F. (2000). Conditional inactivation of Vegf-A in areas of collagen2a1 expression results in embryonic lethality in the heterozygous state. Development 127,1445 -1453.[Abstract]

Hall, B. K. and Miyake, T. (1992). The membranous skeleton: the role of cell condensations in vertebrate skeletogenesis. Anat. Embryol. 186,107 -124.[Medline]

Hartmann, C. and Tabin, C. J. (2000). Dual roles of wnt signaling during chondrogenesis in the chicken limb. Development 127,3141 -3159.[Abstract]

Ivan, M., Kondo, K., Yang, H., Kim, W., Valiando, J., Ohh, M., Salic, A., Asara, J. M., Lane, W. S. and Kaelin, W. G., Jr (2001). HIFalpha targeted for VHL-mediated destruction by proline hydroxylation: implications for O2 sensing. Science 292,464 -468.[Abstract/Free Full Text]

Ivkovic, S., Yoon, B. S., Popoff, S. N., Safadi, F. F., Libuda, D. E., Stephenson, R. C., Daluiski, A. and Lyons, K. M. (2003). Connective tissue growth factor coordinates chondrogenesis and angiogenesis during skeletal development. Development 130,2779 -2791.[Abstract/Free Full Text]

Jaakkola, P., Mole, D. R., Tian, Y. M., Wilson, M. I., Gielbert, J., Gaskell, S. J., Kriegsheim, A., Hebestreit, H. F., Mukherji, M., Schofield, C. J. et al. (2001). Targeting of HIF-alpha to the von Hippel-Lindau ubiquitylation complex by O2-regulated prolyl hydroxylation. Science 292,468 -472.[Abstract/Free Full Text]

Karsenty, G. (1999). The genetic transformation of bone biology. Genes. Dev. 13,3037 -3051.[Free Full Text]

Krishnamachary, B., Berg-Dixon, S., Kelly, B., Agani, F., Feldser, D., Ferreira, G., Iyer, N., LaRusch, J., Pak, B., Taghavi, P. et al. (2003). Regulation of colon carcinoma cell invasion by hypoxia-inducible factor 1. Cancer Res. 63,1138 -1143.[Abstract/Free Full Text]

Lammert, E., Cleaver, O. and Melton, D. (2001). Induction of pancreatic differentiation by signals from blood vessels. Science 294,564 -567.[Abstract/Free Full Text]

Logan, M., Martin, J. F., Nagy, A., Lobe, C., Olson, E. N. and Tabin, C. J. (2002). Expression of Cre recombinase in the developing mouse limb bud driven by a Prxl enhancer. Genesis 33,77 -80.[CrossRef][Medline]

Maes, C., Carmeliet, P., Moermans, K., Stockmans, I., Collen, D., Bouillon, R. and Carmeliet, G. (2002). Impaired angiogenesis and endochondral bone formation in mice lacking the vascular endothelial growth factor isoforms Vegf164 and Vegf188. Mech. Dev. 111,61 -73.[CrossRef][Medline]

Masson, N., Willam, C., Maxwell, P. H., Pugh, C. W. and Ratcliffe, P. J. (2001). Independent function of two destruction domains in hypoxia-inducible factor-alpha chains activated by prolyl hydroxylation. EMBO J. 20,5197 -5206.[CrossRef][Medline]

Matsumoto, K., Yoshitomi, H., Rossant, J. and Zaret, K. S. (2001). Liver organogenesis promoted by endothelial cells prior to vascular function. Science 294,559 -563.[Abstract/Free Full Text]

Maxwell, P. H., Pugh, C. W. and Ratcliffe, P. J. (1993). Inducible operation of the erythropoietin 3' enhancer in multiple cell lines: evidence for a widespread oxygen-sensing mechanism. Proc. Natl. Acad. Sci. USA 90,2423 -2427.[Abstract/Free Full Text]

McLeod, M. J. (1980). Differential staining of cartilage and bone in whole mouse fetuses by alcian blue and alizarin red S. Teratology 22,299 -301.[CrossRef][Medline]

Midy, V. and Plouet, J. (1994). Vasculotropin/vascular endothelial growth factor induces differentiation in cultured osteoblasts. Biochem. Biophys. Res. Commun. 199,380 -386.[CrossRef][Medline]

Olsen, B. R., Reginato, A. M. and Wang, W. (2000). Bone development. Annu. Rev. Cell Dev. 16,191 -220.[CrossRef][Medline]

Park, J. E., Keller, G. A. and Ferrara, N. (1993). The vascular endothelial growth factor (Vegf) isoforms: differential deposition into the subepithelial extracellular matrix and bioactivity of extracellular matrix-bound Vegf. Mol. Biol. Cell 4,1317 -1326.[Abstract]

Pfander, D., Cramer, T., Schipani, E. and Johnson, R. S. (2003). HIF-1alpha controls extracellular matrix synthesis by epiphyseal chondrocytes. J. Cell Sci. 116,1819 -1826.[Abstract/Free Full Text]

Pfander, D., Kobayashi, T., Knight, M. C., Zelzer, E., Chan, D. A., Olsen, B. R., Giaccia, A. J., Johnson, R. S., Haase, V. H. and Schipani, E. (2004). Deletion of Vhlh in chondrocytes reduces cell proliferation and increases matrix deposition during growth plate development. Development (in press).

Pugh, C. W. and Ratcliffe, P. J. (2003). Regulation of angiogenesis by hypoxia: role of the HIF system. Nat. Med. 9,677 -684.[CrossRef][Medline]

Schipani, E., Ryan, H. E., Didrickson, S., Kobayashi, T., Knight, M. and Johnson, R. S. (2001). Hypoxia in cartilage: HIF-1alpha is essential for chondrocyte growth arrest and survival. Genes Dev. 15,2865 -2876.[Abstract/Free Full Text]

Semenza, G. L. (2003). Targeting HIF-1 for cancer therapy. Nat. Rev. Cancer 3, 721-732.[CrossRef][Medline]

Semenza, G. L. and Wang, G. L. (1992). A nuclear factor induced by hypoxia via de novo protein synthesis binds to the human erythropoietin gene enhancer at a site required for transcriptional activation. Mol. Cell Biol. 12,5447 -5454.[Abstract/Free Full Text]

Shima, D. T., Adamis, A. P., Ferrara, N., Yeo, K. T., Yeo, T. K., Allende, R., Folkman, J. and D'Amore, P. A. (1995). Hypoxic induction of endothelial cell growth factors in retinal cells: identification and characterization of vascular endothelial growth factor (Vegf) as the mitogen. Mol. Med. 1, 182-193.[Medline]

Shima, D. T., Kuroki, M., Deutsch, U., Ng, Y. S., Adamis, A. P. and D'Amore, P. A. (1996). The mouse gene for vascular endothelial growth factor. Genomic structure, definition of the transcriptional unit, and characterization of transcriptional and post-transcriptional regulatory sequences. J. Biol. Chem. 271,3877 -3883.[Abstract/Free Full Text]

Wang, G. L. and Semenza, G. L. (1993). Characterization of hypoxia-inducible factor 1 and regulation of DAN binding activity by hypoxia. J. Biol. Chem. 268,21513 -21518.[Abstract/Free Full Text]

Wang, G. L. and Semenza, G. L. (1995). Purification and characterization of hypoxia-inducible factor 1. J. Biol. Chem. 270,1230 -1237.[Abstract/Free Full Text]

Wang, L., Zeng, H., Wang, P., Soker, S. and Mukhopadhyay, D. (2003). Neuropilin-1-mediated vascular permeability factor/vascular endothelial growth factor (VPF/Vegf)-dependent endothelial cell migration. J. Biol. Chem. 278,48848 -48860.[Abstract/Free Full Text]

Yu, F., White, S. B., Zhao, Q. and Lee, F. S. (2001). HIF-1alpha binding to VHL is regulated by stimulus-sensitive proline hydroxylation. Proc. Natl. Acad. Sci. USA 98,9630 -9635.[Abstract/Free Full Text]

Zelzer, E., Glotzer, D. J., Hartmann, C., Thomas, D., Fukai, N., Shay, S. and Olsen, B. R. T. (2001). Tissue specific regulation of Vegf expression by Cbfa1/Runx2 during bone development. Mech. Dev. 106,97 -106.[CrossRef][Medline]

Zelzer, E., Levy, Y., Kahana, C., Shilo, B. Z., Rubinstein, M. and Cohen, B. (1998). Insulin induces transcription of target genes through the hypoxia-inducible factor HIF-1alpha/ARNT. EMBO J. 17,5085 -5094.[CrossRef][Medline]

Zelzer, E., McLean, W., Ng, Y.-S., Fukai, N., Reginato, A. M., Lovejoy, S., D'Amore, P. A. and Olsen, B. (2002). Skeletal defects in Vegf120/120 mice reveal multiple roles for Vegf in skeletogenesis. Development 129,1893 -1904.


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
DevelopmentHome page
I. Eshkar-Oren, S. V. Viukov, S. Salameh, S. Krief, C.-d. Oh, H. Akiyama, H.-P. Gerber, N. Ferrara, and E. Zelzer
The forming limb skeleton serves as a signaling center for limb vasculature patterning via regulation of Vegf
Development, April 15, 2009; 136(8): 1263 - 1272.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. R. Cuddihy, S. Ge, J. Zhu, J. Jang, A. Chidgey, G. Thurston, R. Boyd, and G. M. Crooks
VEGF-mediated cross-talk within the neonatal murine thymus
Blood, March 19, 2009; 113(12): 2723 - 2731.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
G. Yang, Q. Sun, Y. Teng, F. Li, T. Weng, and X. Yang
PTEN deficiency causes dyschondroplasia in mice by enhanced hypoxia-inducible factor 1{alpha} signaling and endoplasmic reticulum stress
Development, November 1, 2008; 135(21): 3587 - 3597.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Shinoda, N. Ogata, A. Higashikawa, I. Manabe, T. Shindo, T. Yamada, F. Kugimiya, T. Ikeda, N. Kawamura, Y. Kawasaki, et al.
Kruppel-like Factor 5 Causes Cartilage Degradation through Transactivation of Matrix Metalloproteinase 9
J. Biol. Chem., September 5, 2008; 283(36): 24682 - 24689.
[Abstract] [Full Text] [PDF]


Home page
IBMS BoneKEyHome page
E. Schipani and T. L. Clemens
Hypoxia and the Hypoxia-Inducible Factors in the Skeleton
IBMS BoneKEy, August 1, 2008; 5(8): 275 - 284.
[Abstract] [Full Text] [PDF]


Home page
IBMS BoneKEyHome page
K. K. VanKoevering and B. O. Williams
Transgenic Mouse Strains for Conditional Gene Deletion During Skeletal Development
IBMS BoneKEy, May 1, 2008; 5(5): 151 - 170.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M. Chen, M. Zhu, H. Awad, T.-F. Li, T.-J. Sheu, B. F. Boyce, D. Chen, and R. J. O'Keefe
Inhibition of {beta}-catenin signaling causes defects in postnatal cartilage development
J. Cell Sci., May 1, 2008; 121(9): 1455 - 1465.
[Abstract] [Full Text] [PDF]


Home page
JDRHome page
J. Dai and A.B.M. Rabie
VEGF: an Essential Mediator of Both Angiogenesis and Endochondral Ossification
Journal of Dental Research, October 1, 2007; 86(10): 937 - 950.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
S. Provot, D. Zinyk, Y. Gunes, R. Kathri, Q. Le, H. M. Kronenberg, R. S. Johnson, M. T. Longaker, A. J. Giaccia, and E. Schipani
Hif-1{alpha} regulates differentiation of limb bud mesenchyme and joint development
J. Cell Biol., May 7, 2007; 177(3): 451 - 464.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
K. K. Mak, M.-H. Chen, T. F. Day, P.-T. Chuang, and Y. Yang
Wnt/{beta}-catenin signaling interacts differentially with Ihh signaling in controlling endochondral bone and synovial joint formation
Development, September 15, 2006; 133(18): 3695 - 3707.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
R. D. Ward, B. M. Stone, L. T. Raetzman, and S. A. Camper
Cell Proliferation and Vascularization in Mouse Models of Pituitary Hormone Deficiency
Mol. Endocrinol., June 1, 2006; 20(6): 1378 - 1390.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
Y. Macotela, M. B. Aguilar, J. Guzman-Morales, J. C. Rivera, C. Zermeno, F. Lopez-Barrera, G. Nava, C. Lavalle, G. M. de la Escalera, and C. Clapp
Matrix metalloproteases from chondrocytes generate an antiangiogenic 16 kDa prolactin
J. Cell Sci., May 1, 2006; 119(9): 1790 - 1800.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. R. Wedge, J. Kendrew, L. F. Hennequin, P. J. Valentine, S. T. Barry, S. R. Brave, N. R. Smith, N. H. James, M. Dukes, J. O. Curwen, et al.
AZD2171: A Highly Potent, Orally Bioavailable, Vascular Endothelial Growth Factor Receptor-2 Tyrosine Kinase Inhibitor for the Treatment of Cancer
Cancer Res., May 15, 2005; 65(10): 4389 - 4400.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Korc
Targeted Therapeutics in Pancreatic Cancer: A Ray of Hope
Clin. Cancer Res., January 1, 2005; 11(1): 410 - 411.
[Full Text] [PDF]


Home page
DevelopmentHome page
D. Stickens, D. J. Behonick, N. Ortega, B. Heyer, B. Hartenstein, Y. Yu, A. J. Fosang, M. Schorpp-Kistner, P. Angel, and Z. Werb
Altered endochondral bone development in matrix metalloproteinase 13-deficient mice
Development, December 1, 2004; 131(23): 5883 - 5895.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
D. Pfander, T. Kobayashi, M. C. Knight, E. Zelzer, D. A. Chan, B. R. Olsen, A. J. Giaccia, R. S. Johnson, V. H. Haase, and E. Schipani
Deletion of Vhlh in chondrocytes reduces cell proliferation and increases matrix deposition during growth plate development
Development, May 15, 2004; 131(10): 2497 - 2508.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dev.01053v1
131/9/2161    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zelzer, E.
Right arrow Articles by Olsen, B. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zelzer, E.
Right arrow Articles by Olsen, B. R.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?