|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 8 April 2004
doi: 10.1242/dev.01053
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Cell Biology, Harvard Medical School, Boston, MA 02115,
USA
2 Department of Surgical Research, Children's Hospital and Harvard Medical
School, Boston, MA 02115, USA
3 Department of Molecular Oncology, Genentech, South San Francisco, CA 94080,
USA
4 Molecular Biology Section, Division of Biology, University of California, San
Diego, CA 92093, USA
5 Endocrine Unit, Massachusetts General Hospital and Harvard Medical School,
Boston, MA 02114, USA
* Author for correspondence (e-mail: bjorn_olsen{at}hms.harvard.edu)
Accepted 30 December 2003
| SUMMARY |
|---|
|
|
|---|
(Hif1a)
expression was abolished in developing cartilage. This similarity of cell
death phenotypes and the deficient VEGFA production in Hif1a null
epiphyseal chondrocytes demonstrate that HIF1
and VEGFA are components
of a key pathway to support chondrocyte survival during embryonic bone
development.
Key words: Conditional knockout mice, VEGFA, Chondrocyte survival, Bone development, Angiogenesis, HIF1, HIF1
, VEGF
| Introduction |
|---|
|
|
|---|
Vascular endothelial growth factor A (VEGFA) is an important regulator of
angiogenesis during endochondral ossification. Inhibition of VEGFA by
administration of soluble chimeric VEGFA receptor protein to 24-day-old mice
inhibited blood vessel invasion into the hypertrophic zone of long bone growth
plates and resulted in impaired trabecular bone formation and the expansion of
the hypertrophic zone (Gerber et al.,
1999
). Further support for the role of VEGFA in angiogenesis of
hypertrophic cartilage came from studies of mice expressing only the VEGFA120
isoform of VEGFA (Maes et al.,
2002
; Zelzer et al.,
2002
).
VEGFA120 is one of three isoforms of VEGFA in the mouse
(Ferrara et al., 1992
;
Shima et al., 1996
). VEGFA120
does not bind heparan sulfate, while the other two isoforms, VEGFA164 and
VEGFA188, possess one or two heparin-binding domains, respectively, allowing
interactions with heparan sulfate (Ferrara
and Davis-Smyth, 1997
; Park et
al., 1993
). Unlike heterozygous Vegfa null mice, mice
that express only the 120 isoform survive through embryonic development
(Carmeliet et al., 1999
).
Studies of blood vessel invasion into the primary ossification centers in
VEGFA120 mice demonstrated a delay in vessel invasion and alterations in the
extent of expression of cartilage differentiation markers at E14.5, indicating
a role for VEGFA in cartilage angiogenesis and maturation
(Maes et al., 2002
;
Zelzer et al., 2002
). The
skeletons of VEGFA120 mice showed decreased mineralization and a reduction in
the expression of osteoblastic markers in membranous and endochondral bone.
This suggests that VEGFA has a direct effect on the activity of osteoblasts
(Zelzer et al., 2002
). There
is also evidence from in-vitro experiments that VEGFA may regulate bone
formation through a direct effect on osteoblasts
(Deckers et al., 2000
;
Midy and Plouet, 1994
).
Thus, VEGFA appears to have several functions during bone formation. In
this study, we report for the first time that VEGFA is critical for
chondrocyte survival. We demonstrate that VEGFA, in addition to its
upregulated expression in hypertrophic chondrocytes of long bone growth
plates, is expressed at moderate levels in epiphyseal chondrocytes, and that
these chondrocytes undergo massive cell death in the absence of VEGFA. Based
on the striking similarity in the cartilage phenotypes resulting from
inactivation of either Vegfa or hypoxia-inducible factor 1
(Hif1a) in chondrocytes, we conclude that the chondrocyte survival
function of VEGFA is controlled by HIF1
.
| Materials and methods |
|---|
|
|
|---|
Skeletal preparations
Cartilage and bones in whole mouse embryos (E18.5) were visualized after
staining with Alcian Blue and Alizarin Red S (Sigma) and clarification of soft
tissue with potassium hydroxide (McLeod,
1980
).
Histology and immunohistochemistry
For histological analysis, embryonic limbs and heads were fixed in 4%
paraformaldehyde and embedded in paraffin for sectioning using standard
procedures. Sections of 7 µm thickness were stained with hematoxylin and
eosin (H & E). For CD31 immunohistochemistry, embryos were fixed in 4%
paraformaldehyde, followed by 20% sucrose infiltration. Tissues were embedded
in OCT (Tissue-Tek®) and 7 µm cryostat sections were made. Sections
were incubated with monoclonal rat anti-mouse CD31 (BD PharMingen). Sections
were incubated with biotinylated anti-rat IgG (Vector Laboratories), and an
ABC kit (Vector Laboratories) was used for detection.
In situ hybridization and TUNEL assay
In situ hybridization was carried out on paraffin sections with
33P-labeled anti-sense RNA essentially as described
(Hartmann and Tabin, 2000
;
Zelzer et al., 2002
). For
TUNEL assay, paraffin sections were permeabilized with 0.1% Triton X-100 in
0.1% sodium citrate. TUNEL assay was performed using a Roche In situ Cell
Death Detection kit (Roche) according to the manufacturer's
recommendations.
Culture of primary epiphyseal chondrocytes
Epiphyseal chondrocytes were isolated from the knee joint region of newborn
mice. Skin, muscles and soft tissue were removed. DMEM containing 0.5 mg/ml
hyaluronidase (Sigma H-3506) was added and the tissue was digested for 30
minutes at 37°C on a rotating shaker. The medium was then replaced by
medium containing 1 mg/ml trypsin (Sigma T-1426) and incubation continued for
30 minutes at 37°C on a rotating shaker. The trypsin containing medium was
removed and cartilage was incubated twice with medium containing 1 mg/ml
bacterial collagenase (Sigma C-9263). Medium from the first incubation was
discarded after 20 minutes and then chondrocytes were isolated by collagenase
digestion for 2 hours at 37°C on a rotating shaker. The cells were passed
through a cell strainer (Falcon 352340) and were centrifuged at 400
g for 5 minutes. The cells were suspended in DMEM containing
10% FBS and 2% Penicillin/Streptomycin/Glutamine, plated at a density of 5
x 105 cells/well in a 24-well plate and incubated at 37°C
overnight.
Gene-specific RT-PCR analysis
Total RNA was extracted from cultured primary mouse epiphyseal chondrocytes
using Rneasy kit (Qiagen 74104). Five micrograms of total RNA were treated
with DNA-Free RNA Kit (Zymo Research) and reverse transcribed with Superscript
II First Strand Synthesis System for RT-PCR (Invitrogen). All genes were
amplified using Taq DNA polymerase (Roche) for 35 cycles and PCR products were
fractionated by gel electrophoresis. The primers used for the PCR
amplification were 5'CACAGATAAGCCCACCAGAG3' and
5'GACAACCACCGCAATGA3' for Cd31;
5'GGCTCAGGGTCGAAGTTAAAAGTGCCT3' and
5'TAGGATTGTATTGGTCTGCCGATGGGT3' for VEGFAr1;
5'CTCTGTGGGTTTGCCTGGCGATTTTCT3' and
5'GCGGATCACCACAGTTTTGTTCTTGTT3' for Vegfr2;
5'GCTGGCAGGAGGAGGAA3' and 5'TCCCGCTGTCTGTCTGGTTA3' for
Vegfr3; 5'TCCCGCCTGAACTACCCTGAA3' and
5'GCCTTGCGCTTGCTGTCATC3' for neuropilin 1;
5'CCCCGAACCCAACCAGAAGA3' and 5'GAATGCCATCCCAGATGTCCA3'
for neuropilin 2.
| Results |
|---|
|
|
|---|
Lack of VEGFA in chondrocytes leads to impaired embryonic bone development
Staining of skeletons of mice that were heterozygous for both
floxed-Vegfa and Col2a1-Cre alleles (unaffected) and mice
that were heterozygous for Col2a1-Cre and homozygous for the
floxed-Vegfa alleles (conditional knockout, CKO) with Alizarin Red
and Alcian Blue showed that the Alizarin Red-stained zones were reduced in the
Vegfa CKO mice at E18.5, suggesting a reduction in mineralization
(Fig. 1). This reduction was
observed in long bones in the limbs (Fig.
1B), in ribs (Fig.
1D), in sternum (Fig.
1F), and in the bones of the vertebral column
(Fig. 1H). Furthermore, the
cartilaginous parts were smaller and stained less intensely for Alcian Blue in
the CKO tissues, suggesting a cartilage abnormality.
|
|
|
Loss of VEGFA in chondrocytes results in massive cell death
Histological studies of Vegfa CKO femurs at E16.5 revealed a zone
of large, balloon-like cells, poorly stained and with a `ghost'-like
appearance, at the center of the epiphysis
(Fig. 4A,B). There was some
variation in the severity of the abnormalities, with the distal limb bones
showing the highest degree of abnormality. In the distal bones at E18.5,
extensive regions of dead cells were observed
(Fig. 4C,D). These regions of
cell death were located in the central regions of the skeletal elements,
starting at an articular surface and continuing through the resting to the
proliferating zones of chondrocytes and ending in a misshapen growth plate.
Depending on the severity of the phenotype, the growth plate was dramatically
affected and hypertrophic chondrocytes of normal shape were almost completely
missing. Outside the center of the growth plates, proliferating cells appeared
to accumulate (Fig. 4D). These
zones of proliferating cells were much more extended in Vegfa CKO
than in unaffected growth plates.
|
|
|
|
is involved in chondrocyte differentiation
may therefore play a role in chondrocyte differentiation. To
analyze this possibility further, we studied chondrocyte differentiation in
Hif1a CKO mice by following the temporal expression of cartilage
differentiation markers (Fig.
8). At E15.5, Col10a1 expression was reduced in the most
mature (terminally differentiated) hypertrophic chondrocytes of unaffected
bones. In contrast, in the Hif1a CKO tissue the expression of
Col10a1 was still prominent in the hypertrophic zone
(Fig. 8A,B). Differences in the
expression of Pthr1 and Ihh further support the possibility
that differentiation is delayed in Hif1a CKO chondrocytes. In the
unaffected bones, the expression of these two markers was reduced in the
terminally differentiated hypertrophic chondrocytes, but most of the
hypertrophic chondrocytes still expressed Pthr1 and Ihh in
the Hif1a CKO bones (Fig.
8C-F). These results indicate that HIF1
has a role in
chondrocyte differentiation within long bone growth plates.
|
|
|
| Discussion |
|---|
|
|
|---|
, a well-known regulator of VEGFA, and VEGFA are
critical for chondrocyte survival during bone formation.
Hif1
and Vegfa are part of a chondrocyte survival pathway
HIF1
regulates the transcription of a broad range of genes that are
involved in a variety of processes such as glucose metabolism, angiogenesis
and cell survival (Pugh and Ratcliffe,
2003
; Semenza,
2003
). Several stimuli, such as hypoxia, hormones and growth
factors, induce stabilization of the HIF1 heterodimeric transcription complex.
This complex is composed of HIF1
and HIF1ß. HIF1ß is
constitutively expressed, whereas HIF1
is tightly regulated
(Maxwell et al., 1993
;
Semenza and Wang, 1992
;
Wang and Semenza, 1993
;
Wang and Semenza, 1995
;
Zelzer et al., 1998
); the
tumor-suppressor protein von Hippel-Lindau (VHL) protein is a key element in
this regulation (Bruick and McKnight,
2001
; Ivan et al.,
2001
; Jaakkola et al.,
2001
; Masson et al.,
2001
; Yu et al.,
2001
).
HIF1
is known to be a regulator of VEGFA in many systems
(Shima et al., 1995
). However,
in hypertrophic chondrocytes of Hif1a CKO growth plates,
Vegfa expression was comparable to the expression in unaffected,
control growth plates at E15.5 (Fig.
6). This suggests that Vegfa expression is not dependent
on Hif1a in hypertrophic chondrocytes, at least at that stage of
development. Runx2 and Ctgf are two genes that may be
involved in the regulation of VEGFA at that stage or later, since
Vegfa expression in the hypertrophic zones of Runx2 and
Ctgf null embryos is decreased
(Ivkovic et al., 2003
;
Zelzer et al., 2001
)
(Fig. 11). In epiphyseal
chondrocytes Hif1a may well be a major regulator of Vegfa
expression, since the expression of Vegfa was dramatically reduced at
E18.5 in Hif1a CKO bones (Fig.
6F). The important role of Hif1a in regulating expression
of Vegfa in epiphyseal chondrocytes is further demonstrated by the
recent analysis of the phenotype of mice that are homozygous for VHL
null alleles in chondrocytes (Pfander et
al., 2004
). In these VHL conditional knockout mice, levels of
hydroxylated HIF1
protein are elevated and expression of Vegfa
is enhanced in epiphyseal cartilage.
|
regulates Vegfa expression in
a chondrocyte survival pathway (Fig.
11). Interestingly, there is a time difference in the appearance
of the cell death phenotype in the two conditional knockouts. The cell death
phenotype appears at E14.5 in bones of Hif1a CKO mice
(Schipani et al., 2001
is known to regulate the
expression of many genes that have a role in cell survival, including
Igf2 and Tgfa (Feldser et
al., 1999
is independent of VEGFA at E14.5 but becomes dependent on VEGFA
later at E16.5, when Vegfa expression in epiphyseal chondrocytes can
be detected (Fig. 6).
Although VEGFA is best known for its activity as an angiogenic factor
(Ferrara et al., 2003
), it has
been shown to be a survival factor for endothelial and hematopoietic stem
cells (Benjamin et al., 1999
;
Gerber et al., 1998a
;
Gerber et al., 2002
;
Gerber et al., 1998b
), and
here we describe a role for VEGFA in supporting chondrocyte survival. We
cannot at present rule out the possibility that Vegfa expression in
the epiphyseal chondrocytes regulates some aspect of vascularization in the
vicinity of the epiphysis (with secondary consequences for the survival of
epiphyseal chondrocytes), but we favor the view that VEGFA has a direct role
in chondrocyte survival. First, epiphyseal chondrocytes express three
receptors for VEGFA, namely Vegfr3, Nrp1 and Nrp2,
suggesting that VEGFA can initiate signaling in these cells. Interestingly, it
was recently demonstrated that Nrp1 can, independently of other receptors,
initiate cell signaling (Bachelder et al.,
2001
; Foster et al.,
2003
; Wang et al.,
2003
). Secondly, cell death in the Prx1/Vegfa
CKO epiphyseal cartilage was observed at E16.5
(Fig. 5H), the stage at which
we identified cell death in the Col2a1/Vegfa CKO mice,
suggesting that VEGFA is needed for chondrocyte survival at a specific
developmental time. This finding is particularly important, since the
cartilaginous elements in the Prx1/Vegfa CKO are
significantly smaller than in the Col2a1/Vegfa CKO mice,
suggesting that the cell death cannot be a simple consequence of a deficient
diffusion of nutrients and oxygen into the epiphysis. Consistent with this
interpretation is the recent report that incubation of chondrocytes in hypoxic
conditions did not cause cell death
(Pfander et al., 2003
).
Finally, when we analyzed vascularization in the vicinity of the cartilaginous
elements to examine a possible reduction in vessel numbers before cell death
occurs in the Vegfa CKO mice, we failed to observe any obvious
difference between unaffected and Vegfa CKO limbs.
Several studies have recently suggested a role for VEGFA during organ
development as a mediator of cell-cell interactions between endothelial and
parenchymal cells (Cleaver and Melton,
2003
). We have therefore considered the possibility that the role
of VEGFA in supporting survival of epiphyseal chondrocytes may somehow involve
an interaction with endothelial cells in the vicinity of the cartilage. During
development of pancreas and liver there is a close physical interaction
between endothelial and endodermal cells and VEGFA was demonstrated to have an
important role in interactions that led to development of these organs
(Lammert et al., 2001
;
Matsumoto et al., 2001
). Since
chondrocyte differentiation and cartilage formation take place in an
endothelium-free environment, any involvement of endothelial cells in the
HIF1
/VEGFA chondrocyte survival pathway would have to include
long-range interactions.
VEGFA regulation of bone vascularity
Blood vessel invasion into the primary ossification center is a key step in
bone development. In this study we have provided further in-vivo evidence that
VEGFA is required for angiogenesis into the primary ossification center and
the maintenance of blood vessel growth in developing bones. At E15, vessels
are invading hypertrophic cartilage, and as development proceeds, the vessels
continue to grow under the growth plates as hypertrophic chondrocytes are
being removed. In the Vegfa CKO bones, there is a delay in blood
vessel invasion into the primary ossification center
(Fig. 2), and accumulation of
terminally differentiated chondrocytes in growth plates suggests a reduction
of vessel sprouting and cartilage removal
(Fig. 3). Since the angiogenic
process in the Vegfa CKO bones was not completely abolished, we
consider the possibility that VEGFA is not the only factor regulating the
process of endochondral angiogenesis, although it is also possible that the
Cre was less than fully efficient in generating a chondrocyte-specific
Vegfa null phenotype. However, comparing the phenotypes of the
Vegfa CKO and the Vegfa120 mice clearly demonstrates that
the 120 isoform cannot compensate for the loss of the other VEGFA isoforms as
an angiogenic regulator in endochondral bones, since the conditional loss of
Vegfa in chondrocytes results in an angiogenic phenotype similar to
the phenotype observed in mice that express only the 120 isoform
(Fig. 2) (Maes et al., 2002
;
Zelzer et al., 2002
). In
contrast, the 120 isoform is clearly sufficient to compensate for the loss of
other isoforms as a survival factor for chondrocytes, since the massive cell
death observed in Vegfa CKO bones was not observed in
Vegfa120 mice (Maes et al.,
2002
; Zelzer et al.,
2002
). Runx2 null bones represent the most severe example
of a deficient angiogenic process in developing bones, since the hypertrophic
zone is not invaded by blood vessels
(Zelzer et al., 2001
). This
lack of endochondral angiogenesis in Runx2 null mice makes the mice
useful for further studies aimed at identifying other components of the
mechanism that regulates skeletal vascularization.
In conclusion, in this study we provide further in-vivo evidence for the
important role of VEGFA in blood vessel invasion into hypertrophic cartilage
during bone development. More importantly, we describe for the first time a
connection between VEGFA and chondrocyte survival during skeletal development.
The similarities in the phenotypes of Hif1a and Vegfa null
bones, together with the in-vivo finding that HIF1
is a regulator of
Vegfa expression, establishes that these two genes are part of a
pathway that regulates chondrocyte survival.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Bachelder, R. E., Crago, A., Chung, J., Wendt, M. A., Shaw, L.
M., Robinson, G. and Mercurio, A. M. (2001). Vascular
endothelial growth factor is an autocrine survival factor for
neuropilin-expressing breast carcinoma cells. Cancer
Res. 61,5736
-5740.
Benjamin, L. E., Golijanin, D., Itin, A., Pode, D. and Keshet,
E. (1999). Selective ablation of immature blood vessels in
established human tumors follows vascular endothelial growth factor
withdrawal. J. Clin. Invest.
103,159
-165.[Medline]
Bruick, R. K. and McKnight, S. L. (2001). A
conserved family of prolyl-4-hydroxylases that modify HIF.
Science 294,1337
-1340.
Carmeliet, P., Ng, Y. S., Nuyens, D., Theilmeier, G.,
Brusselmans, K., Cornelissen, I., Ehler, E., Kakkar, V. V., Stalmans, I.,
Mattot, V. et al. (1999). Impaired myocardial angiogenesis
and ischemic cardiomyopathy in mice lacking the vascular endothelial growth
factor isoforms Vegf164 and Vegf188. Nat. Med.
5, 495-502.[CrossRef][Medline]
Cleaver, O. and Melton, D. A. (2003).
Endothelial signaling during development. Nat. Med.
9, 661-668.[CrossRef][Medline]
Deckers, M. M., Karperien, M., van der Bent, C., Yamashita, T.,
Papapoulos, S. E. and Lowik, C. W. (2000). Expression of
vascular endothelial growth factors and their receptors during osteoblast
differentiation. Endocrinology
141,1667
-1674.
Feldser, D., Agani, F., Iyer, N. V., Pak, B., Ferreira, G. and
Semenza, G. L. (1999). Reciprocal positive regulation of
hypoxia-inducible factor 1slpha and insulin-like growth factor 2.
Cancer Res. 59,3915
-3918.
Ferrara, N. and Davis-Smyth, T. (1997). The
biology of vascular endothelial growth factor. Endocr.
Rev. 18,4
-25.
Ferrara, N., Gerber, H. P. and LeCouter, J.
(2003). The biology of Vegf and its receptors. Nat.
Med. 9,669
-676.[CrossRef][Medline]
Ferrara, N., Houck, K., Jakeman, L. and Leung, D. W.
(1992). Molecular and biological properties of the vascular
endothelial growth factor family of proteins. Endocr.
Rev. 13,18
-32.
Foster, R. R., Hole, R., Anderson, K., Satchell, S. C., Coward,
R. J., Mathieson, P. W., Gillatt, D. A., Saleem, M. A., Bates, D. O. and
Harper, S. J. (2003). Functional evidence that vascular
endothelial growth factor may act as an autocrine factor on human podocytes.
Am. J. Physiol. Renal Physiol.
284,F1263
-F1273.
Gerber, H. P., Dixit, V. and Ferrara, N.
(1998a). Vascular endothelial growth factor induces expression of
the antiapoptotic proteins Bcl-2 and A1 in vascular endothelial cells.
J. Biol. Chem. 273,13313
-13316.
Gerber, H. P., Hillan, K. J., Ryan, A. M., Kowalski, J., Keller,
G. A., Rangell, L., Wright, B. D., Radtke, F., Aguet, M. and Ferrara, N.
(1999). Vegf is required for growth and survival in neonatal
mice. Development 126,1149
-1159.[Abstract]
Gerber, H. P., Malik, A. K., Solar, G. P., Sherman, D., Liang,
X. H., Meng, G., Hong, K., Marsters, J. C. and Ferrara, N.
(2002). Vegf regulates haematopoietic stem cell survival by an
internal autocrine loop mechanism. Nature
417,954
-958.[CrossRef][Medline]
Gerber, H. P., McMurtrey, A., Kowalski, J., Yan, M., Keyt, B.
A., Dixit, V. and Ferrara, N. (1998b). Vascular endothelial
growth factor regulates endothelial cell survival through the
phosphatidylinositol 3'-kinase/Akt signal transduction pathway.
Requirement for Flk-1/KDR activation. J. Biol. Chem.
273,30336
-30343.
Haigh, J. J., Gerber, H. P., Ferrara, N. and Wagner, E. F.
(2000). Conditional inactivation of Vegf-A in areas of
collagen2a1 expression results in embryonic lethality in the heterozygous
state. Development 127,1445
-1453.[Abstract]
Hall, B. K. and Miyake, T. (1992). The
membranous skeleton: the role of cell condensations in vertebrate
skeletogenesis. Anat. Embryol.
186,107
-124.[Medline]
Hartmann, C. and Tabin, C. J. (2000). Dual
roles of wnt signaling during chondrogenesis in the chicken limb.
Development 127,3141
-3159.[Abstract]
Ivan, M., Kondo, K., Yang, H., Kim, W., Valiando, J., Ohh, M.,
Salic, A., Asara, J. M., Lane, W. S. and Kaelin, W. G., Jr
(2001). HIFalpha targeted for VHL-mediated destruction by proline
hydroxylation: implications for O2 sensing. Science
292,464
-468.
Ivkovic, S., Yoon, B. S., Popoff, S. N., Safadi, F. F., Libuda,
D. E., Stephenson, R. C., Daluiski, A. and Lyons, K. M.
(2003). Connective tissue growth factor coordinates
chondrogenesis and angiogenesis during skeletal development.
Development 130,2779
-2791.
Jaakkola, P., Mole, D. R., Tian, Y. M., Wilson, M. I., Gielbert,
J., Gaskell, S. J., Kriegsheim, A., Hebestreit, H. F., Mukherji, M.,
Schofield, C. J. et al. (2001). Targeting of HIF-alpha to the
von Hippel-Lindau ubiquitylation complex by O2-regulated prolyl
hydroxylation. Science
292,468
-472.
Karsenty, G. (1999). The genetic transformation
of bone biology. Genes. Dev.
13,3037
-3051.
Krishnamachary, B., Berg-Dixon, S., Kelly, B., Agani, F.,
Feldser, D., Ferreira, G., Iyer, N., LaRusch, J., Pak, B., Taghavi, P. et
al. (2003). Regulation of colon carcinoma cell invasion by
hypoxia-inducible factor 1. Cancer Res.
63,1138
-1143.
Lammert, E., Cleaver, O. and Melton, D. (2001).
Induction of pancreatic differentiation by signals from blood vessels.
Science 294,564
-567.
Logan, M., Martin, J. F., Nagy, A., Lobe, C., Olson, E. N. and
Tabin, C. J. (2002). Expression of Cre recombinase in the
developing mouse limb bud driven by a Prxl enhancer.
Genesis 33,77
-80.[CrossRef][Medline]
Maes, C., Carmeliet, P., Moermans, K., Stockmans, I., Collen,
D., Bouillon, R. and Carmeliet, G. (2002). Impaired
angiogenesis and endochondral bone formation in mice lacking the vascular
endothelial growth factor isoforms Vegf164 and Vegf188. Mech.
Dev. 111,61
-73.[CrossRef][Medline]
Masson, N., Willam, C., Maxwell, P. H., Pugh, C. W. and
Ratcliffe, P. J. (2001). Independent function of two
destruction domains in hypoxia-inducible factor-alpha chains activated by
prolyl hydroxylation. EMBO J.
20,5197
-5206.[CrossRef][Medline]
Matsumoto, K., Yoshitomi, H., Rossant, J. and Zaret, K. S.
(2001). Liver organogenesis promoted by endothelial cells prior
to vascular function. Science
294,559
-563.
Maxwell, P. H., Pugh, C. W. and Ratcliffe, P. J.
(1993). Inducible operation of the erythropoietin 3'
enhancer in multiple cell lines: evidence for a widespread oxygen-sensing
mechanism. Proc. Natl. Acad. Sci. USA
90,2423
-2427.
McLeod, M. J. (1980). Differential staining of
cartilage and bone in whole mouse fetuses by alcian blue and alizarin red S.
Teratology 22,299
-301.[CrossRef][Medline]
Midy, V. and Plouet, J. (1994).
Vasculotropin/vascular endothelial growth factor induces differentiation in
cultured osteoblasts. Biochem. Biophys. Res. Commun.
199,380
-386.[CrossRef][Medline]
Olsen, B. R., Reginato, A. M. and Wang, W.
(2000). Bone development. Annu. Rev. Cell
Dev. 16,191
-220.[CrossRef][Medline]
Park, J. E., Keller, G. A. and Ferrara, N.
(1993). The vascular endothelial growth factor (Vegf) isoforms:
differential deposition into the subepithelial extracellular matrix and
bioactivity of extracellular matrix-bound Vegf. Mol. Biol.
Cell 4,1317
-1326.[Abstract]
Pfander, D., Cramer, T., Schipani, E. and Johnson, R. S.
(2003). HIF-1alpha controls extracellular matrix synthesis by
epiphyseal chondrocytes. J. Cell Sci.
116,1819
-1826.
Pfander, D., Kobayashi, T., Knight, M. C., Zelzer, E., Chan, D.
A., Olsen, B. R., Giaccia, A. J., Johnson, R. S., Haase, V. H. and Schipani,
E. (2004). Deletion of Vhlh in chondrocytes reduces cell
proliferation and increases matrix deposition during growth plate development.
Development (in press).
Pugh, C. W. and Ratcliffe, P. J. (2003).
Regulation of angiogenesis by hypoxia: role of the HIF system. Nat.
Med. 9,677
-684.[CrossRef][Medline]
Schipani, E., Ryan, H. E., Didrickson, S., Kobayashi, T.,
Knight, M. and Johnson, R. S. (2001). Hypoxia in cartilage:
HIF-1alpha is essential for chondrocyte growth arrest and survival.
Genes Dev. 15,2865
-2876.
Semenza, G. L. (2003). Targeting HIF-1 for
cancer therapy. Nat. Rev. Cancer
3, 721-732.[CrossRef][Medline]
Semenza, G. L. and Wang, G. L. (1992). A
nuclear factor induced by hypoxia via de novo protein synthesis binds to the
human erythropoietin gene enhancer at a site required for transcriptional
activation. Mol. Cell Biol.
12,5447
-5454.
Shima, D. T., Adamis, A. P., Ferrara, N., Yeo, K. T., Yeo, T.
K., Allende, R., Folkman, J. and D'Amore, P. A. (1995).
Hypoxic induction of endothelial cell growth factors in retinal cells:
identification and characterization of vascular endothelial growth factor
(Vegf) as the mitogen. Mol. Med.
1, 182-193.[Medline]
Shima, D. T., Kuroki, M., Deutsch, U., Ng, Y. S., Adamis, A. P.
and D'Amore, P. A. (1996). The mouse gene for vascular
endothelial growth factor. Genomic structure, definition of the
transcriptional unit, and characterization of transcriptional and
post-transcriptional regulatory sequences. J. Biol.
Chem. 271,3877
-3883.
Wang, G. L. and Semenza, G. L. (1993).
Characterization of hypoxia-inducible factor 1 and regulation of DAN binding
activity by hypoxia. J. Biol. Chem.
268,21513
-21518.
Wang, G. L. and Semenza, G. L. (1995).
Purification and characterization of hypoxia-inducible factor 1. J.
Biol. Chem. 270,1230
-1237.
Wang, L., Zeng, H., Wang, P., Soker, S. and Mukhopadhyay, D.
(2003). Neuropilin-1-mediated vascular permeability
factor/vascular endothelial growth factor (VPF/Vegf)-dependent endothelial
cell migration. J. Biol. Chem.
278,48848
-48860.
Yu, F., White, S. B., Zhao, Q. and Lee, F. S.
(2001). HIF-1alpha binding to VHL is regulated by
stimulus-sensitive proline hydroxylation. Proc. Natl. Acad. Sci.
USA 98,9630
-9635.
Zelzer, E., Glotzer, D. J., Hartmann, C., Thomas, D., Fukai, N.,
Shay, S. and Olsen, B. R. T. (2001). Tissue specific
regulation of Vegf expression by Cbfa1/Runx2 during bone development.
Mech. Dev. 106,97
-106.[CrossRef][Medline]
Zelzer, E., Levy, Y., Kahana, C., Shilo, B. Z., Rubinstein, M.
and Cohen, B. (1998). Insulin induces transcription of target
genes through the hypoxia-inducible factor HIF-1alpha/ARNT. EMBO
J. 17,5085
-5094.[CrossRef][Medline]
Zelzer, E., McLean, W., Ng, Y.-S., Fukai, N., Reginato, A. M.,
Lovejoy, S., D'Amore, P. A. and Olsen, B. (2002). Skeletal
defects in Vegf120/120 mice reveal multiple roles for Vegf in skeletogenesis.
Development 129,1893
-1904.
This article has been cited by other articles:
![]() |
C. L. Hammond and S. Schulte-Merker Two populations of endochondral osteoblasts with differential sensitivity to Hedgehog signalling Development, December 1, 2009; 136(23): 3991 - 4000. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Eshkar-Oren, S. V. Viukov, S. Salameh, S. Krief, C.-d. Oh, H. Akiyama, H.-P. Gerber, N. Ferrara, and E. Zelzer The forming limb skeleton serves as a signaling center for limb vasculature patterning via regulation of Vegf Development, April 15, 2009; 136(8): 1263 - 1272. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. Cuddihy, S. Ge, J. Zhu, J. Jang, A. Chidgey, G. Thurston, R. Boyd, and G. M. Crooks VEGF-mediated cross-talk within the neonatal murine thymus Blood, March 19, 2009; 113(12): 2723 - 2731. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Yang, Q. Sun, Y. Teng, F. Li, T. Weng, and X. Yang PTEN deficiency causes dyschondroplasia in mice by enhanced hypoxia-inducible factor 1{alpha} signaling and endoplasmic reticulum stress Development, November 1, 2008; 135(21): 3587 - 3597. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Shinoda, N. Ogata, A. Higashikawa, I. Manabe, T. Shindo, T. Yamada, F. Kugimiya, T. Ikeda, N. Kawamura, Y. Kawasaki, et al. Kruppel-like Factor 5 Causes Cartilage Degradation through Transactivation of Matrix Metalloproteinase 9 J. Biol. Chem., September 5, 2008; 283(36): 24682 - 24689. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Schipani and T. L. Clemens Hypoxia and the Hypoxia-Inducible Factors in the Skeleton IBMS BoneKEy, August 1, 2008; 5(8): 275 - 284. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. K. VanKoevering and B. O. Williams Transgenic Mouse Strains for Conditional Gene Deletion During Skeletal Development IBMS BoneKEy, May 1, 2008; 5(5): 151 - 170. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Chen, M. Zhu, H. Awad, T.-F. Li, T.-J. Sheu, B. F. Boyce, D. Chen, and R. J. O'Keefe Inhibition of {beta}-catenin signaling causes defects in postnatal cartilage development J. Cell Sci., May 1, 2008; 121(9): 1455 - 1465. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Dai and A.B.M. Rabie VEGF: an Essential Mediator of Both Angiogenesis and Endochondral Ossification Journal of Dental Research, October 1, 2007; 86(10): 937 - 950. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Provot, D. Zinyk, Y. Gunes, R. Kathri, Q. Le, H. M. Kronenberg, R. S. Johnson, M. T. Longaker, A. J. Giaccia, and E. Schipani Hif-1{alpha} regulates differentiation of limb bud mesenchyme and joint development J. Cell Biol., May 7, 2007; 177(3): 451 - 464. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. K. Mak, M.-H. Chen, T. F. Day, P.-T. Chuang, and Y. Yang Wnt/{beta}-catenin signaling interacts differentially with Ihh signaling in controlling endochondral bone and synovial joint formation Development, September 15, 2006; 133(18): 3695 - 3707. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. D. Ward, B. M. Stone, L. T. Raetzman, and S. A. Camper Cell Proliferation and Vascularization in Mouse Models of Pituitary Hormone Deficiency Mol. Endocrinol., June 1, 2006; 20(6): 1378 - 1390. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Macotela, M. B. Aguilar, J. Guzman-Morales, J. C. Rivera, C. Zermeno, F. Lopez-Barrera, G. Nava, C. Lavalle, G. M. de la Escalera, and C. Clapp Matrix metalloproteases from chondrocytes generate an antiangiogenic 16 kDa prolactin J. Cell Sci., May 1, 2006; 119(9): 1790 - 1800. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Wedge, J. Kendrew, L. F. Hennequin, P. J. Valentine, S. T. Barry, S. R. Brave, N. R. Smith, N. H. James, M. Dukes, J. O. Curwen, et al. AZD2171: A Highly Potent, Orally Bioavailable, Vascular Endothelial Growth Factor Receptor-2 Tyrosine Kinase Inhibitor for the Treatment of Cancer Cancer Res., May 15, 2005; 65(10): 4389 - 4400. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Korc Targeted Therapeutics in Pancreatic Cancer: A Ray of Hope Clin. Cancer Res., January 1, 2005; 11(1): 410 - 411. [Full Text] [PDF] |
||||
![]() |
D. Stickens, D. J. Behonick, N. Ortega, B. Heyer, B. Hartenstein, Y. Yu, A. J. Fosang, M. Schorpp-Kistner, P. Angel, and Z. Werb Altered endochondral bone development in matrix metalloproteinase 13-deficient mice Development, December 1, 2004; 131(23): 5883 - 5895. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Pfander, T. Kobayashi, M. C. Knight, E. Zelzer, D. A. Chan, B. R. Olsen, A. J. Giaccia, R. S. Johnson, V. H. Haase, and E. Schipani Deletion of Vhlh in chondrocytes reduces cell proliferation and increases matrix deposition during growth plate development Development, May 15, 2004; 131(10): 2497 - 2508. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||