|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 8 April 2004
doi: 10.1242/dev.01094
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Herman B Wells Center for Pediatric Research, Department of Pediatrics,
Indiana University School of Medicine, Indianapolis, IN 46202, USA
2 Department of Experimental Biology, University of Jaen, Jaen 23071,
Spain
3 Department of Medicine, University of California San Diego, La Jolla, CA
92093, USA
4 Department of Pharmacology and Cancer Biology, Duke University Medical Center,
Durham, NC 27708, USA
5 Department of Medicine, Baylor College of Medicine, Houston, TX 77030,
USA
* Author for correspondence (e-mail: wshou{at}iupui.edu)
Accepted 7 January 2004
| SUMMARY |
|---|
|
|
|---|
Key words: BMP10, p57kip2, NKX2.5, MEF2C, Cardiac growth, Ventricular trabeculation, Compaction
| Introduction |
|---|
|
|
|---|
Ventricular trabeculation and compaction are important morphogenetic
processes and are closely associated with cardiac growth regulation at
mid-gestation (Rumyantsev,
1991
; Icardo,
1984
). At the final stage of cardiac looping (E9.0-E9.5),
initially the endocardium penetrates through the cardiac jelly and evaginates
at discrete points of myocardium to form `outpockets' directed toward the
myocardium. These endocardium outpockets initiate the cardiac trabeculation.
Further expansion of primitive trabecular myocardium between E9.5 and E13.5,
via either myocyte recruitment or proliferation, is an important step in
generating matured trabeculae. Later in development (E14.5-E15.5), trabecular
myocytes in the developing myocardium undergo `compaction' and gradually
become part of compact wall, papillary muscles, interventricular septum and
conductive system cells (Moorman and
Lamers, 1999
), respectively. One of the scientific challenges is
to determine the molecular mechanism by which cardiac trabeculation and
subsequent compaction are regulated. Several endocardial growth factors
required for the development of trabeculae, such as neuregulin
(Meyer and Birchmeier, 1995
)
and its receptors ErbB (Gassmann et al.,
1995
; Lee et al.,
1995
), vascular endothelial growth factor (VEGF)
(Ferrara et al., 1996
), and
angiopoietin-1 (Suri et al.,
1996
), have been identified. Mutant mice deficient in these genes
have severe defects in ventricular trabeculation. However, more detailed
analysis is still required to determine their precise role in the process of
ventricular trabeculation and compaction.
Bone morphogenetic proteins (BMPs), named for their initial biological
activity of inducing ectopic bone formation, belong to the transforming growth
factor ß (TGFß) superfamily. They mediate a diverse spectrum of
developmental events throughout evolution in species ranging between insects
and mammals (for a review, see Ducy and
Karsenty, 2000
; Nakayama et
al., 2000
). BMP signals have been shown to link multiple steps of
cardiac development, including cardiogenic induction and endocardial cushion
formation (for a review, see Schneider et
al., 2003
). Unlike other BMPs, BMP10 expression is restricted to
the developing and postnatal heart
(Neuhaus et al., 1999
). The
most interesting feature of BMP10 is its transient presence in the developing
trabecular myocardium. In this study, we found that BMP10 was upregulated in
trabecular myocardium of genetically manipulated mutant mice deficient in
FK506 binding protein 12 (FKBP12) (Shou et
al., 1998
). FKBP12 is able to bind type I receptors for
BMP/Activin/TGFß and possibly plays a role in preventing premature
activation of type I receptors (Wang et
al., 1994
; Wang et al.,
1996
) (for a review, see
Massague and Chen, 2000
).
FKBP12-defcient mice are embryonically lethal due to enormous overproduction
of ventricular trabeculae, which severely impairs cardiac development and
function. In this study, we generated BMP10-deficient mice and analyzed the
biological function of BMP10 during cardiac trabeculation and uncovered a
BMP10-mediated molecular pathway essential for regulating cardiac growth and
function at mid-gestation.
| Materials and methods |
|---|
|
|
|---|
RT-PCR reactions
MicroPoly(A)Pure kit (Ambion) was used to isolate mRNA from mouse embryos
or pooled embryonic hearts. The first-strand synthesis and PCR reaction were
performed using RETROscript kit (Ambion) according to the manufacturer's
instructions. The sets of primers are: 5' BMP10 primer,
ACCAGACGTTGGCAAAAGTCAGGC; 3' BMP10 primer, GATGATCCAGGAGTCCCACCCAAT;
5' p57kip2 primer, AGTCTGTGCCCGCCTTCTAC; 3'
p57kip2 primer, CTCAGTTCCCAGCTCATCACCC; 5' FKBP12 primer,
CACGTGGATCTGCCATGGAGGAA; 3' FKBP12 primer, GTGGAAGGACTGACAGAAGCCAA;
5' GAPDH primer, GGGTGGAGCCAAACGGGTC; 3' GAPDH primer,
GGAGTTGCTGTTGAAGTCGCA.
Targeted deletion and generation of BMP10-deficient mice
A BMP10 genomic clone was isolated from a mouse 129SvEv genomic BAC library
(RPCI-22 129 mouse library from BAC/PAC Resources, Children's Hospital
Oakland). The mouse BMP10 gene contains two exons
(Fig. 3A). Linearized targeting
vector (25 µg) was electroporated into embryonic stem (ES) cells (CCE916 ES
cell line), clones were selected in G418 and gancyclovir, DNA from the clones
was analyzed by Southern blot, and targeted ES cell lines BMP10-B12 and
BMP10-F8 were expanded and injected into blastocysts. Male chimeras were bred
to C57BL/6J or 129SvEv females to generate F1 offspring. Mutant mice generated
from both targeted ES cell lines had identical phenotype.
|
Whole-mount immunostaining and confocal microscopic imaging
Embryos were washed three times in PBS and fixed for 10 minutes in
pre-chilled acetone before being treated with blocking solution containing 3%
non-fat dry milk (Bio-Rad Laboratories, Hercules, CA) and 0.025% Triton X-100
for 1 hour. Directly conjugated primary antibodies were then added to a final
concentration of 1 µg/ml for 12 to 18 hours at 4°C. Anti-Flk-1
(PharMingen, San Diego, CA) and MF-20 monoclonal antibodies (Hybridoma bank,
University of Iowa) were labeled with Alexa Fluor 488 and Alexa Fluor 647,
respectively, using a monoclonal antibody labeling kit (Molecular Probes,
Eugene, OR). Samples were analyzed using a Bio-Rad MRC 1024 Laser Scanning
Confocal Microscope (Bio-Rad Microscopy Division, Cambridge, MA) equipped with
a Krypton-Argon laser (488, 647 nm). 3D series (Z series) were obtained by
imaging serial confocal planes at 512x512 pixel resolution with a Nikon
20X oil-immersion objective (2 µm intervals).
Generation of BMP10 expressing NIH3T3 cells
The coding region of the mouse BMP10 cDNA was subcloned into 5' of an
IRES-EGFP cassette in the retroviral vector MIEG3. Ecotropic packaging cell
lines were established for MIEG3-BMP10 and MIEG3 vector control as described
(Haneline et al., 2003
).
NIH3T3 cells were transduced with retroviral supernatants (containing
approximately 1x105 viral particles/ml) in a similar way to
previously published methods (Haneline et
al., 2003
). Transduced cells were kept in DMEM containing 10% FBS
for 3 days before sorting for EGFP positive cells using FACSVantage SE (Becton
Dickinson). Northern blot analysis confirmed that the BMP10 transcript was
detected only in NIH3T3 cells transduced with MIEG3-BMP10 (NIH3T3/BMP10) and
not in cells transduced with vector control (NIH3T3/EGFP).
Cardiomyocyte-NIH3T3 cell co-culture to assay the proliferative activity of cardiomyocytes
NIH3T3/BMP10 and NIH3T3/EGFP cells were used as feeders in our
cardiomyocyte co-culture assay. We first treated feeder cells with mitomycin C
(10 µg/ml) for 2 hours to prevent proliferation. After washing twice in
PBS, mitomycin C-treated cells were trypsinized and re-suspended in DMEM
containing 2% FBS and were mixed with freshly isolated mouse embryonic
cardiomyocytes (E12.5). Cells were plated on one-well Lab-Tek chamber slides.
The final plating density was 2-3x105 total cells for each
well. Cells were labeled with [3H]thymidine for 2 hours and fixed
in methanol and processed for autoradiography and Periodic Acid-Schiff (PAS)
staining. The DNA-[3H]thymidine labeling index of PAS positive
cells (cardiomyocytes) was recorded and compared between experimental and
control groups.
Culture of isolated embryonic hearts
Based on the method previously described
(Conway et al., 1997
;
Rentschler et al., 2002
),
embryonic hearts were dissected from E9.25 or E9.5 embryos in DMEM containing
10% FBS, and washed twice in PBS and cultured for 8, 12 or 24 hours in
BMP10-conditioned or control media. BMP10-conditioned media were collected
from overnight culture of BMP10 expressing cells (NIH3T3/BMP10). Control media
were collected from overnight culture of control cells (NIH3T3/EGFP). Both
BMP10-conditioned and control media were derived from DMEM containing 1% FBS.
Conditioned media for BMP-2, -4, -5, -6 and TGFß-1 (final concentration:
50 ng/ml) and neuregulin (NRG-1, final concentration:
2.5x109 M) were prepared by adding each activated
growth factors to DMEM containing 1% serum right before the culture to reach
the final concentration (Barron et al.,
2000
; Rentschler et al.,
2002
). BMP-2, -4, -5, -6 and TGFß-1 were from Sigma. NRG-1
was from R & D Systems.
| Results |
|---|
|
|
|---|
|
Generation of BMP10-deficient mice
The mouse BMP10 gene contains only two exons. The second exon encodes a
proteolytic processing site and the mature peptide. To generate a null
mutation in the mouse BMP10 gene, we deleted most of the coding region
(bmp10m1) using mouse embryonic stem cell technology
(Fig. 2A). Genomic Southern
blot using 3'-probe (Fig.
2B) and PCR analyses were used to genotype targeted ES cells and
mutant mice. RT-PCR was used to confirm that BMP10 expression was absent in
BMP10-deficient embryos (Fig.
2C).
|
Embryonic lethality of BMP10-deficient mice is due to severely impaired cardiac development and function
We carried out morphological and histological analyses on embryos from E8.5
to E10.5 (Fig. 3A). At
E8.5-8.75 (8-12 somite pair stage), BMP10-deficient embryos appeared normal
compared to wild-type and heterozygous littermate controls, suggesting that
BMP10 was not required for cardiac patterning
(Fig. 3A, parts a-d). At
E9.0-E9.5 (15-20 somite pair stage), while having normal pairs of somites in
mutant embryos, normal allantoic/umbilical connection, and normal vasculature
development in mutant yolk sacs and embryos, cardiogenesis appeared arrested
in BMP10-deficient embryos (Fig.
3A, parts e-p). These mutant embryos displayed cardiac dysgenesis
with profound hypoplastic ventricular walls and absence of ventricular
trabeculae. The development of endocardial cushions was abnormal in both
outflow track (OFT) and atrial-ventricular canal (AVC) and was halted at the
acellular stage. At this developmental stage, BMP10-deficient hearts exhibit
rhythmic contraction, but at a significantly slower rate compared with
littermate controls [43±6 beats/minute in mutant hearts (n=12)
versus 96±7 beats/minute in wild-type and heterozygous littermate
controls (n=15), P<0.0001]. To visualize and compare the
cardiac function and circulation in mutants and controls, ink was injected
into the primitive left ventricle of E9.0 and E9.5-9.75 embryos. As shown in
Fig. 3B, while circulation was
established in BMP10 mutant embryos at E9.0, severely impaired cardiac
function and circulation was observed in mutant embryos at E9.5-9.75. By
E10.0-E10.5, mutant embryos appeared to be dying
(Fig. 3A, parts q-t).
The outgrowth of ventricular trabecular myocardium is defective in the BMP10-deficient heart
It has been suggested that cardiac trabeculation is the consequence of
interactions between the developing myocardium and the `outpocketing'
endocardium at E9.0-E9.5 (Icardo,
1984
). To better understand if the lack of ventricular trabeculae
in the BMP10-deficient heart was due to the failure of endocardial
outpocketing (i.e. initiation of trabeculation) or the failure of a myocardial
response (i.e. further expansion of trabecular myocardium through either
myocyte recruitment or growth), we used confocal microscopy to analyze the
structural relationship between endocardium and myocardium in BMP10-deficient
hearts at E9.5 (Fig. 4).
Endothelial receptors for vascular endothelial growth factor (Flk1)
(Millauer et al., 1993
) and
angiopoietin (Tek/Tie2) (Dumont et al.,
1994
) (data not shown) were normal in BMP10-deficient endothelial
cells throughout the developing cardiovasculature compared with wild-type and
heterozygous littermate controls at E9.5
(Fig. 4A,B). MF20 staining
(anti-myosin heavy chain) was also maintained in the BMP10-deficient
myocardium despite overall hypoplasia (Fig.
4C,D). These observations confirmed that BMP10 was not required
for differentiation of either endocardium or myocardium. Furthermore, the
developing endocardium was in normal proximity to the ventricular wall and the
primitive ventricular trabeculae were indeed formed in the BMP10 mutants
(Fig. 4C,D). These findings
strongly suggested that BMP10 was not crucial to the initiation of cardiac
trabeculation, nor myocyte recruitment, but was essential to the further
growth of both ventricular wall and trabeculae.
|
Among multiple cell cycle regulators, p57kip2 expression is
first detectable in the developing heart at E10.5 by in-situ hybridization and
RT-PCR and is restricted to ventricular trabeculae
(Kochilas et al., 1999
).
Therefore, p57kip2 is considered a key negative regulator involved
in cardiac cell cycle exit within the developing ventricular trabeculae during
chamber maturation (Kochilas et al.,
1999
). Immunohistochemistry staining revealed that
p57kip2 was upregulated and ectopically expressed throughout the
ventricular wall in BMP10-deficient hearts at E9.5 compared with littermate
controls (Fig. 5A, parts a-c).
FKBP12-deficient hearts (E13.5), which have elevated BMP10 levels and an
overproduction of trabeculae, exhibited significantly lower p57kip2
expression in trabecular myocardia compared with littermate controls
(Fig. 5A, parts d,e),
suggesting a mechanistic relationship between p57kip2 and BMP10.
RT-PCR analysis confirmed this observation
(Fig. 5B) and further suggested
that BMP10 regulated p57kip2 at the transcriptional level. Together
these data show that elimination or elevation of BMP10 expression jeopardized
the regulation of ventricular growth and chamber maturation.
|
|
|
Mutant mice deficient in neuregulin or its receptor ErbB developed severe
defects in ventricular trabeculation
(Meyer and Birchmeier, 1995
;
Gassmann et al., 1995
;
Lee et al., 1995
). To
determine if the strong effect of BMP10 on myocardium was via a
neuregulinErbB-mediated pathway, we cultured BMP10-deficient hearts in
the neuregulin (NRG-1)-containing media
(Rentschler et al., 2002
).
Unlike BMP10-conditioned medium, NRG-1 medium was not able to rescue the
growth-deficiency phenotype of BMP10-deficient hearts (data not shown). This
observation suggested that BMP10 was either downstream of, or irrelevant to,
the neuregulinErbB-mediated pathway.
Importantly, when E9.5 mutant hearts were cultured in BMP10-conditioned media, both NKX2.5 (Fig. 8A) and MEF2C (data not shown) expression was restored, and p57kip2 expression was significantly downregulated in these rescued hearts (Fig. 8B). This observation further indicated the close relationship between BMP10 and cardiogenic transcriptional factors NKX2.5 and MEF2C and cell cycle regulator p57kip2.
|
|
| Discussion |
|---|
|
|
|---|
Another important finding in our studies is that BMP10 was specifically
required to maintain the expression level of cardiogenic transcription factors
NKX2.5 and MEF2C during mid-gestation. Both NKX2.5 and MEF2C have been shown
to be critical for cardiac patterning in the early phase of cardiogenesis (for
a review, see Harvey et al.,
1999
; Black and Olson,
1999
). BMP10-deficient hearts have normal cardiac patterning,
which is consistent with the normal expression of NKX2.5 and MEF2C before
E9.0. However, the rapid downregulation of NKX2.5 and MEF2C in E9.5 mutant
hearts may help to explain the severely impaired cardiac function seen in
BMP10-deficient hearts, since many of the NKX2.5 and MEF2C downstream gene
products are crucial for cardiac function.
A related observation is that the downregulation of NKX2.5 and MEF2C is not restricted to the ventricular chamber in which BMP10 is expressed. In fact, in a similar way to other BMPs, BMP10 is a secreted peptide that can function as an autocrine and paracrine growth and differentiation signal, which would lead to a broader effect during cardiac development. The lack of seeded mesenchymal cells in endocardial cushions in BMP10-deficient hearts and the relative normal cushion structure in rescued hearts suggest that BMP10 is able to contribute to the epithelialmesenchymal transformation, a key step in endocardial cushion development. However, we cannot yet exclude the likelihood that the cushion defect in BMP10 mutant heart is secondary to severely impaired cardiac growth in vivo.
In addition to the cardiac-specific BMP10, other BMPs (e.g. BMP-2, -4, -5,
-6 and -7) and TGFß family members and receptors (for a review, see
Schneider et al., 2003
), which
have much wider expression patterns during embryonic development, are also
found in the developing heart. These BMPs appear to form an important network
that controls several crucial morphogenetic events during cardiac development.
Obviously, these BMPs are not able to compensate for the loss of BMP10 in
vivo. Probably, this is partially due to their differences in temporal and
spatial pattern of expression and partially due to their differences in
ligand-receptor specificity. During cardiac development, BMP2/4 is more
restricted to the myocardium adjacent to the endocardial cushion region
(Nakajima et al., 2000
).
BMP-5, -6 and -7 have overlapping expression patterns and redundant functions
in cardiac development (Solloway and
Robertson, 1999
; Kim et al.,
2001
). Mice deficient in both BMP-6 and BMP-7 develop outflow
tract and valvo-septation anomalies (Kim
et al., 2001
), while mice deficient in both BMP-5 and BMP-7 have
defects in cardiac looping and ventricular chamber formation
(Solloway and Robertson,
1999
). In our on-going rescue experiments using different BMPs
(e.g. BMP-2, -4, -5 and -6, and TGFß-1), we clearly observed the
differences in their ability to rescue the BMP10-deficient hearts in culture
(data not shown). This finding suggests a complicated BMP-receptor network in
the developing heart. It is consistent with recent data in cardiac conditional
knockout of type I receptor for BMP (Alk3)
(Gaussin et al., 2002
).
Cardiac myocyte-specific deletion of Alk3 leads to major defects in
endocardial cushion and ventricular wall but has very little effect on cardiac
trabeculation. BMP10 expression is also normal in these mutant mice.
Interestingly, NKX2.5 and other cardiogenic transcription factors are not
altered in Alk3 mutant hearts, suggesting that Alk3 is not the receptor
mediating BMP10 signaling.
Recently, analysis of the NKX2.5 promoter showed that NKX2.5 expression in
both early and late cardiac development is mediated by multiple conserved Smad
binding sites (Liberatore et al.,
2002
; Lien et al.,
2002
). This finding further suggests that BMP signaling is
required beyond the initial step of cardiogenic induction. Previously, BMP2/4
has been shown to mediate cardiac induction via activation of NKX2.5 in chick
embryos at an early stage (Schultheiss et
al., 1997
) (for a review, see
Srivastava and Olson, 2000
).
Our data supported the observation from NKX2.5 promoter analysis. BMP10 is a
strong candidate that is responsible for maintaining the expression of NKX2.5
during mid-gestation, possibly via a Smad-NKX2.5 pathway.
Our studies have demonstrated an important genetic pathway that regulates ventricular trabeculation and chamber maturation. The regulation of BMP10 expression may be an important mechanism for normal cardiac trabecular growth and compaction in mice. Genetic investigation of human patients with noncompaction myocardial defects may demonstrate a role for BMP10 in this pathological condition as well.
Note added in proof
A recent related study by Pashmforoush et al.
(Pashmforoush et al., 2004
)
has indicated that Nkx2.5 can act as a negative-feedback regulator of
BMP10 expression at later developmental stages. Mutant mice with a late onset
cardiomyocyte-specific Nkx2.5 null mutation, generated via a
conditional cre/loxP knockout strategy, have an abnormal myocardium with
increased ventricular trabeculation. Significantly, BMP10 expression is
ectopically upregulated in these conditional Nkx2.5-deficient hearts.
These findings further support a role for BMP10 in ventricular maturation and
underscore the deleterious effects of abnormal BMP10 regulation during the
pathogenesis of ventricular non-compaction in murine models. Further studies
will be required to determine the link between BMP10 and the etiology of
ventricular non-compaction in humans.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Andree, B., Duprez, D., Vorbusch, B., Arnold, H. H. and Brand,
T. (1998). BMP-2 induces ectopic expression of cardiac
lineage markers and interferes with somite formation in chicken embryos.
Mech. Dev. 70,119
-131.[CrossRef][Medline]
Bao, S., Shen, X., Shen, K., Liu, Y. and Wang, X. F.
(1998). The mammalian Rad24 homologous to yeast Saccharomyces
cerevisiae Rad24 and Schizosaccharomyces pombe Rad17 is involved
in DNA damage checkpoint. Cell Growth Differ.
9, 961-967.[Abstract]
Barron, M., Gao, M. and Lough, J. (2000).
Requirement for BMP and FGF signaling during cardiogenic induction in
non-precardiac mesoderm is specific, transient, and cooperative.
Dev. Dyn. 218,383
-393.[CrossRef][Medline]
Black, B. L. and Olson, E. N. (1999). Control
of cardiac development by the MEF2 family of transcription factors. In
Heart Development (ed. R. P. Harvey and N. Rosenthal),
pp. 131-142. San Diego: Academic Press.
Chen, F., Kook, H., Milewski, R., Gitler, A. D., Lu, M. M.,
Nazarian, R., Schnepp, R., Jen, K., Biben, C., Runke, G., Mackay, J. P.,
Novotny, J., Schwatz, R. J., Harvey, R. P., Mullins, M. C. and Epstein, J.
A. (2002). Hop is an unusual homeobox gene that modulates
cardiac development. Cell
110,713
-723.[CrossRef][Medline]
Conway, S. J., Henderson, D. J. and Copp, A. J.
(1997). Pax3 is required for cardiac neural crest migration in
the mouse: evidence from the splotch (Sp2h) mutant.
Development 124,505
-514.[Abstract]
Ducy, P. and Karsenty, G. (2000). The family of
bone morphogenetic proteins. Kidney International
57,2207
-2214.[CrossRef][Medline]
Dumont, D. J., Gradwohl, G., Fong, G. H., Puri, M. C.,
Gertsenstein, M., Auerbach, A. and Breitman, M. L. (1994).
Dominant-negative and targeted null mutations in the endothelial receptor
tyrosine kinase, tek, reveal a critical role in vasculogenesis of the embryo.
Genes Dev. 8,1897
-1909.
Durocher, D., Chen, C-Y., Ardati, A., Schwartz, R. J. and Nemer,
M. (1996). The atrial natriuretic factor promoter is a
downstream target for Nkx-2.5 in the myocardium. Mol. Cell
Biol. 16,4648
-4655.[Abstract]
Dusek, J., Ostadal, B. and Duskova, M. (1975).
Postnatal persistence of spongy myocardium with embryonic blood supply.
Arch. Pathol. 99,312
-317.[Medline]
Ferrara, N., Carver-Moore, K., Chen, H., Dowd, M., Lu, L.,
O'Shea, K. S., Powell-Braxton, L., Hillan, K. J. and Moore, M. W.
(1996). Heterozygous embryonic lethality induced by targeted
inactivation of the VEGF gene. Nature
380,439
-442.[CrossRef][Medline]
Franco, D. and Icardo, J. M. (2001). Molecular
characterization of the ventricular conduction system in the developing mouse
heart: topographical correlation in normal and congenitally malformed hearts.
Cardiovasc. Res. 49,417
-429.
Franco, D., deBoer, P. A., deGier-de Vries, C., Lamers, W. H.
and Moorman, A. F. (2001). Methods on in situ hybridization,
immunohistochemistry and beta-galactosidase reporter gene detection.
Eur. J. Morphol. 39,169
-191.[CrossRef][Medline]
Gassmann, M., Casagranda, F., Oriori, A. Simon, H., Lai C. and
Klein, R. and Lemek, G. (1995). Aberrant neural and cardiac
development in mice lacking the ErbB4 neuregulin receptor.
Nature 378,390
-394.[CrossRef][Medline]
Gaussin, V., Van de Putte, T., Mishina, Y., Hanks, M. C.,
Zwijsen, A., Huylebroeck, D., Behringer, R. R. and Schneider, M. D.
(2002). Endocardial cushion and myocardial defects after cardiac
myocyte-specific conditional deletion of the bone morphogenetic protein
receptor ALK3. Proc. Natl. Acad. Sci. USA
99,2878
-2883.
Haneline, L. S., Li, X., Ciccone, S. L. M., Hong, P., Yang, Y.,
Lee, S-H., Orazi, A., Srour, E. F. and Clapp, D. W. (2003).
Retroviral-mediated expression of recombinant Fancc enhances the repopulating
ability of Fancc/ hematopoietic stem cells and
decreases the risk of clonal evolution. Blood
101,1299
-1307.
Harvey, R. P., Biben, C. and Elliott, D. A.
(1999). Transcriptional control and pattern formation in the
developing vertebrate heart: studies on NK-2 class homeodomain factors. In
Heart Development (ed. R. P. Harvey and N. Rosenthal),
pp. 111-129. San Diego: Academic Press.
Icardo, J. M. (1984). The growing heart: an
anatomical perspective. In Growth of the Heart in Health and
Disease (ed. R. Zak), pp. 41-79. New
York: Raven Press.
Ichida, F., Tsubata, S., Bowles, K. R., Haneda, N., Uese, K.,
Miyawaki, T., Dreyer, W. J., Messina, J., Li, H., Bowles, N. E. and Towbin, J.
A. (2001). Novel gene mutations in patients with left
ventricular noncompaction or Bath Syndrome.
Circulation 103,1256
-1263.
Kim, R. Y., Robertson, E. J. and Solloway, M. J.
(2001). Bmp6 and Bmp7 are required for cushion formation and
septation in the developing mouse heart. Dev. Biol.
235,449
-466.[CrossRef][Medline]
Kochilas, L. K., Li, J., Jin, F., Buck, C. A. and Epstein, J.
A. (1999). P57kip2 expression is enhanced during mid-cardiac
murine development and is restricted to trabecular myocardium.
Pediatr. Res. 45,635
-642.[Medline]
Lee, K. F., Simon, H., Chen, H., Bates, B., Hung, M. C. and
Hauser, C. (1995). Requirement for neuregulin receptor ErbB2
in neural and cardiac development. Nature
378,394
-398.[CrossRef][Medline]
Liberatore, C. M., Searcy-Schrick, R. D., Vincent, E. B. and
Yutzey, K. E. (2002). Nkx-2.5 gene induction in mice is
mediated by a Smad concensus regulatory region. Dev.
Biol. 244,243
-256.[CrossRef][Medline]
Lien, C-L., McAnally, J., Richardson, J. A. and Olson, E. N.
(2002). Cardiac-specific activity of an NKX2-5 enhancer requires
an evolutionarily conserved Smad binding site. Dev.
Biol. 244,257
-266.[CrossRef][Medline]
Massague, J. and Chen, Y. G. (2000).
Controlling TGF-beta signaling. Genes Dev.
14,627
-644.
Meyer, D. and Birchmeier, C. (1995). Multiple
essential functions of neuregulin in development.Nature
378,386
-390.[CrossRef][Medline]
Millauer, B., Wizigmann-Voos, S., Schnurch, H., Martinez, R.,
Moller, N. P., Risau, W. and Ullrich, A. (1993). High
affinity VEGF binding and developmental expression suggest Flk-1 as a major
regulator of vasculogenesis and angiogenesis. Cell
72,835
-846.[CrossRef][Medline]
Moorman, A. F. M. and Lamers, W. H. (1999).
Development of the conduction system of the vertebrate heart. In
Heart Development. (ed. R. P. Harvey and N.
Rosenthal), pp. 195-207. San Diego: Academic
Press.
Nakajima, Y., Yamagishi, T., Hokari, S. and Nakamura, H.
(2000). Mechanisms involved in valvuloseptal endocardial cushion
formation in early cardiogenesis: roles of transforming growth factor
(TGF)-beta and bone morphogenetic protein (BMP). Anat.
Rec. 258,119
-127.[CrossRef][Medline]
Nakayama, T., Cui, Y. and Christian, J. L.
(2000). Regulation of BMP/Dpp signaling during embryonic
development. Cell Mol. Life Sci.
57,943
-956.[CrossRef][Medline]
Neuhaus, H., Rosen, V. and Thies, R. S. (1999).
Heart specific expression of mouse BMP-10 a novel member of the TGF-ß
superfamily. Mech. Dev.
80,181
-184.[CrossRef][Medline]
Palmer, S., Groves, N., Schindeler, A., Yeoh, T., Biben, C.,
Wang, C-C., Sparrow, D. B., Barnett, L., Jemkins, N. A., Copeland, N. G.,
Koentgen, F., Mohum, T. and Harvey, R. P. (2001). The small
muscle-specific protein Csl modifies cell shape and promotes myocyte fusion in
an insulin-like growth factor 1-dependent manner. J. Cell
Biol. 153,985
-997.
Pashmforoush, M., Lu, J. T., Chen, H., St Amand, T., Kondo, R.,
Pradervand, S., Evans, S. M., Clark, R., Feramisco, J. R., Giles, W., Ho, S.
Y., Benson, W. D., Silberbach, M., Shou, W. and Chien, K. R.
(2004). Defects in Nkx 2.5 pathways for ventricular myocytes
lineage specification leads to progressive cardiomyopathy and atrioventricular
heart block. Cell (in press).
Rentschler, S., Zander, J., Meyers, K., France, D., Levine, R.,
Porter, G., Rivkees, S. A., Morley, G. E. and Fishman, G. I.
(2002). Neuregulin-1 promotes formation of the murine cardiac
conduction system. Proc. Natl. Acad. Sci. USA
99,10464
-10469.
Rumyantsev, P. P. (1991). Growth and
hyperplasia of cardiac muscle cells. In Soviet Medical Reviews
Supplement series (ed. B. M. Carlson), pp.12
-36. London: Harwood Academic
Publishers.
Schneider, M. D., Gaussin, V. and Lyons, K. M.
(2003). BMP signals for cardiac morphogenesis.
Cytokine Growth Factor Rev.
14, 1-4.[CrossRef][Medline]
Schott, J. J., Benson, D. W., Basson, C. T., Pease, W.,
Silberbach, G. M., Moak, J. P., Maron, B. J., Seidman, C. E. and Seidman, J.
G. (1998). Congenital heart disease caused by mutations in
the transcription factor NKX2-5. Science
281,108
-111.
Schultheiss, T. M., Burch, J. B. and Lassar, A. B.
(1997). A role for bone morphogenetic proteins in the induction
of cardiac myogenesis. Genes Dev.
11,451
-462.
Shin, C. H., Liu, Z-P., Passier, R., Zhang, C-L., Wang, D-Z.,
Harris, T. M., Yamagishi, H., Richardson, J. A., Childs, G. and Olson, E.
N. (2002). Modulation of cardiac growth and development by
HOP, an unusual homeodomain protein. Cell
110,725
-735.[CrossRef][Medline]
Shou, W., Aghdasi, B., Armstrong, D. L., Guo, Q., Bao, S.,
Charng, M-J., Mathews, L. S., Schneider, M. D., Hamilton, S. L. and Matzuk, M.
M. (1998). Cardiac defects and altered ryanodine receptor
function in mice lacking FKBP12. Nature
391,489
-492.[CrossRef][Medline]
Solloway, M. J. and Robertson, E. J. (1999).
Early embryonic lethality in Bmp5; Bmp7 double mutant mice suggests functional
redundancy within the 60A subgroup. Development
126,1753
-1768.[Abstract]
Srivastava, D. and Olson, E. N. (2000). A
genetic blueprint for cardiac development. Nature
407,221
-226.[CrossRef][Medline]
Suri, C., Jones, P. F., Patan, S., Bartunkova, S., Maisonpierre,
P. C., Davis, S., Sato, T. N. and Yancopoulos, G. D. (1996).
Requisite role of angiopoietin-1, a ligand for the TIE2 receptor, during
embryonic angiogenesis. Cell
87,1171
-1180.[CrossRef][Medline]
Wang, T., Donahoe, P. K. and Zervos, A. S.
(1994). Specific interaction of type 1 receptor of the TGF-ß
family with the immunophilin FKBP-12. Science
265,674
-676.
Wang, T., Li, B.-Y., Danielson, P. D., Shah, P. C., Rockwell,
S., Lechleider, R. J., Martin, J., Manganaro, T. and Donahoe, P. K.
(1996). The immunophilin FKBP12 functions as a common inhibitor
of the TGFß family type 1 receptors. Cell
86,435
-444.[CrossRef][Medline]
Winnier, G. E., Kume, T., Deng, K., Rogers, R., Bundy, J.,
Raines, C., Walter, M. A., Hogan, B. L. and Conway, S.
(1999). Roles for the winged helix transcription factors MF1 and
MFH1 in cardiovascular development revealed by nonalletic noncomplementation
of null alleles. Dev. Biol.
213,418
-431.[CrossRef][Medline]
Yan, Y., Frisen, J., Lee, M. H., Massague, J. and Barbacid,
M. (1997). Ablation of the CDK inhibitor p57kip2 results in
increased apoptosis and delayed differentiation during development.
Genes Dev. 11,973
-983.
Zhang, P., Liegeois, N. J., Wong, C., Finegold, M., Hou, H.,
Thompson, J. C., Silverman, A., Harper, J. W., DePinho, R. A. and Elledge, S.
J. (1997). Altered cell differentiation and proliferation in
mice lacking p57kip2 indicates a role in Beckwith-Wiedemann syndrome.
Nature 387,151
-158.[CrossRef][Medline]
Zhang, P., Wong, C., DePinho, R. A., Harper, J. W and Elledge,
S. J. (1998). Cooperation between the Cdk inhibitors p21kip1
and p57kip2 in the control of tissue growth and development. Genes
Dev. 12,3162
-3167.
Zhang, P., Wong, C., Liu, D., Finegold, M., Harper, J. W. and
Elledge, S. J. (1999). p21cip1 and p57kip2 control muscle
differentiation at the myogenin step. Genes Dev.
13,213
-224.
Related articles in Development:
This article has been cited by other articles:
![]() |
C. J. Hatcher and C. T. Basson Specification of the Cardiac Conduction System by Transcription Factors Circ. Res., September 25, 2009; 105(7): 620 - 630. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Chen, H. Chen, D. Zheng, C. Kuang, H. Fang, B. Zou, W. Zhu, G. Bu, T. Jin, Z. Wang, et al. Smad7 Is Required for the Development and Function of the Heart J. Biol. Chem., January 2, 2009; 284(1): 292 - 300. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. El-Bizri, C. Guignabert, L. Wang, A. Cheng, K. Stankunas, C.-P. Chang, Y. Mishina, and M. Rabinovitch SM22{alpha}-targeted deletion of bone morphogenetic protein receptor 1A in mice impairs cardiac and vascular development, and influences organogenesis Development, September 1, 2008; 135(17): 2981 - 2991. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Niessen and A. Karsan Notch Signaling in Cardiac Development Circ. Res., May 23, 2008; 102(10): 1169 - 1181. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-H. Shen, Z. Chen, S. Shi, H. Chen, W. Zhu, A. Penner, G. Bu, W. Li, D. W. Boyle, M. Rubart, et al. Cardiac Restricted Overexpression of Kinase-dead Mammalian Target of Rapamycin (mTOR) Mutant Impairs the mTOR-mediated Signaling and Cardiac Function J. Biol. Chem., May 16, 2008; 283(20): 13842 - 13849. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Tessari, M. Pietrobon, A. Notte, G. Cifelli, P. J. Gage, M. D. Schneider, G. Lembo, and M. Campione Myocardial Pitx2 Differentially Regulates the Left Atrial Identity and Ventricular Asymmetric Remodeling Programs Circ. Res., April 11, 2008; 102(7): 813 - 822. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Nakano, H. Hori, M. Abe, H. Shibata, T. Arimura, T. Sasaoka, M. Sawabe, K. Chida, T. Arai, K.-i. Nakahara, et al. Interaction of BMP10 with Tcap may modulate the course of hypertensive cardiac hypertrophy Am J Physiol Heart Circ Physiol, December 1, 2007; 293(6): H3396 - H3403. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Song, W. Yan, X. Chen, C.-x. Deng, Q. Wang, and K. Jiao Myocardial Smad4 Is Essential for Cardiogenesis in Mouse Embryos Circ. Res., August 3, 2007; 101(3): 277 - 285. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Kitamura, T. Takahashi, N. Nakajima, K. Isodono, S. Asada, H. Ueno, T. Ueyama, T. Yoshikawa, H. Matsubara, and H. Oh Stage-Specific Role of Endogenous Smad2 Activation in Cardiomyogenesis of Embryonic Stem Cells Circ. Res., July 6, 2007; 101(1): 78 - 87. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Arab, I. E. Konstantinov, C. Boscarino, E. Cukerman, A. Mori, J. Li, P. P. Liu, A. N. Redington, and J. G. Coles Early gene expression profiles during intraoperative myocardial ischemia-reperfusion in cardiac surgery J. Thorac. Cardiovasc. Surg., July 1, 2007; 134(1): 74 - 81. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Wagner and M. A. Q. Siddiqui Signal Transduction in Early Heart Development (II): Ventricular Chamber Specification, Trabeculation, and Heart Valve Formation Experimental Biology and Medicine, July 1, 2007; 232(7): 866 - 880. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. van Wijk, A. F.M. Moorman, and M. J.B. van den Hoff Role of bone morphogenetic proteins in cardiac differentiation Cardiovasc Res, May 1, 2007; 74(2): 244 - 255. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Koibuchi and M. T. Chin CHF1/Hey2 Plays a Pivotal Role in Left Ventricular Maturation Through Suppression of Ectopic Atrial Gene Expression Circ. Res., March 30, 2007; 100(6): 850 - 855. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. David, C. Mallet, S. Mazerbourg, J.-J. Feige, and S. Bailly Identification of BMP9 and BMP10 as functional activators of the orphan activin receptor-like kinase 1 (ALK1) in endothelial cells Blood, March 1, 2007; 109(5): 1953 - 1961. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Yong, Z. Yang, S. Periyasamy, H. Chen, S. Yucel, W. Li, L. Y. Lin, I. M. Wolf, M. J. Cohn, L. S. Baskin, et al. Essential Role for Co-chaperone Fkbp52 but Not Fkbp51 in Androgen Receptor-mediated Signaling and Physiology J. Biol. Chem., February 16, 2007; 282(7): 5026 - 5036. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Choi, R. W. Stottmann, Y.-P. Yang, E. N. Meyers, and J. Klingensmith The Bone Morphogenetic Protein Antagonist Noggin Regulates Mammalian Cardiac Morphogenesis Circ. Res., February 2, 2007; 100(2): 220 - 228. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Shiojima and K. Walsh Regulation of cardiac growth and coronary angiogenesis by the Akt/PKB signaling pathway Genes & Dev., December 15, 2006; 20(24): 3347 - 3365. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Chen, W. Yong, S. Ren, W. Shen, Y. He, K. A. Cox, W. Zhu, W. Li, M. Soonpaa, R. M. Payne, et al. Overexpression of Bone Morphogenetic Protein 10 in Myocardium Disrupts Cardiac Postnatal Hypertrophic Growth J. Biol. Chem., September 15, 2006; 281(37): 27481 - 27491. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mazerbourg and A. J.W. Hsueh Genomic analyses facilitate identification of receptors and signalling pathways for growth differentiation factor 9 and related orphan bone morphogenetic protein/growth differentiation factor ligands Hum. Reprod. Update, July 1, 2006; 12(4): 373 - 383. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-W. Chen, B. Zhou, Q.-C. Yu, S. J. Shin, K. Jiao, M. D. Schneider, H. S. Baldwin, and J. M. Bergelson Cardiomyocyte-Specific Deletion of the Coxsackievirus and Adenovirus Receptor Results in Hyperplasia of the Embryonic Left Ventricle and Abnormalities of Sinuatrial Valves Circ. Res., April 14, 2006; 98(7): 923 - 930. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Yang, C.-L. Cai, L. Lin, Y. Qyang, C. Chung, R. M. Monteiro, C. L. Mummery, G. I. Fishman, A. Cogen, and S. Evans Isl1Cre reveals a common Bmp pathway in heart and limb development. Development, April 1, 2006; 133(8): 1575 - 1585. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Thackaberry, B. A. Nunez, I. D. Ivnitski-Steele, M. Friggins, and M. K. Walker Effect of 2,3,7,8-Tetrachlorodibenzo-p-Dioxin on Murine Heart Development: Alteration in Fetal and Postnatal Cardiac Growth, and Postnatal Cardiac Chronotropy Toxicol. Sci., November 1, 2005; 88(1): 242 - 249. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Thackaberry, Z. Jiang, C. D. Johnson, K. S. Ramos, and M. K. Walker Toxicogenomic Profile of 2,3,7,8-Tetrachlorodibenzo-p-Dioxin in the Murine Fetal Heart: Modulation of Cell Cycle and Extracellular Matrix Genes Toxicol. Sci., November 1, 2005; 88(1): 231 - 241. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mazerbourg, K. Sangkuhl, C.-W. Luo, S. Sudo, C. Klein, and A. J. W. Hsueh Identification of Receptors and Signaling Pathways for Orphan Bone Morphogenetic Protein/Growth Differentiation Factor Ligands Based on Genomic Analyses J. Biol. Chem., September 16, 2005; 280(37): 32122 - 32132. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-L. Cai, W. Zhou, L. Yang, L. Bu, Y. Qyang, X. Zhang, X. Li, M. G. Rosenfeld, J. Chen, and S. Evans T-box genes coordinate regional rates of proliferation and regional specification during cardiogenesis Development, May 15, 2005; 132(10): 2475 - 2487. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Fiore, B. Rahim, V. M. Christoffels, A. F. M. Moorman, and A. W. Puschel Inactivation of the Sema5a Gene Results in Embryonic Lethality and Defective Remodeling of the Cranial Vascular System Mol. Cell. Biol., March 15, 2005; 25(6): 2310 - 2319. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Monteiro, S. M. C. de Sousa Lopes, O. Korchynskyi, P. t. Dijke, and C. L. Mummery Spatio-temporal activation of Smad1 and Smad5 in vivo: monitoring transcriptional activity of Smad proteins J. Cell Sci., September 15, 2004; 117(20): 4653 - 4663. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||