|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 13 April 2005
doi: 10.1242/dev.01810
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1 Laboratory for Developmental Gene Regulation, Brain Science Institute, The
Institute of Physical and Chemical Research (RIKEN), 2-1 Hirosawa, Wako,
Saitama 351-0198, Japan
2 Core Research for Evolutional Science and Technology (CREST), Japan Science
and Technology Corporation (JST), 4-1-8 Honcho, Kawaguchi, Saitama 332-0012,
Japan
3 Masai Initiative Research Unit, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198,
Japan
Author for correspondence (e-mail:
hitoshi{at}brain.riken.jp)
Accepted 2 March 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Zebrafish, landlocked, scribble1, facial motor neuron, neuronal migration, convergent extension
| Introduction |
|---|
|
|
|---|
|
However, in zebrafish, there is evidence that CE may also be regulated by
other PCP signaling molecules encoded by knypek(kny)/glypican4/6,
silberblick(slb)/wnt11 and pipetail(ppt)/wnt5a
(Topczewski et al., 2001
;
Heisenberg et al., 2000
;
Kilian et al., 2003
), but
disruption of these genes does not impair migration of the nVII motor neurons
(Bingham et al., 2002
;
Jessen et al., 2002
),
suggesting that the genetic cascades underlying neuronal migration and CE are
not identical. In this study, we attempted to isolate novel mutants that were
deficient in neuronal migration but retained normal CE movements. Such mutants
would enable us to address the question of how the migration of the nVII motor
neurons is related to the differentiation and function of these neurons.
In a systematic screen using the zebrafish transgenic Isl1-GFP strain,
which expresses green fluorescent protein (GFP) in the branchiomotor neurons
(Higashijima et al., 2000
), we
identified two novel mutants, denoted landlocked (llk) and
off-road (ord), which displayed specific impairment of
migration of the nVII motor neurons without any disruption of CE movements.
The llk locus encompasses scribble1 (scrb1), a
homologue of the Drosophila cell polarity gene scribble.
Here, we show that the zygotic expression of the llk/scrb1 gene is
required for migration of the nVII motor neurons mainly in a non
cell-autonomous manner. In zygotic llk embryos, migration of the VII
motor neurons is specifically impaired without any effect on CE movements. The
zygotic llk embryos are homozygously viable, which meant we could
obtain embryos deficient for both the maternal and zygotic contribution of
llk transcripts. Depletion of maternal expression of
llk/scrb1 impaired CE movements. Furthermore, we show that proper
interaction of Llk/Scrb1 with Tri/Stbm plays a crucial role in the regulation
of CE movements.
| Materials and methods |
|---|
|
|
|---|
Immunohistochemistry and in situ hybridization
Standard protocols were used for immunohistochemistry with a zn-5 antibody
(Oregon Monoclonal Bank, 1:100 dilution)
(Trevarrow et al., 1990
),
anti-acetylated
-tubulin antibody (Sigma, 1:1000) and a secondary
antibody conjugated to Alexa Fluor 533 (Santa Cruz Biotechnology, 1:500). The
samples were viewed by confocal microscopy (Zeiss LSM 510). In situ
hybridization using RNA probes was carried out as described previously
(Westerfield, 1995
). Digital
images of the embryos were captured using a differential interference contrast
(DIC) microscope (Zeiss Axioplan2) with a CCD camera (Olympus DP50). In each
experiment involving comparison between wild-type and mutant embryos, we used
embryos obtained from heterozygous parents and identified mutant homozygous
embryos by observing expression of GFP. At least 20 embryos were stained and
observed in each experiment.
Restrograde labeling and cell transplantation
Retrograde labeling of reticulospinal neurons with rhodamine-conjugated
dextran (Molecular Probes) was carried out as described previously
(Moens et al., 1996
).
Retrograde labeling of putative octavolateralis efferent (OLe) neurons with
DiI (Molecular Probes) was also performed as described previously
(Higashijima et al., 2000
).
The putative OLe neurons extend axons to the anterior and posterior lateral
lines. The OLe axons exit the hindbrain at the r4 and r6 level at 24 hours
post-fertilization (hpf) and extend anteriorly or posteriorly at 28 hpf
(Higashijima et al., 2000
).
The DiI was applied, at 30 hpf, to the anterior or posterior lateral line
ganglion regions, through which the OLe axons extend. Co-localization of DiI
and GFP signals in the cell bodies was confirmed in each optical section of
confocal microscopy (see Fig. S1 in supplementary material). From a total of
20 embryos, six wild-type embryos (three anterior and three posterior lateral
line ganglia) and six llkrw16 homozygous embryos (four
anterior and two posterior lateral line ganglia) were successfully
labeled.
Cell transplantation was carried out according to standard protocols
(Westerfield, 1995
).
llkrw16 homozygous embryos were produced by crossing
llkrw16 homozygous parents. Cells from dome-stage (4-5
hpf) donor embryos injected with rhodamine-conjugated dextran were
transplanted into shield-stage (6 hpf) host embryos as described previously
(Moens et al., 1996
). Mosaic
embryos were analyzed alive at 36 hpf. To ensure that the transplanted donor
cells were nVII motor neurons, we observed peripheral axons from donor cells
labeled with rhodamine. In all of the mosaic embryos examined (three wild
type>mutant and two mutant>wild type), a part of the facial motor axons
bundle was rhodamine labeled, confirming that these donor cells were nVII
motor neurons.
Mapping the mutant locus
In total, 1027 llk homozygous embryos (2054 meioses) were
collected from parents derived from a llkrw16 homozygous
fish x WIK cross. Genomic DNA was extracted from individual embryos at 3
dpf. PCR analysis with SSLP markers
(Shimoda et al., 1999
) was
carried out to assign the llk locus to the linkage group.
Representational differential analysis (RDA) was carried out as described
previously (Lisitsyn et al.,
1993
; Sato and Mishina,
2003
; Matsuda and Mishina,
2004
). Genomic DNA was extracted from pools of 20 homozygous
mutant fish and five wild-type siblings at 30 dpf. Amplicons were prepared by
digesting pooled mutant genomic DNA (4 µg) and pooled wild-type genomic DNA
(4 µg) with XbaI, EcoRI, BamHI, SpeI
and NcoI. The interactive hybridization-amplification step was
repeated three times. The resulting RDA products were cloned and their
flanking genomic sequences were obtained from the Sanger Centre genome
database. Specific primers were designed, and PCR products amplified from the
DNA of each mutant embryo of the mapping F2 panel were digested
with the appropriate enzymes to detect restriction enzyme length
polymorphisms. Four RDA products (NcoI-10, XbaI-1,
XbaI-4, and EcoRI-46) were successfully mapped near the
llk locus (see text). The following primers and enzymes were
used:
Identification of the gene
A zebrafish PAC library (BUSUMP, RZPD) was screened by PCR using standard
procedures. Specific primers from the EcoRI-46 flanking genome sequence were
used for the amplification step (5'TTAAGGCAGAACAGGGAAGTGAGATCAAC3'
and 5'ACCTGTGATGTAGAGAGTCACC3'). Both ends of the resulting PAC
were sequenced, and consistency with the database was confirmed. The
scrb1 genomic region was covered by a PAC clone (BUSUM#149G1) and the
database contigs (AL772146 and z06s003613). To isolate the scrb1
gene, total RNA was extracted from 24-hpf llkrw16 and
llkrw468 homozygous embryos using an RNA extraction kit
(Nippon gene). scrb1 cDNA was amplified with a first strand cDNA
synthesis kit (Takara) and PCR using specific primers designed from the
database genomic sequences. The amino acid sequence of llk/scrb1 was
deduced from the nucleotide sequences of nine partial cDNAs. To exclude
nucleotide changes derived from polymorphisms, genomic DNA from male
grandparents of the family containing the llkrw16 and
llkrw468 mutations was also sequenced. Six alternatively
used exons 16, 28, 31, 34, 40 and 43 (see text in detail) were identified and
RT-PCR analyses were performed to show the predominant scrb1 product.
Total RNAs extracted from 1.5, 10, 18, 24, 36 and 48-hpf embryos were used.
Specific primers designed in the flanking regions of each exon are as
follows:
For in situ hybridization, we used a partial cDNA fragment from the N-terminal region of the scrb1 gene (157-418 aa, corresponding to the LRR domain), which detects all of the spliced variants. The primers used to isolate the cDNA fragments were as follows: 5'GAATCTACTGAAATCCTTGCC3' and 5'GTTGGGGCAGCAGGTAGCAGG 3'.
The PCR products were cloned into the TA cloning vector, pCRII-TOPO (Invitrogen), and sequenced using a BigDye terminator cycle sequencing kit (PE Applied Biosystems) with an automated DNA sequencer (ABI PRISM/3100 Genetic Analyzer).
The accession number of scrb1 is AB188388.
mRNA injection and detection of protein localization
The scrb1 gene and mutated variants
(scrb1rw16, scrb1rw468) were amplified
by RT-PCR. To make the scrb1
PDZs construct, the
N-terminal 423-amino acid region of the scrb1 gene was amplified by
RT-PCR. The stbm gene was amplified by RT-PCR as previously described
(Jessen et al., 2002
). All of
these genes were subcloned into pCS2 expression vectors and verified by
sequencing. Sense-capped mRNA was synthesized using mMessage mMachine (Ambion)
according to the manufacturer's guidelines. Approximately 1 nl of mRNA was
injected into one-cell stage embryos at a concentration of 0.5 mg/ml in
Danieau buffer (0.5 ng per embryo). To observe subcellular localization of the
expressed proteins, GFP-fused genes (Scrb:GFP, Scrb1rw16:GFP,
Scrb1
PDZs:GFP and GFP:Scrb1rw468) were generated
and mRNA was injected as described. Five samples injected with each construct
were observed by confocal microscopy at 10-12 hpf.
Knockdown by anti-sense morpholino oligonucleotides
Antisense morpholino oligonucleotides (MO) were designed by Gene Tools to
target the llk/scrb1 gene:
Corresponding control MOs were as follows (lower case letters indicate mispaired residues):
The MO/ATG was designed for targeting the putative AUG translation start
site (underlined) and the MO/2e2i was designed for targeting the boundary of
the second exon and the second intron (underlined) according to the
manufacturer's instructions. The MO to the tri/stbm was designed as
previously described (Jessen et al.,
2002
). Approximately 1 nl of MO was injected into one-cell stage
embryos at concentrations of 5 or 0.5 mg/ml in Danieau buffer (5 or 0.5 ng per
embryo) as described (Nasevicius and
Ekker, 2000
).
Labeling and tracing the r4-derived cell movements
Caged fluorescein-conjugated dextran (Molecular Probes) was injected into
1-cell stage Isl1-GFP embryos, and then the whole r4 region was exposed to UV
illumination at 16 hpf using a fixed-stage microscope (Olympus BX-51WI)
modified with special optics for uncaging experiments as previously described
(Ando et al., 2001
; Ando et
al., 2003; Kozlowski and Weinberg,
2000
). Three embryos were fixed at 24 hpf, and subjected to
antibody staining using an anti-fluorescein antibody (Molecular Probes),
anti-GFP antibody (Santa Cruz Biotechnology, 1:500), and secondary antibodies
conjugated to Alexa Fluor 488 and 533.
| Results |
|---|
|
|
|---|
|
|
Tag-1 is a specific marker for migrating nVII motor neurons
(Fig. 3G) (Warren et al., 1999
). The
non-migratory cells in the llk embryos still expressed tag-1
mRNA (Fig. 3H), suggesting that
these cells retained the potential to differentiate normally into nVII motor
neurons. Consistent with this, these non-migratory cells extended the
GFP-positive peripheral axons normally
(Fig. 3I,J). The axons in the
llk embryos projected to the correct specific target muscles with the
same pattern as observed in wild-type embryos
(Fig. 3K,L).
Patterning of the hindbrain is unaffected in the llk embryos
Each rhombomere shows differential expression of several genes which are
essential for the fate determination of that specific rhombomere. hoxb1a,
krox20 and valentino(val)/mafB are expressed in r4, r3/5 and
r5/6, respectively, in the developing zebrafish hindbrain
(Prince et al., 1998
;
Oxtoby and Jowett, 1993
;
Moens et al., 1998
). The
patterns of expression of hoxb1a
(Fig. 4A,B), krox20
(Fig. 4C,D) and
val/mafB (Fig. 4E,F)
were identical between the llk and wild-type embryos, suggesting that
the segmental patterning of the rhombomeres was normal in the mutant
embryos.
|
llk encodes zebrafish scribble1
The llk locus was genetically mapped to linkage group 7 between
the SSLP markers, Z11545 and Z62080
(Shimoda et al., 1999
)
(Fig. 5A). To isolate DNA
fragments closely associated with the llk locus, a representational
differential analysis (RDA) (Lisitsyn et
al., 1993
; Sato and Mishina,
2003
; Matsuda and Mishina,
2004
) was performed. Four RDA products were closely linked to the
llk locus and one of them, EcoRI-46, showed no recombination per 2054
meioses in F2 crosses (Fig.
5A). The DNA fragments carrying the EcoRI-46 sequence were
obtained by screening a PAC library together with a search of the Sanger
Center genome database. The EcoRI-46 site was located in the first intron of a
gene (Fig. 5B) that is highly
homologous to mouse Scrb (Fig.
5F) (Murdoch et al.,
2003
). Sequence analyses of cDNA revealed that at least exons 16,
28, 31, 34, 40 and 43 were differentially used by alternative splicing
(Fig. 5C). Two of them (exons
16 and 43) corresponded to those used in mouse Scrb [exons 16 and 36
in mouse (Murdoch et al.,
2003
)]. RT-PCR was performed and the most predominant transcript
that putatively encoded a 1724 amino acid protein was identified (encompassing
exon 16, but no other alternatively used exons;
Fig. 5C,D). We refer to this
gene product as the wild-type scrb1 gene in the following
experiments. Scrb1 is a cytoplasmic protein carrying a set of 16 leucine-rich
repeats (LRR) and four PDZ (for PSD-95/Discs-large/ZO-1) domains
(Fig. 5F). Sequence analyses
showed that each of the two alleles of the llk locus carries a point
mutation in the scrb1 gene. The allele llkrw16
carries a mis-sense amino acid substitution in the first PDZ domain (I734D),
and llkrw468 carries a stop codon in the LRR domain
(K310Stop; Fig. 5E,F).
|
Functional knock-down of scrb1 recapitulates defects of migration of the nVII motor neurons
To confirm that loss of function of the scrb1 gene is responsible
for the llk phenotype, antisense morpholino oligos (MO) were designed
to specifically disrupt scrb1 gene function. MO/ATG was designed to
abolish translation of scrb1 maternally and zygotically, while the
MO/2e2i abolishes splicing of the gene zygotically. Normal migration of the
nVII motor neurons was completely lost in both the resulting morphants
compared with the wild-type embryo [5 ng of MO per embryo,
Fig. 6B,C, and A, respectively;
100% of MO/ATG-injected embryos (n=82) and 98% of MO/2e2i-injected
embryos (n=61)]. Injection of each control MO (MO/ATG-5mis and
MO/2e2i-5mis) did not impair migration of nVII motor neurons (0%,
n=22 and n=35, respectively), confirming the specificity of
the antisense MOs.
|
PDZs)
(Fig. 6D). Maternal-and-zygotic
(MZ) llkrw468 embryos were injected with 0.5 ng of each
mRNA. MZ-llkrw468 embryos showed slight CE defects
(described in detail below), but these defects were restricted to the tail
regions (see below), and the migration phenotype was not affected by the
maternal depletion of the gene. When wild-type scrb1 mRNA was
injected into MZ-llkrw468 homozygous eggs
(n=162), 61% of embryos had migration of nVII motor neurons restored
(Fig. 6E,F); in 24% this
migration was only into r5, and in 37%, migration was fully restored so that
neurons moved through r5 into r6. Injection of scrb1rw16
mRNA (n=175) also rescued the migration phenotype, but only in 10.2%
of embryos (5.1% with partial migration to r5, 5.1% with fully restored
migration through to r6; Fig.
6G). In contrast, injection of scrb1rw468 mRNA
(n=41) or scrb1
PDZs mRNA (n=42)
failed to rescue the migration phenotype in any embryos. Thus, both
loss-of-function and gain-of-function experiments confirmed that the
llk locus encompasses the scrb1 gene.
The llk gene acts mainly in a non cell-autonomous manner during migration of the nVII motor neurons
Mosaic experiments were performed to determine the cell autonomy of the
llk mutation. Wild-type-derived nVII motor neurons failed to migrate
caudally in MZ-llk host embryos
(Fig. 7A). We observed
peripheral axons of these cells in each mosaic embryo to ensure that the donor
cells were nVII motor neurons. In all of the mosaic embryos examined, a part
of the facial motor axons bundle was labeled with rhodamine-dextran
(Fig. 7A'), showing that
they were indeed nVII motor neurons. These results suggest that the
llk gene acts in a non cell-autonomous manner during migration of the
nVII motor neurons, which is consistent with the observation that
scrb1 mRNA is strongly expressed in the dorsal neural tube cells
surrounding the migrating nVII motor neurons
(Fig. 5M). In contrast, most of
the MZ-llk-derived nVII motor neurons migrated normally through r5
into r6 in wild-type host embryos (Fig.
7B). Since some of the late-born neurons remained in r4 at the
time of observation, we could not completely exclude the autonomous
involvement of the scrb1 gene in migration of the nVII motor
neurons.
|
|
PDZs mRNA (n=42) failed to rescue the
CE phenotype in any embryos. These results indicate that the scrb1
gene is essential for CE, and that the first PDZ domain of the Scrb1 protein
is important for this activity.
Subcellular localization of Scrb1 and mutated proteins
To analyze the subcellular localization of Scrb1 protein, we injected mRNA
from expression vectors encoding wild-type or mutated Scrb1 fused with GFP
(Scrb1:GFP) into one-cell stage embryos. Overexpression of the wild-type
Scrb1:GFP also rescued the migration of the nVII motor neurons (in 62% of
embryos; n=45), suggesting that the GFP fusion does not abolish
normal function of the original Scrb1. Wild-type Scrb1:GFP protein was
localized to the plasma membranes of all cells in which they were
overexpressed (5 embryos; Fig.
6H). The mutated Scrb1rw16:GFP and
Scrb1
PDZs:GFP proteins were both similarly localized to the
plasma membrane (5 embryos; Fig.
6I,K). However, mutated Scrb1rw468 protein was not
associated with the cell membrane, but was localized to the cytoplasm (5
embryos; Fig. 6J). These
suggest that the LRR domain is sufficient for the membrane-associated
localization of Scrb1 protein. Although Scrb1rw16 was localized to
the plasma membrane, injection of this construct restored migration of the
nVII motor neurons and CE movements in MZ-llkrw468 embryos
only at a lower frequency. Therefore, the membrane-associated localization of
Scrb1 by way of the LRR domain is not sufficient, but the first PDZ domain is
required for the normal functions of Scrb1.
Genetic interaction between llk/scrb1 and tri/stbm
To determine whether there is an epistatic interaction between the
scrb1 and stbm genes in the regulation of migration of the
nVII motor neurons, we performed some rescue experiments.
We confirmed that only 0% (n=45) and 30% (n=37) of embryos injected with 5 ng and 0.5 ng of stbm MO, respectively, showed the normal migration of the nVII motor neurons (Fig. 8K). We also confirmed the activity of stbm mRNA by using the tri/stbm mutant embryos. The trirw75 homozygous embryos show the nVII motor neurons migration defects with strong CE defects (Fig. 2D). Sequencing analyses showed that the trirw75 allele carries a stop codon (Y342Stop), which results in deletion of the C-terminal intracellular domain of Stbm, and is likely to be a loss-of-function mutation. 22% of embryos obtained from heterozygous trirw75 parents show the nVII migration defects as expected (n=96). When 0.5 ng of stbm mRNA was injected into eggs obtained from heterozygous trirw75 parents, only 7.9% of embryos showed the nVII migration defects (n=139). These results indicate that 0.5 ng of stbm mRNA has activity enough to rescue loss of stbm gene function. Similarly, 0.5 ng of scrb1 mRNA restored the nVII motor neuron migration in MZ-llkrw468 embryos efficiently as described (Fig. 8F). In contrast, injection of 0.5 ng of stbm mRNA into the MZ-llkrw468 embryos did not restore the migration (0%, n=70). Similarly, injection of 0.5 ng of scrb1 mRNA with 5 ng of stbm MO did not restore the neuronal migration (0%, n=67). Injection of 0.5 ng of scrb1 mRNA with 0.5 ng of stbm MO also did not restore the neuronal migration (25% of embryos showed the normal migration, n=57). Thus, we conclude that the scrb1 and stbm genes do not act in a simple linear pathway in migration of the nVII motor neurons.
However, we observed strong genetic interactions between llk/scrb1
and tri/stbm genes in CE movements. As previously described
(Jessen et al., 2002
),
injection of 5-50 pg of stbm mRNA into wild-type embryos induced CE
defects resembling tri mutant phenotypes without affecting migration
of the nVII motor neurons as judged by the defects in extension of the tail.
Overexpression of 0.5 ng of scrb1 mRNA in wild-type embryos also
induced slight CE defects without affecting migration of the nVII motor
neurons (63%, n=51, Fig.
8M). Injection of 5 ng of stbm MO into
MZ-llkrw468 embryos slightly enhanced CE defects (21% of
embryos showed enhanced phenotype, n=39;
Fig. 8L). Injection of 0.5 ng
of stbm mRNA in the MZ-llkrw468 embryos
significantly enhanced CE defects (14%, n=70). More strikingly,
co-injection of 5 ng of stbm MO together with 0.5 ng of
scrb1 mRNA markedly enhanced CE defects (91% of embryos showed severe
defects, n=67, Fig.
8N; Table 1). Co-injection of 5 ng of stbm MO together with 0.5 ng of
scrb1rw16 mRNA also enhanced CE defects, but at a lower
frequency (33% of embryos showed severe defects, n=98).
|
In conclusion, overexpression of scrb1 or stbm induced the similar CE phenotypes as loss of function of these genes. Moreover, CE was affected most severely when scrb1 was overexpressed in the absence of stbm.
Migration of the nVII motor neurons is not associated with CE movements
It is shown that CE movements of the midline cells are required for neural
tube closure in Xenopus
(Wallingford and Harland,
2002
). In mouse embryos, Crc/Scrb is required for neural
tube closure (Murdoch et al.,
2003
). Therefore, we wondered if the caudal migration of the nVII
motor neurons in normal embryos could be a consequence of any uneven
morphogenetic movements of the hindbrain neuroepithelial tissues. For
examples, if CE movements proceed more slowly near the ventral midline than in
the more lateral region of the r4 tissue, then the medial part including the
nVII motor neurons may be left behind by the rest of the r4 tissue and appear
to have migrated out from the other r4 tissue. To address this possibility, we
labeled the r4 region by uncaging the caged fluorescein-conjugated dextran and
traced the cell movements during development
(Kozlowski and Weinberg,
2000
). We showed that the nVII motor neurons were the only
population which came out of the labeled r4 tissue (3 embryos;
Fig. 9). These results indicate
that the nVII motor neurons migrate completely independently of the rest of
the r4 tissues. Thus, we conclude that the uncoordinated CE movements between
the tissue surrounding the nVII motor neurons and the rest of the hindbrain is
not the cause of the posterior displacement of the nVII motor neurons from
r4.
|
| Discussion |
|---|
|
|
|---|
Localization of Scrb1 to the plasma membrane is mediated by the LRR domain
We showed that overexpressed Scrb1 protein is associated with the plasma
membrane. Moreover, the LRR domain alone is sufficient for the targeting of
this protein to the membrane, which is consistent with previous results
(Legouis et al., 2003
).
Drosophila Scribble and the C. elegans ortholog LET-413
localize to the basolateral membranes of epithelial cells
(Bilder and Perrimon, 2000
;
Bilder et al., 2000
;
Legouis et al., 2000
). The LRR
domain may be required for primary targeting of the protein to the membranes,
and then the PDZ domains may be important for precise localization of the
protein to specific sites on the membrane, via interaction with other membrane
proteins.
Llk/Scrb1 and Tri/Stbm may constitute a functional complex
Recent studies reported that a mammalian homologue
circletail(Crc)/Scrb is required for neural tube closure and the
orientation of sensory cells in the cochlea
(Murdoch et al., 2003
;
Montcouquiol et al., 2003
).
The defects in the Crc embryos are very similar to that in
loop-tail(Lp) mutants which are the result of mutations in Van
Gogh2(Vangl2)/stbm, and Crc/Scrb interacts
with Lp/Vangl2/stbm genetically (Kiber, 2001;
Murdoch et al., 2003
;
Montcouquiol et al., 2003
).
Thus, in vertebrates, Scrb may act together with Stbm in morphogenesis of
neural tissues.
In this study, we showed that injection of llk/scrb1 mRNA did not rescue migration of the VII motor neurons in tri/stbm MO-injected embryos. Similarly, injection of tri/stbm mRNA also failed to rescue neuronal migration in the llk embryos, suggesting that the llk/scrb1 and tri/stbm genes do not act in a simple linear pathway, but rather that they function by forming a functional complex.
Although our results and previous studies have suggested that there is a
genetic interaction between scrb1 and stbm
(Murdoch et al., 2003
;
Montcouquiol et al., 2003
), it
is not known whether the PDZ domains of Scrb directly interact with the
PDZ-binding domain of Stbm. In Drosophila, the second PDZ domain of
Scrb interacts with Dlg via GUKH (guanylate kinase holder protein) to form a
scaffolding complex at synaptic junctions
(Mathew et al., 2002
).
Furthermore, Dlg interacts with Stbm and this complex is required for plasma
membrane formation in epithelial cells
(Lee et al., 2003
). These
results suggest that Scrb, Stbm and Dlg may constitute a functional complex
during the formation of membrane structures.
If Tri/Stbm and Llk/Scrb1 form a functional complex, this complex would probably have two sites that associate with membranes: the transmembrane domain of Tri/Stbm and the LRR domain of Llk/Scrb1. In this study, we showed that knock-down of Tri/Stbm with overexpression of Llk/Scrb1 led to the most severe impairment of CE. These results indicate that Tri/Stbm may be required for localization of Llk/Scrb1 protein to the specific site of the membrane where they are anchored and function together. Release of membrane-associated Llk/Scrb1 from such positional constraint in the absence of Stbm may have more markedly perturbed the functional protein complexes controlling CE than simple overexpression of Scrb1 in the presence of Stbm.
We also demonstrated that the Scrb1rw16 protein, which has a single amino acid substitution in the first PDZ domain, has lower activity than the wild-type protein to rescue migration of the nVII motor neurons in the llk mutation. Similarly, overexpression of Scrb1rw16 induced CE defects to a lesser extent than that of wild-type Scrb1 protein. These results indicate that the first PDZ domain is also essential for Scrb1 activity. The first PDZ domain of Llk/Scrb1 may interact with another, as yet unidentified, component to establish a multi-protein complex required for its function.
Possible roles of Llk/Scrb1 in migration of the nVII motor neurons
We showed that the llk/scrb1 gene functions mainly in a non
cell-autonomous manner in migration. We also showed that the uncoordinated CE
movements between the medial r4 tissue surrounding the nVII motor neurons and
the rest of the hindbrain is not likely to be the cause of the posterior
displacement of the nVII motor neurons relative to r4. One possibility may be
the involvement of the Llk/Scrb1 protein (or the protein complex) in
establishing a concentration gradient of attractive cues in the hindbrain. For
example, the Llk/Scrb1 protein may interact with a transmembrane protein to
capture and display the attractive cues on the surface of cells in the
migratory pathway of the nVII motor neurons. Alternatively, the Llk/Scrb1
protein may be required by the neuroepithelial cells to prevent the migrating
nVII motor neurons from veering away from the normal migratory pathway as is
the case in the llk and ord embryos (see
Fig. 2J,K).
In zebrafish, we showed that several putative OLe neurons are born in r6
and migrate into r7, and that this migration is also impaired in the
llk embryos. The glossopharyngeal (nIX) motor neurons also failed to
migrate from r6 to r7 in the tri embryos
(Bingham et al., 2002
). These
results show that there are at least two cell populations that migrate, one
from r4 to r6 (nVII motor and r6-located OLe neurons), and the other from r6
to r7 (nIX motor and r7-located putative OLe neurons). The fact that both
r4-derived cells and r6-derived cells failed to migrate in the llk
and tri embryos may indicate that the migrations of these cells are
regulated by a common mechanism in different rhombomeres. If they are both
guided by a common attractive cue emanating from the caudal end of the
hindbrain, as was suggested in mouse embryos
(Studer, 2001
), this cue may
have been accumulated to saturation at r6 at which level an effective gradient
may have been lost, by the time the r4-derived nVII neurons had arrived at
r6.
Similarity and diversity in mechanisms regulating CE and migration of the nVII motor neurons
It has now been shown that llk/scrb1 (present study),
tri/stbm (Bingham et al.,
2002
; Jessen et al.,
2002
) and pk1
(Carreira-Barbosa et al., 2003
)
are required for both CE and neuronal migration. However, the possible PCP
signaling molecules kny/glypican4/6, slb/wnt11 and ppt/wnt5a
regulate CE (Topczewski et al.,
2001
; Heisenberg et al.,
2000
; Kilian et al.,
2003
), but do not regulate neuronal migration
(Bingham et al., 2002
;
Jessen et al., 2002
).
Moreover, overexpression of a dominant-negative Dishevelled (Dsh), which
blocks CE movements (Heisenberg et al.,
2000
), does not affect the neuronal migration
(Jessen et al., 2002
). These
results suggest that genetic cascades, which regulate the VII motor neuron
migration, may not coincide completely with those regulating CE movements.
In this study, we isolated a second mutant, ord, in which the nVII motor neurons are misguided away from the normal pathway. Preliminary results showed that the MZ-ord embryos did not have any defects in CE movements and are viable. These results suggest that the ord gene is only required for neuronal migration, and not for CE. Identification of the gene responsible for the ord mutation may provide us with clues to the mechanisms of neuronal migration, e.g. molecules regulating the attractive guidance cues.
Differentiation and migration of the nVII motor neurons occurs independently
The functions of the nVII motor neurons located ectopically in r4 in
morphants or mutants have not been analyzed. In hoxb1a knock-down
embryos, the non-migratory nVII motor neurons extend peripheral axons normally
(McClintock et al., 2002
).
However, OLe neurons innervating the ear fail to extend axons, indicating that
differentiation of these neurons is deficient in these morphants
(McClintock et al., 2002
). In
the tri embryos, although all of the non-migratory nVII motor neurons
appear to extend axons normally, it is not known whether they are functional
because of embryonic lethality (Bingham et
al., 2002
).
In this study, we were able to address this question, because the
llk mutation exclusively affects neuronal migration zygotically, and
the resultant embryos remain viable. We showed that the nVII motor neurons in
the zygotic llk embryos failed to migrate and remained at r4, but had
normal morphological development. Moreover, the llk homozygous larvae
showed apparently normal foraging behavior, and the jaw muscles appeared to
contract normally. The llk homozygous embryos were viable and
developed into fertile adults. Therefore, these non-migratory motor neurons
must function relatively normally despite their aberrant localization. Since
many genes have been implicated in migration of the VII motor neurons and this
process has been conserved in evolution
(Studer et al., 1996
;
Garel et al., 2000
;
Ohshima et al., 2002
;
Muller et al., 2003
), it is
unlikely that correct migration of nVll motor neurons has been maintained
without any survival advantage. Thus, it is rather more likely that
mislocation of the nVII motor neurons in the llk embryos may be
epigenetically compensated for by reorganization of neural networks during
development. This innate developmental plasticity may have laid the basis for
accommodating the loss of migration of the nVII motor neurons during evolution
to avian species (Studer,
2001
).
Possible functional redundancy within LAP family genes
In Drosophila scribble and C. elegans let-413 mutants,
cell-cell junctions are not positioned properly, resulting in embryonic death
with severe apicobasal polarity defects in epithelial cells
(Bilder and Perrimon, 2000
;
Bilder et al., 2000
;
Legouis et al., 2000
).
However, in mice (Murdoch et al.,
2003
; Montcouquiol et al.,
2003
) and in zebrafish (this study), scrb1 mutant embryos
appear to have normal epithelial cells. Four LAP family genes (scribble1,
erbin, densin-180 and lano) have been identified in mice
(reviewed by Santoni et al., 2002). Therefore, it is possible that other LAP
family genes may have overlapping or redundant functions in epithelial
formation in vertebrate species. In zebrafish, at least four LAP family genes
were also identified in the genome database (corresponding to
llk/scribble1, erbin, densin-180 and lano, data not shown).
Putative zebrafish erbin and lano mRNA was strongly
expressed maternally (data not shown), thus these genes are good candidates to
compensate for loss of Scribble1 function in epithelial polarity formation in
vertebrates.
In Crc/Scrb mutant mice embryos neural tube closure is severely
deficient (Murdoch et al.,
2003
). In contrast, there is no neural tube defect in zygotic or
MZ-llk embryos in zebrafish. It is possible that unidentified
zebrafish scribble1 homologs may regulate neurulation independently
of llk/scrb1 function. Alternatively, neurulation in zebrafish may be
achieved by mechanisms different from that in mice (reviewed by Lowery and
Sive, 2004). In mice, a neural tube with an open ventricle lumen forms by
folding of the neural plate epithelium. In contrast, in zebrafish, the neural
plate forms a solid neural keel, then a lumen opens in its midline to form the
tube (reviewed by Lowery and Sive, 2004). Thus, it is possible that
llk/scrb1 function may not be required for the teleost-specific
neurulation steps.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/132/10/2273/DC1
* Present address: School of Bionics, Tokyo University of Technology, 1404
Katakura, Hachioji, Tokyo 192-0982, Japan ![]()
| REFERENCES |
|---|
|
|
|---|
Ando, H. and Okamoto, H. (2003). Practical procedures for ectopic induction of gene expression in zebrafish embryos using Bhc-diazo-caged mRNA. Methods Cell Sci. 25, 25-31.[CrossRef][Medline]
Ando, H., Furuta, T., Tsien, R. Y. and Okamoto, H. (2001). Photo-mediated gene activation using caged RNA/DNA in zebrafish embryos. Nat. Genet. 28,317 -325.[CrossRef][Medline]
Bilder, D. and Perrimon, N. (2000). Localization of apical epithelial determinants by the basolateral PDZ protein Scribble. Nature 403,676 -680.)[CrossRef][Medline]
Bilder, D., Li, M. and Perrimon, N. (2000).
Cooperative regulation of cell polarity and growth by Drosophila
tumor suppressors. Science
289,113
-116.
Bingham, S., Higashijima, S., Okamoto, H. and Chandrasekhar, A. (2002). The Zebrafish trilobite gene is essential for tangential migration of branchiomotor neurons. Dev. Biol. 242,149 -160.[CrossRef][Medline]
Carreira-Barbosa, F., Concha, M. L., Takeuchi, M., Ueno, N.,
Wilson, S. W. and Tada, M. (2003). Prickle 1 regulates cell
movements during gastrulation and neuronal migration in zebrafish.
Development 130,4037
-4046.
Chandrasekhar, A., Moens, C. B., Warren J. T., Jr, Kimmel, C. B. and Kuwada, J. Y. (1997). Development of branchiomotor neurons in zebrafish. Development 124,2633 -2644.[Abstract]
Garel, S., Garcia-Dominguez, M. and Charnay, P. (2000). Control of the migratory pathway of facial branchiomotor neurones. Development 127,5297 -5307.[Abstract]
Heisenberg, C. P., Tada, M., Rauch, G. J., Saude, L., Concha, M. L., Geisler, R., Stemple, D. L., Smith, J. C. and Wilson, S. W. (2000). Silberblick/Wnt11 mediates convergent extension movements during zebrafish gastrulation. Nature 405, 76-81.[CrossRef][Medline]
Higashijima, S., Hotta, Y. and Okamoto, H.
(2000). Visualization of cranial motor neurons in live transgenic
zebrafish expressing green fluorescent protein under the control of the
islet-1 promoter/enhancer. J. Neurosci.
20,206
-218.
Jessen, J. R., Topczewski, J., Bingham, S., Sepich, D. S., Marlow, F., Chandrasekhar, A. and Solnica-Krezel, L. (2002). Zebrafish trilobite identifies new roles for Strabismus in gastrulation and neuronal movements. Nat. Cell Biol. 4,610 -615.)[Medline]
Kibar, Z., Vogan, K. J., Groulx, N., Justice, M. J., Underhill, D. A. and Gros, P. (2001). Ltap, a mammalian homolog of Drosophila Strabismus/Van Gogh, is altered in the mouse neural tube mutant Loop-tail. Nat. Genet. 28,251 -255.[CrossRef][Medline]
Kilian, B., Mansukoski, H., Barbosa, F. C., Ulrich, F. and Tada, M. and Heisenberg, C. P. (2003). The role of Ppt/Wnt5 in regulating cell shape and movement during zebrafish gastrulation. Mech. Dev. 120,467 -476.[CrossRef][Medline]
Kozlowski, D. J. and Weinberg, E. S. (2000). Photoactivatable (caged) fluorescein as a cell tracer for fate mapping in the zebrafish embryo. Methods Mol. Biol. 135,349 -355.[Medline]
Lee, O. K., Frese, K. K., James, J. S., Chadda, D., Chen, Z. H., Javier, R. T. and Cho, K. O. (2003). Discs-Large and Strabismus are functionally linked to plasma membrane formation. Nat. Cell Biol. 5,987 -993.[CrossRef][Medline]
Legouis, R., Gansmuller, A., Sookhareea, S., Bosher, J. M., Baillie, D. L. and Labouesse, M. (2000). LET-413 is a basolateral protein required for the assembly of adherens junctions in Caenorhabditis elegans. Nat. Cell Biol. 2, 415-422.[CrossRef][Medline]
Legouis, R., Jaulin-Bastard, F., Schott, S., Navarro, C., Borg, J. P. and Labouesse, M. (2003). Basolateral targeting by leucine-rich repeat domains in epithelial cells. EMBO Rep. 4,1096 -1102.[CrossRef][Medline]
Lisitsyn, N., Lisitsyn, N. and Wigler, M. (1993). Cloning the differences between two complex genomes. Science 259,946 -951.[Abstract]
Masai, I., Lele, Z., Yamaguchi, M., Komori, A., Nakata, A.,
Nishiwaki, Y., Wada, H., Tanaka, H., Nojima, Y., Hammerschmidt, M. et al.
(2003). N-cadherin mediates retinal lamination, maintenance of
forebrain compartments and patterning of retinal neurites.
Development 130,2479
-2494.
Matsuda, N. and Mishina, M. (2004).
Identification of chaperonin CCT gamma subunit as a determinant of
retinotectal development by whole-genome subtraction cloning from zebrafish no
tectal neuron mutant. Development
131,1913
-1925.
Mathew, D., Gramates, L. S., Packard, M., Thomas, U., Bilder, D., Perrimon, N., Gorczyca, M. and Budnik, V. (2002). Recruitment of scribble to the synaptic scaffolding complex requires GUK-holder, a novel DLG binding protein. Curr. Biol. 12,531 -539.[CrossRef][Medline]
McClintock, J. M., Kheirbek, M. A. and Prince, V. E. (2002). Knockdown of duplicated zebrafish hoxb1 genes reveals distinct roles in hindbrain patterning and a novel mechanism of duplicate gene retention. Development 129,2339 -2354.[Medline]
Metcalfe, W. K., Mendelson, B. and Kimmel, C. B. (1986). Segmental homologies among reticulospinal neurons in the hindbrain of the zebrafish larva. J. Comp. Neurol. 251,147 -159.[CrossRef][Medline]
Moens, C. B., Yan, Y. L., Appel, B., Force, A. G. and Kimmel, C. B. (1996). valentino: a zebrafish gene required for normal hindbrain segmentation. Development 122,3981 -3990.[Abstract]
Moens, C. B., Cordes, S. P., Giorgianni, M. W., Barsh, G. S. and Kimmel, C. B. (1998). Equivalence in the genetic control of hindbrain segmentation in fish and mouse. Development 125,381 -391.[Abstract]
Montcouquiol, M., Rachel, R. A., Lanford, P. J., Copeland, N. G., Jenkins, N. A. and Kelley, M. W. (2003). Identification of Vangl2 and Scrb1 as planar polarity genes in mammals. Nature 423,173 -177.[CrossRef][Medline]
Muller, M., Jabs, N., Lork, D. E., Fritzsch, B. and Sander, M. (2003). Nkx6.1 controls migration and axon pathfinding of cranial branchio-motoneurons. Development 130,5818 -5826.
Murdoch, J. N., Henderson, D. J., Doudney, K., Gaston-Massuet,
C., Phillips, H. M., Paternotte, C., Arkell, R., Stanier, P. and Copp, A.
J. (2003). Disruption of scribble (Scrb1) causes
severe neural tube defects in the circletail mouse. Hum. Mol.
Genet. 12,87
-98.
Nasevicius, A. and Ekker, S. C. (2000). Effective targeted gene `knockdown' in zebrafish. Nat. Genet. 26,216 -220.[CrossRef][Medline]
Ohshima, T., Ogawa, M., Takeuchi, K., Takahashi, S., Kulkarni,
A. B. and Mikoshiba, K. (2002). Cyclin-dependent kinase 5/p35
contributes synergistically with Reelin/Dab1 to the positioning of facial
branchiomotor and inferior olive neurons in the developing mouse hindbrain.
J. Neurosci. 22,4036
-4044.
Oxtoby, E. and Jowett, T. (1993). Cloning of
the zebrafish krox-20 gene (krx-20) and its expression during hindbrain
development. Nucleic Acids Res.
21,1087
-1095.
Prince, V. E., Moens, C. B., Kimmel, C. B. and Ho, R. K. (1998). Zebrafish hox genes: expression in the hindbrain region of wild-type and mutants of the segmentation gene, valentino. Development 125,393 -406.[Abstract]
Sato, T. and Mishina, M. (2003). Representational difference analysis, high-resolution physical mapping, and transcript identification of the zebrafish genomic region for a motor behavior. Genomics 82,218 -229.[CrossRef][Medline]
Solnica-Krezel, L., Schier, A. F. and Driever, W. (1994). Efficient recovery of ENU-induced mutations from the zebrafish germline. Genetics 136,1401 -1420.[Abstract]
Shimoda, N., Knapik, E. W., Ziniti, J., Sim, C., Yamada, E., Kaplan, S., Jackson, D., de Sauvage, F., Jacob, H. and Fishman, M. C. (1999). Zebrafish genetic map with 2000 microsatellite markers. Genomics 58,219 -232.[CrossRef][Medline]
Strutt, D. (2003). Frizzled signalling and cell
polarisation in Drosophila and vertebrates.
Development 130,4501
-4513.
Studer, M., Lumsden, A., Ariza-McNaughton, L., Bradley, A. and Krumlauf, R. (1996). Altered segmental identity and abnormal migration of motor neurons in mice lacking Hoxb-1. Nature 386,630 -634.
Studer, M. (2001). Initiation of facial
motoneurone migration is dependent on rhombomeres 5 and 6.
Development 128,3707
-3716.
Topczewski, J., Sepich, D. S., Myers, D. C., Walker, C., Amores, A., Lele, Z., Hammerschmidt, M., Postlethwait, J. and Solnica-Krezel, L. (2001). The zebrafish glypican knypek controls cell polarity during gastrulation movements of convergent extension. Dev. Cell 1,251 -264.[CrossRef][Medline]
Trevarrow, B., Marks, D. L. and Kimmel, C. B. (1990). Organization of hindbrain segments in the zebrafish embryo. Neuron 4,669 -679.[CrossRef][Medline]
Wallingford, J. B. and Harland, R. M. (2002). Neural tube closure requires Dishvelled-dependent convergent extension of the midline. Development 129,5815 -5825.[CrossRef][Medline]
Warren, J. T. Jr, Chandrasekhar, A., Kanki, J. P., Rangarajan, R., Furley, A. J. and Kuwada, J. Y. (1999). Molecular cloning and developmental expression of a zebrafish axonal glycoprotein similar to TAG-1. Mech. Dev. 80,197 -201.[CrossRef][Medline]
Westerfield, M. (1995). The Zebrafish Book. Eugene, Oregon: University of Oregon.
Weinberg, E. S., Allende, M. L., Kelly, C. S., Abdelhamid, A., Murakami, T., Andermann, P., Doerre, O. G., Grunwald, D. J. and Riggleman, B. (1996). Developmental regulation of zebrafish MyoD in wild-type, no tail and spadetail embryos. Development 122,271 -280.[Abstract]
This article has been cited by other articles:
![]() |
D. C.Y. Phua, P. O. Humbert, and W. Hunziker Vimentin Regulates Scribble Activity by Protecting It from Proteasomal Degradation Mol. Biol. Cell, June 15, 2009; 20(12): 2841 - 2855. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Skouloudaki, M. Puetz, M. Simons, J.-R. Courbard, C. Boehlke, B. Hartleben, C. Engel, M. J. Moeller, C. Englert, F. Bollig, et al. Scribble participates in Hippo signaling and is required for normal zebrafish pronephros development PNAS, May 26, 2009; 106(21): 8579 - 8584. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ohata, S. Kinoshita, R. Aoki, H. Tanaka, H. Wada, S. Tsuruoka-Kinoshita, T. Tsuboi, S. Watabe, and H. Okamoto Neuroepithelial cells require fucosylated glycans to guide the migration of vagus motor neuron progenitors in the developing zebrafish hindbrain Development, May 15, 2009; 136(10): 1653 - 1663. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nola, M. Sebbagh, S. Marchetto, N. Osmani, C. Nourry, S. Audebert, C. Navarro, R. Rachel, M. Montcouquiol, N. Sans, et al. Scrib regulates PAK activity during the cell migration process Hum. Mol. Genet., November 15, 2008; 17(22): 3552 - 3565. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Tanaka, R. Maeda, W. Shoji, H. Wada, I. Masai, T. Shiraki, M. Kobayashi, R. Nakayama, and H. Okamoto Novel mutations affecting axon guidance in zebrafish and a role for plexin signalling in the guidance of trigeminal and facial nerve axons Development, September 15, 2007; 134(18): 3259 - 3269. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wang and J. Nathans Tissue/planar cell polarity in vertebrates: new insights and new questions Development, February 15, 2007; 134(4): 647 - 658. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Stoick-Cooper, G. Weidinger, K. J. Riehle, C. Hubbert, M. B. Major, N. Fausto, and R. T. Moon Distinct Wnt signaling pathways have opposing roles in appendage regeneration Development, February 1, 2007; 134(3): 479 - 489. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wada, H. Tanaka, S. Nakayama, M. Iwasaki, and H. Okamoto Frizzled3a and Celsr2 function in the neuroepithelium to regulate migration of facial motor neurons in the developing zebrafish hindbrain Development, December 1, 2006; 133(23): 4749 - 4759. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Montcouquiol, N. Sans, D. Huss, J. Kach, J. D. Dickman, A. Forge, R. A. Rachel, N. G. Copeland, N. A. Jenkins, D. Bogani, et al. Asymmetric localization of Vangl2 and Fz3 indicate novel mechanisms for planar cell polarity in mammals. J. Neurosci., May 10, 2006; 26(19): 5265 - 5275. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||