|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 18 May 2005
doi: 10.1242/dev.01859
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Center for Basic Neuroscience, UT Southwestern Medical Center, Dallas, TX
75390, USA
2 Division of Molecular Neurobiology, National Institute for Medical Research,
The Ridgeway, Mill Hill, London NW7 1AA, UK
* Author for correspondence (e-mail: Jane.Johnson{at}UTSouthwestern.edu)
Accepted 12 April 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Spinal cord development, Dorsal horn, bHLH, Neuronal specification, Mouse, Atoh1, Neurog2, Ascl1
| Introduction |
|---|
|
|
|---|
Neurons in the mouse dorsal spinal cord are largely born between embryonic
day 10 and 14 (E10-E14). These neurons provide the network that connects and
modulates sensory input from the periphery to the spinal cord and brain.
Currently there are six early (dI1-dI6) and two late (dILA and
dILB) dorsal neuron types defined by birthdate, position in the
dorsoventral axis, and distinct homeodomain (HD) transcription factor markers
(Caspary and Anderson, 2003
;
Helms and Johnson, 2003
). The
most dorsal of these, dI1-dI3, are dependent on roof plate signals, whereas
dI4-dI6 and dILA/B form independently of these signals and are
distinguished by the presence of the HD factor Lbx1
(Gross et al., 2002
;
Lee et al., 2000
;
Müller et al., 2002
). The
combinations of HD factors in early stages of neuronal differentiation have
been crucial for defining these distinct dorsal interneuron populations. Much
less is known about how these neurons contribute to the overall circuitry of
the spinal cord (Cheng et al.,
2004
; Lanuza et al.,
2004
). Mice mutant for specific HD factors, such as Lbx1 and
Tlx1/3, have been used to link the fate of some of these populations to a
GABAergic or glutamatergic-specific neuronal type at later stages
(Cheng et al., 2004
;
Gross et al., 2002
;
Müller et al., 2002
).
Progenitor populations located in the ventricular zone of the neural tube
can also be classified by transcription factor patterns. In ventral regions,
the primary determinants of neuronal specification are combinations of HD
transcription factors (Briscoe et al.,
2000
; Ericson et al.,
1997
; Pierani et al.,
2001
). By contrast, dorsal progenitor domains have largely been
defined by bHLH transcription factors
(Gowan et al., 2001
). A role
for bHLH factors in specification of dorsal neurons was first suggested by
expression domains in the dorsoventral axis of Math1 (Atoh1 Mouse
Genome Informatics), Ngn1 (Neurog1 Mouse Genome Informatics), Mash1
(Ascl1 Mouse Genome Informatics)
(Gowan et al., 2001
;
Helms and Johnson, 1998
;
Lo et al., 1991
;
Ma et al., 1997
;
Sommer et al., 1996
) and, more
recently, Olig3 (Müller et al.,
2005
). Each of these factors represents a distinct sub-class of
neuronal bHLH (Bertrand et al.,
2002
). Within the dorsal neural tube, Math1 is in ventricular zone
cells adjacent to the roof plate (Helms
and Johnson, 1998
), Ngn1 is just ventral to the Math1 domain
(Gowan et al., 2001
;
Lee et al., 1998
) and Mash1 is
ventral to the Ngn1 domain extending almost to the sulcus limitans
(Gowan et al., 2001
;
Guillemot and Joyner, 1993
;
Lo et al., 1991
). There is
little if any overlap in Math1, Ngn1 and Mash1 in individual cells
(Gowan et al., 2001
). The bHLH
factors have been shown to have at least two functions during neural
development: to induce neuronal differentiation and to specify neuronal
sub-types (Cau et al., 2002
;
Farah et al., 2000
;
Nakada et al., 2004
;
Parras et al., 2002
;
Perez et al., 1999
).
Furthermore, cross-inhibitory regulation of expression between Math1, Ngn1 and
Mash1 has been suggested as a mechanism for refining distinct progenitor
domains (Gowan et al., 2001
;
Parras et al., 2002
). By
contrast, Ngn2, a bHLH factor most closely related to Ngn1, partially overlaps
with Ngn1 and Mash1 (Fig. 1)
(A.W.H. and J.E.J., unpublished), whereas Olig3 overlaps with Math1, Ngn1 and
dorsal Mash1 (Müller et al.,
2005
), suggesting different rules and additional complexities for
the functions of Ngn2 and Olig3.
Although inroads have been made into identifying important players in the
specification of spinal cord neurons, the underlying logic behind a
combinatorial code for specification of these neurons is far from complete.
Indeed, in the dorsal neural tube a progenitor/neuron relationship has only
been defined for Math1+ progenitors with dI1 neurons, Ngn1+ progenitors with
dI2 neurons (Gowan et al.,
2001
) and Olig3+ progenitors with dI1-dI3
(Müller et al., 2005
).
The generation of dI3, dI4 and dI5 from Mash1+ progenitors has only been
inferred by position in the dorsoventral axis
(Gross et al., 2002
;
Müller et al., 2002
;
Qian et al., 2002
). In this
study, we show that cells with the highest levels of Mash1 appear to give rise
to dI3 and dI5, but not dI4, neurons. Consistent with this lineage
relationship, dI5 and most dI3 are lost in the Mash1 mutant, whereas
the dI4 neuronal population appears to increase. By contrast, Ngn2 overlaps
with Mash1 and Ngn1 but has later temporal characteristics. Loss of Ngn2
alone, or in combination with Mash1, reveals a function for Ngn2 downstream of
Mash1 in modulating the number of Mash1-dependent neurons that form. Mouse
mutants where the balance and temporal characteristics of Mash1 and Ngn2
levels have been altered were used to refine a model for how these factors
function in generation of the correct composition of neurons in the dorsal
spinal cord.
| Materials and methods |
|---|
|
|
|---|
Transgenic mouse generation and mouse mutant strains
Transgenic mice were generated by standard procedures
(Hogan et al., 1986
) using
fertilized eggs from B6D2F1 (C57B1/6xDBA) crosses. M1-GIC BAC
was prepared using a modified Qiagen Midi Prep procedure as directed by
manufacturer. The M1-GIC BAC was then injected into the pronucleus of
fertilized mouse eggs at 0.5-1 ng/µl in 10 mM Tris (pH 7.5), 0.1 mM EDTA,
100 mM NaCl. Transgenic animals were identified by PCR analysis using tail or
yolk sac DNA with primers to CRE (5' GGACATGTTCAGGGATCGCCAGGCG 3'
and 5' GCATAACCAGTGAAACAGCATTGCTG 3').
The mouse mutant strains used in this study have been previously published:
Mash1 (Guillemot et al.,
1993
), Ngn2 (Fode et
al., 1998
), Mash1KINgn2 and
Ngn2KIMash1 (Parras et
al., 2002
), and R26R-YFP
(Srinivas et al., 2001
).
Embryos were staged based on assumed copulation at E0, halfway through the
dark cycle. All procedures on animals follow NIH Guidelines and were approved
by the UT Southwestern Institutional Animal Care and Use Committee.
Immunofluorescence and mRNA in situ hybridization
Staged embryos were dissected in cold 0.1 M sodium phosphate buffer (pH
7.4), fixed in 4% formaldehyde in 0.1 M sodium phosphate buffer (pH 7.4) for 2
hours at 4°C, sunk in 30% sucrose in 0.1 M sodium phosphate buffer pH 7.4
overnight at 4°C, embedded in OCT, cryosectioned at 30 µm and processed
for immunofluorescence or mRNA in situ hybridization. All sections shown are
from the level of the upper limbs.
For immunofluorescence, slides were incubated in the appropriate dilution
of primary antibody in PBS/1% goat serum/0.1% Triton X-100, followed by either
goat anti-rabbit, mouse or guinea pig IgG conjugated with Alexa Fluor 488, 594
or 647 (Molecular Probes). Primary antibodies used for this study include:
rabbit anti-Mash1 (Horton et al.,
1999
), mouse anti-Ngn2 (Lo et
al., 2002
), mouse anti-Lhx1/5 (4F2), mouse anti-Islet1/2 (39.4D5),
mouse anti-Lmx, (Developmental Studies Hybridoma Bank), rabbit anti-GFP
(Molecular Probes), rabbit and guinea pig anti-Brn3a
(Fedtsova and Turner, 1997
),
rabbit, rat and guinea pig anti-Lbx1
(Gross et al., 2002
;
Müller et al., 2002
),
guinea pig anti-Lmx1b (Müller et al.,
2002
), rabbit anti-Islet1/2
(Tsuchida et al., 1994
),
rabbit anti-Pax2 (Zymed), and mouse anti-BrdU (Becton Dickinson). For BrdU
labeling, pregnant mothers were injected with 200 µg BrdU per gram body
weight 1 hour before sacrifice. For double labeling experiments using the
anti-BrdU antibody, either Mash1 or Ngn2 antibody staining was carried out in
full, followed by treatment with 2 N HCl for 20 minutes, 0.1 M sodium borate
(pH 8.5) for 20 minutes and incubation with mouse anti-BrdU antibody as
described above. Cell death was detected using TUNEL analysis (Roche) on E10.5
and E11.5 sections. Fluorescence imaging was carried out on a BioRad MRC 1024
confocal microscope. For each experiment, multiple sections from at least
three different embryos were analyzed and counted.
mRNA in situ hybridization was performed essentially as described using a
combined protocol (Birren et al.,
1993
; Ma et al.,
1998
). A detailed protocol is available upon request. Mash1,
Ngn1 and Ngn2 antisense probes were made from plasmids
containing the coding region of each gene
(Gowan et al., 2001
).
In ovo chick electroporation
Fertilized White Leghorn eggs were obtained from the Texas A&M Poultry
Department (College Station, TX) and incubated at 37°C. Solutions of
supercoiled plasmid DNA (2 µg/ml) in PBS/0.02% Trypan Blue were injected
into the lumen of the closed neural tube at stage HH13-14, and embryos
electroporated as previously described
(Funahashi et al., 1999
;
Muramatsu et al., 1997
;
Nakada et al., 2004
;
Suemori et al., 1990
). A GFP
expression vector (CMV-eGFP; Clontech) was co-injected as a control
to monitor efficiency and extent of electroporation. Embryos were harvested 24
hours later at HH23-24, fixed in 4% formaldehyde for 1 hour, and processed as
above for cryosectioning and immunofluorescence. For each experiment, multiple
sections from at least three electroporated embryos were analyzed and counted.
All sections shown were taken between the upper and lower limb regions.
All electroporations used the expression vector pMiwIII, which drives
expression through a chick ß-actin promoter
(Matsunaga et al., 2001
;
Suemori et al., 1990
). PCR
fragments containing the coding regions of rat Mash1 and mouse
Ngn2 were cloned into NcoI and XbaI sites of a
modified pMiwIII expression vector. Protein expression was verified by
immunofluorescence with antibodies to Mash1 and Ngn2.
| Results |
|---|
|
|
|---|
Mash1 is present throughout the mediolateral extent of the ventricular zone, whereas Ngn2 is enriched more laterally (Fig. 1A,B). This spatial pattern suggests these two factors are acting at different times during neuronal development as cells move laterally out of the ventricular zone when they exit the cell cycle and initiate a program of neuronal differentiation. To characterize Mash1 and Ngn2 relative to cell proliferation, we used BrdU incorporation to detect cells in S phase. In E10.5 embryos exposed to BrdU for 1 hour before analysis, a subset of Mash1+ cells were detected that incorporate BrdU (Fig. 1C,E, arrows). By contrast, Ngn2+ cells did not score positively for BrdU incorporation (Fig. 1D,F). These results suggest that Mash1 is present at an earlier stage than Ngn2 during neuronal differentiation, and that temporal regulation of these factors may be important for their activities. Alternatively, Mash1 and Ngn2 could be revealing a code for dorsal interneuron specification such that ventricular zone cells containing each bHLH singly, or in combination, give rise to a distinct neuronal population. In this study, we used both loss-of-function and gain-of-function experiments to address the role of Mash1 and Ngn2 in specification of dorsal neuronal subtypes dI2-dI5.
|
|
Ngn2 acts to limit Mash1 activity in dI3 and dI5 neuron formation
The role of Ngn2 in specification of dorsal neuronal populations was also
examined to test the hypothesis that Mash1 and Ngn2 provide a combinatorial
code for dorsal neuron identity. In E10.5 embryos null for Ngn2, all neuronal
populations (dI1-dI6) were generated (Fig.
2), demonstrating that Ngn2 is not required for any specific
dorsal cell type. However, the composition of neurons that formed was altered
with a subtle increase in the number of dI3 (Isl1) and dI5 (Lmx1b) neurons
relative to wild-type embryos (Fig.
2E,G,I,K), and no significant changes in dI2 (Lhx1/5;Brn3a) and
dI4/6 (Pax2) populations were detected
(Fig. 2A,C,I,K). Excess levels
of Ngn2 in the chick neural tube resulted in a complementary phenotype to the
Mash1 experiments in that dI3 (Isl1) and dI5 (Lmx1b) were dramatically
decreased, but dI4 (Pax2) was slightly increased relative to the non-injected
side (Fig. 3B,D,F,H, see graph
for cell counts). Together, these results demonstrate that Ngn2, although not
required for any individual neuronal subtype, limits the generation of dI3 and
dI5 neurons, two populations that require Mash1 activity.
|
|
Surprisingly, embryos null for both Mash1 and Ngn2 have an apparent loss of dI4 neurons (Fig. 2L), a phenotype not predicted from the single mutants. Although dI4 and dI6 cannot be distinguished in the absence of dI5, the position of the Pax2-positive cells in the Mash1/Ngn2 double knockout strongly suggests a complete loss of dI4 neurons, and possibly also dI6 neurons (Fig. 2L). This loss of dI4 in the double knockout is in contrast to the single knockouts, where there was no indication that either Mash1 or Ngn2 is required for dI4 generation. In fact, dI4/6 cells are significantly increased in the Mash1 null (Fig. 2J). Thus, there is an apparent redundant function for Mash1 and Ngn2 in the generation of dI4 neurons.
Mash1-positive cells give rise primarily to dI3 and dI5, but not dI4 neurons
Given the presence of Mash1 in the ventricular zone throughout the
dorsoventral domain adjacent to dI3, dI4 and dI5 neurons, it was surprising
that dI4 neurons increased in the Mash1 knockout, while dI3 and dI5
were lost. This finding suggests either Mash1+ cells become dI4 neurons but do
not require Mash1, or that there are distinct low- or non-Mash1+ cells in the
ventricular zone that give rise to the dI4 neurons. We used
recombination-based lineage tracing in vivo to distinguish between these two
possibilities. A transgenic mouse was used (M1-GIC) that expresses
both GFP and Cre in the Mash1 expression pattern from a bacterial
artificial chromosome containing 300 kb of genomic sequence surrounding the
Mash1 protein-coding region (see Fig. S1 in the supplementary
material). By crossing the M1-GIC mouse line with a Cre reporter line
R26R-YFP, any cell that has expressed the transgene will be
permanently labeled with YFP (Srinivas et
al., 2001
).
Embryos at E11.5 were examined by triple-label immunofluorescence to
determine the fate of Mash1+ cells in the dorsal neural tube. An antibody to
GFP detects GFP and YFP simultaneously, and thus, these cells are referred to
as GFP/YFP-positive cells. GFP/YFP-positive cells in the marginal zone were
counted and scored for co-labeling with markers of dI2-dI6 neurons
(Fig. 4,
Table 2). The majority of
GFP/YFP+ cells become dI5 (Lmx1b, 73%) and dI3 (Isl1, 17%), rarely, dI2
(Lhx1/5;Brn3a, 2%) and no dI6 (Lhx1/5, 0%), consistent with the requirement
for Mash1 specifically in dI3 and dI5. A notable percentage of
GFP/YFP-expressing cells co-label with dI4 (Lhx1/5, 8%) suggesting a Mash1+
cell can become a dI4 neuron. However, this represents only a small percentage
of the dI4 cells generated (
3%) and when identified, these co-labeled
cells border the dI3 and dI5 domains (Fig.
4E, arrow). We estimate that Cre induced recombination of the
reporter gene in the M1-GIC embryos is
50% because essentially
all dI5 neurons require Mash1, but we detect only 52% of the dI5 neurons
co-labeled with GFP/YFP (44 of 85 total Lmx1b cells). Furthermore, as we
detect 25% of the dI3 neurons co-labeled with GFP/YFP (nine out of 35 total
Isl1 cells), using the efficiency factor we predict
50% of dI3 neurons
are derived from Mash1+ cells, consistent with the partial loss of dI3
detected in the Mash1 null (Fig.
2). Taken together, these results suggest that the function of
Mash1 in the generation of dI3 and dI5 neurons is cell-autonomous, and
demonstrate that dI2, the majority of dI4, and dI6 neurons develop from cells
that contain Mash1 at levels not detected using this transgenic reporter mouse
line. Indeed, heterogeneity in endogenous Mash1 levels is detected by
immunofluorescence where ventricular zone cells adjacent to dI3 and dI5 have
Mash1 at higher levels than cells adjacent to dI4
(Fig. 5D).
|
|
Other than negative autoregulation, the most dramatic phenotype detected using these mouse strains is that the cells that should have expressed Mash1 (GFP/YFP) appear stalled in the ventricular zone with only a few cells detected in the marginal zone (Fig. 4B,D,F). These stalled cells aberrantly located in the ventricular zone have at least partially initiated a differentiation program; they express Lbx1, a marker that is normally restricted to the marginal zone, and they rarely incorporate BrdU, demonstrating that many have exited the cell cycle (see Fig. S2 in the supplementary material). TUNEL labeling shows no detectable increase in cell death in the neural tube at E10.5 and E11.5 (data not shown). Taken together, the precursors to dI3 and dI5 are not leaving the ventricular zone in the Mash1 null at E10.5/E11.5, and do not appear to significantly contribute to the increase in dI2 and dI4 as there was no increase in the proportion of GFP/YFP cells co-labeled with dI2 and dI4 markers (Fig. 4B,D,F). Thus, the ectopic dI2 and dI4/6 neurons in the Mash1 null at E10.5 cannot be accounted for by a switch in fate of dI3 and dI5 precursor cells. Furthermore, cells with undetectable levels of Mash1 must give rise to dI2 and dI4/6 neurons, and the number of these cells increase in the Mash1 knockout.
Mash1 and Ngn2 levels are independent of each other
Previously, it was demonstrated that cross-inhibition between the three
bHLH family members, Mash1, Math1 and Ngn1, was used to control cell number
and cell-type formed (Gowan et al.,
2001
; Scardigli et al.,
2001
). To determine whether this type of regulation is occurring
between Mash1 and Ngn2, we examined the levels of Ngn2 in the Mash1
null at E10.5 and vice versa. We observed no significant change in the number
of Ngn2+ cells in the dorsal neural tube of Mash1 nulls
(Fig. 5A-C) and no significant
change in the number of Mash1+ cells in Ngn2 nulls
(Fig. 5D-F). These results
suggest that Mash1 and Ngn2 do not use cross-inhibition as a mechanism to
control the number of dorsal neurons formed, consistent with the co-expression
seen with these two bHLH factors. Although difficult to quantify, there may be
increased protein levels of Mash1 in individual cells in the most dorsal
region in the Ngn2 null and vice versa in the Mash1 null
(Fig. 5, compare A with B and D
with E) and this may account for the increase in dI3 neurons in the
Ngn2-null embryos.
We have previously shown that an increase in Ngn1 in the dorsal neural tube
leads to an increase in dI2 neurons (Gowan
et al., 2001
). To test whether an increase in Ngn1 could explain
the increase in dI2 neurons in the Mash1 and the Mash1/Ngn2
double knockouts, we examined Ngn1 expression. Indeed, in the
Mash1 and the Mash1/Ngn2 double knockouts, we detected an
increase in Ngn1 expression in the dorsal neural tube at E10.5
relative to wild type (Fig. 5,
compare G with H and J). Consistent with the lack of change of the dI2
population in the Ngn2 null, there was no change in Ngn1 detected
(Fig. 5I). Thus, the excess dI2
cells in the Mash1 and Mash1/Ngn2 knockouts is probably due
to loss of cross-inhibition of Ngn1 by Mash1 in its dorsal domain of
expression (Gowan et al.,
2001
).
Ngn2 does not directly block Mash1 function in specifying dI3 and dI5 neurons
The preceding data strongly suggest that Ngn2 opposes Mash1 function in
generation of dI3 and dI5 neurons, and thus, the levels and timing of Mash1
and Ngn2 determine the number of dI3 and dI5 neurons that form. A possible
mechanistic model to explain the phenotypes involves Ngn2 directly opposing
Mash1 function by forming a non-functional heterodimer or by competing with
Mash1 on target genes, analogous to interactions between Olig2 and Ngn2
recently reported (Lee et al.,
2005
). The ability of Ngn2 and Mash1 to form non-functional
heterodimers, or to bind similar DNA recognition sites, has been shown in
vitro (Gradwohl et al., 1996
).
To test these models in vivo, we used mouse mutant lines that contain
replacement mutations where either the Ngn2 protein-coding region was
swapped into the Mash1 locus (Mash1KI Ngn2) or
the Mash1 protein-coding region was swapped into the Ngn2
locus (Ngn2KI Mash1)
(Parras et al., 2002
). The
heterozygous embryos in each strain shift the balance and temporal
relationship of Mash1 and Ngn2. If Ngn2 directly opposes Mash1 function, as
predicted above, then the Mash1KI Ngn2/+ would approximate
the Mash1 knockout, and the Ngn2KI Mash1/+ would
approximate a Mash1 gain-of-function phenotype. In Ngn2KI
Mash1/+ embryos, we see an increase in dI3 and dI5, reflecting the
Mash1 gain-of-function phenotype, as predicted from the specification function
of Mash1 (Fig. 6F,I,K,N).
However, rather than losing dI3 and dI5 in Mash1KI Ngn2/+
embryos, dI3 and dI5 are increased (Fig.
6F,G,K,L). Owing to variability between these mutant embryos, only
the dI3 increase was statistically significant. There is also a significant
increase in dI2 neurons in Mash1KI Ngn2/+ embryos,
possibly reflecting the role of Ngn2 in generation of these neurons
(Gowan et al., 2001
)
(Fig. 6A,B). Although the
results confirm the importance of Mash1 in specifying dI3 and dI5 neurons,
they contradict the model that Ngn2 directly opposes this activity of Mash1.
Rather, these results fit a model that highlights distinct functions for Mash1
and Ngn2, where Mash1 has a major role in neuronal specification and Ngn2 has
a role in temporal control of neuronal differentiation.
|
|
| Discussion |
|---|
|
|
|---|
Surprisingly, dI4 neurons, which appear to arise from the domain containing
Mash1, do not require Mash1 or Ngn2 alone. Rather, dI4 neurons appear to arise
from cells with low levels of Mash1 or none at all. Thus, the control of dI4/6
cell number implies a non-autonomous mechanism with respect to Mash1. Indeed,
the heterogeneous Mash1 levels may reflect function of the Notch-signaling
pathway in the neural tube at this time
(Lindsell et al., 1996
;
Ma et al., 1997
). In addition,
we recently identified another bHLH factor, PTF1a
(Krapp et al., 1996
), which is
required for dI4, and is present in the dI4 precursor domain where Mash1
levels are lower (S. Glasgow and J.E.J., unpublished). We have shown that
Mash1 levels are heterogeneous in the ventricular zone; thus, the cells with
the highest levels of Mash1 preferentially go on to become dI3 and dI5
neurons, and the cells with distinctly lower levels of Mash1 either remain as
progenitor cells or become dI4 neurons. These data, combined with previous
reports demonstrating the requirement of Math1 for dI1 neurons
(Bermingham et al., 2001
;
Helms and Johnson, 1998
) and
Ngn1/2 for dI2 neurons (Gowan et al.,
2001
), demonstrate an emerging bHLH transcription factor code for
specification of the early-born dorsal neuronal populations.
Additional refinements of the code are required to explain what determines
whether a Mash1 precursor will develop into a dI3 or a dI5 neuron.
Overexpression of Mash1 in the chick neural tube resulted in an increase in
both neuronal cell types; however, the normal position of the ectopic neurons
in the dorsoventral axis was essentially maintained. This result suggests that
Mash1 interacts with other factors to specify dI3 versus dI5, and that these
factors are likely restricted to defined domains in the dorsoventral axis of
the neural tube (Fig. 3C,G).
The identity of these interacting factors is suggested in recent studies.
Olig3, a bHLH factor present in precursors to dI1-dI3, when combined with
Mash1, induces the dI3 phenotype but not dI5
(Müller et al., 2005
). By
contrast, Lbx1, a HD class transcription factor expressed just as the cells
become postmitotic, is required for specification of dI4-dI6
(Gross et al., 2002
;
Müller et al., 2002
).
When Lbx1 is co-electroporated with Mash1 into the chick neural tube, there is
an increase in dI5 and decrease in dI3 (A.W.H., Y.N. and J.E.J., unpublished).
Furthermore, in PTF1a-deficient embryos, the loss of PTF1a leaves cells with
Mash1 and Lbx1, and this combination results in a fate switch from dI4 to dI5
(S. Glasgow and J.E.J., unpublished). Thus, additional refinements to the
transcription factor code suggest that combinations of factors such as Mash1
plus Olig3 specifies dI3 (Müller et
al., 2005
), Mash1 followed by Lbx1 specifies dI5, and
Mash1low plus PTF1a followed by Lbx1 specifies dI4 (S. Glasgow and
J.E.J., unpublished). In addition, upstream factors controlling expression of
the bHLH genes, e.g. suppression of Ngn1 and induction Mash1 expression by the
HD factor Gsh2 (Kriks et al.,
2005
), are also crucial for generating the correct composition of
neuronal subtypes. Identification of transcriptional targets for the bHLH and
HD factors, as has been reported in ventral spinal cord development
(Lee et al., 2005
;
Lee and Pfaff, 2003
), will be
required to determine the mechanisms controlling the specification of these
dorsal neurons.
Sequential actions of Mash1 and Ngn2 in specifying dorsal horn neurons
In the dorsal telencephalon, loss of Ngn2 results in an increase in Mash1+
cells and a subsequent increase in GABAergic neurons, presumably derived from
these ectopic Mash1-expressing cells (Fode
et al., 2000
). Thus, one function of Ngn2 in forebrain development
is to suppress levels of Mash1. This interpretation is similar to the
cross-repression seen between Math1, Ngn1 and Mash1 in the dorsal spinal
neural tube (Gowan et al.,
2001
). However, in the dorsal neural tube, Ngn2 overlaps with both
Mash1 (Fig. 1) and Ngn1 (A.W.H.
and J.E.J., unpublished). This colocalization is found in cells that do not
incorporate BrdU, suggesting that Ngn2 is somewhat temporally delayed relative
to Mash1 and Ngn1. Regardless, the overlap suggests there is little if any
transcriptional cross-repression mechanism regulating the expression of
Mash1 and Ngn2 in the dorsal neural tube. Indeed, in this
domain, the number of Mash1+ cells is not increased in the Ngn2 null,
nor is the number of Ngn2+ cells increased in the Mash1 null
(Fig. 5). Thus, rather than
cross-inhibition, these results support a model where Mash1 appears to be
temporally upstream of Ngn2.
Although Mash1 and Ngn2 do not appear to cross-repress each other's
expression, it is clear that Ngn2 limits the apparent activity of Mash1 in
inducing dI3 and dI5 neurons. This is evident in the Ngn2 null, where
there is an increase in the Mash1-dependent dI3 and dI5 populations, and in
overexpression of Ngn2 in chick, where there is a decrease in the number of
dI3 and dI5 neurons. However, the hypothesis that Ngn2 directly blocks Mash1
activity, either by forming inactive complexes or by blocking shared
DNA-binding sites, as has been reported for Olig2 and Ngn2
(Lee et al., 2005
), appears
incorrect as increasing Ngn2 and decreasing Mash1 in a cell, as occurs in
Mash1KINgn2/+, does not decrease dI3 and dI5 as would be
predicted.
An alternative model is that Ngn2 increases the probability that a cell
will permanently exit the cell cycle. Even subtle perturbations in the
probability of cell-cycle exit could modulate the number of cells of a
specific cell type that are formed. This function for Ngn2 in controlling the
timing of differentiation is similar to that attributed to Ngn2 in motoneuron
formation, where the balance of Olig2 and Ngn2 control the number of cells
that will undergo neuronal differentiation
(Lee et al., 2005
). In
Mash1KI Ngn2/+ embryos, Ngn2 is present earlier than in
wild type, and Mash1 levels are decreased, but an increase in dI3 and dI5 is
still detected. This increase in dI3 and dI5 could reflect Ngn2 inducing
premature differentiation. By contrast, in the Ngn2 null, the
increase in dI3 and dI5 populations could result from extra divisions of the
dI3/dI5 precursor cells owing to a subtle shift in timing of cell-cycle exit.
What is clear is that there is a fundamental difference in how Ngn2 functions
relative to the other bHLH factors, such as Mash1, Math1 and Ngn1. These
latter factors function in specifying neuronal identity in the dorsal spinal
cord. By contrast, Ngn2 is not required for any specific cell type but is
required to get a normal composition of neurons formed. Further support for
this difference in how Ngn2 functions relative to Mash1 is seen in the ventral
neural tube where Ngn2 but not Mash1 can synergize with the HD factors Lhx3
and Isl1 in post-mitotic cells to generate motoneurons
(Lee and Pfaff, 2003
).
Mash1 is required for lateral movement of differentiating cells from the ventricular zone
The generation of transgenic mice expressing GFP and Cre
from a Mash1 locus containing BAC allows a unique look at the
behavior of the cells in the absence of Mash1 function. The GFP
reporter in M1-GIC;Mash1/ mice indicates
that in the absence of Mash1, the cells do not switch fate and contribute to
the increased dI4 population, but rather these cells primarily remain in the
ventricular zone (see Fig. S1 in the supplementary material, compare E with F;
see Fig. S2 in the supplementary material, compare A with B). Although stalled
in the ventricular zone, the cells continue some aspects of the neuronal
differentiation process as illustrated by ectopic Lbx1 and Tuj1 within the
ventricular zone of Mash1 nulls (Fig. S2). Furthermore, these
aberrant Lbx1+ cells rarely incorporate BrdU suggesting many have left the
cell-cycle (Fig. S2). Thus, in the absence of Mash1, the cells apparently
undergo multiple aspects of differentiation but they do not have the
characteristic lateral movement to the marginal zone.
Conclusions
The data reported here, combined with previous studies
(Bermingham et al., 2001
;
Gowan et al., 2001
;
Helms and Johnson, 1998
;
Müller et al., 2005
),
demonstrate that bHLH factors are required for generating the correct number
and types of neurons in the dorsal neural tube. The precise mechanisms for how
these factors interact to result in this neuronal diversity is still not clear
and will require identification of downstream targets to define where these
pathways intersect. Furthermore, identification of additional bHLH family
members and co-factors such as HD proteins, and a more detailed understanding
of non-cell autonomous mechanisms involving Notch/delta signaling, will be
required to fully understand the formation of the neuronal network in the
dorsal spinal cord.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/132/12/2709/DC1
| REFERENCES |
|---|
|
|
|---|
Bermingham, N. A., Hassan, B. A., Wang, V. Y., Fernandez, M.,
Banfi, S., Bellen, H. J., Fritzsch, B. and Zoghbi, H. Y.
(2001). Proprioceptor pathway development is dependent on MATH1.
Neuron 30,411
-422.[CrossRef][Medline]
Bertrand, N., Castro, D. S. and Guillemot, F.
(2002). Proneural genes and the specification of neural cell
types. Nat. Rev. Neurosci.
3, 517-530.[CrossRef][Medline]
Birren, S. J., Lo, L. and Anderson, D. J.
(1993). Sympathetic neuroblasts undergo a developmental switch in
trophic dependence. Development
119,597
-610.
Briscoe, J., Alessandra, P., Jessell, T. M. and Ericson, J.
(2000). A homeodomain protein code specifies progenitor cell
identity and neuronal fate in the ventral neural tube.
Cell 101,435
-445.[CrossRef][Medline]
Casarosa, S., Fode, C. and Guillemot, F.
(1999). Mash1 regulates neurogenesis in the ventral
telencephalon. Development
126,525
-534.[Abstract]
Caspary, T. and Anderson, K. V. (2003).
Patterning cell types in the dorsal spinal cord: what the mouse mutants say.
Nat. Rev. Neurosci 4,289
-297.[CrossRef][Medline]
Cau, E., Casarosa, S. and Guillemot, F. (2002).
Mash1 and Ngn1 control distinct steps of determination and
differentiation in the olfactory sensory neuron lineage.
Development 129,1871
-1880.
Cheng, L., Arata, A., Mizuguchi, R., Qian, Y., Karunaratne, A.,
Gray, P. A., Arata, S., Shirasawa, S., Bouchard, M., Luo, P. et al.,
(2004). Tlx3 and Tlx1 are post-mitotic selector genes determining
glutamatergic over GABAergic cell fates. Nat.
Neurosci. 7,510
-517.[CrossRef][Medline]
Ericson, J., Rashbass, P., Schedl, A., Brenner-Morton, S.,
Kawakami, A., van Heyningen, V., Jessell, T. M. and Briscoe, J.
(1997). Pax6 controls progenitor cell identity and neuronal fate
in response to graded Shh signaling. Cell
90,169
-180.[CrossRef][Medline]
Farah, M. H., Olson, J. M., Sucic, H. B., Hume, R. I., Tapscott,
S. J. and Turner, D. L. (2000). Generation of neurons by
transient expression of neural bHLH proteins in mammalian cells.
Development 127,693
-702.[Abstract]
Fedtsova, N. and Turner, E. E. (1997).
Inhibitory effects of ventral signals on the development of Brn-3.0-expressing
neurons in the dorsal spinal cord. Dev. Biol.
190, 18-31.[CrossRef][Medline]
Fode, C., Gradwohl, G., Morin, X., Dierich, A., LeMeur, M.,
Goridis, C. and Guillemot, F. (1998). The bHLH protein
NEUROGENIN2 is a detemination factor for epibranchial placode-derived sensory
neurons. Neuron 120,483
-494.
Fode, C., Ma, Q., Casarosa, S., Ang, S.-L., Anderson, D. J. and
Guillemot, F. (2000). A role for neural determination genes
in specifying the dorsoventral identity of telencephalic neurons.
Genes Dev. 14,67
-80.
Funahashi, J., Okafuji, T., Ohuchi, H., Noji, S., Tanaka, H. and
Nakamura, H. (1999). Role of Pax-5 in the regulation of a
mid-hindbrain organizer's activity. Dev. Growth
Differ. 41,59
-72.[CrossRef][Medline]
Gowan, K., Helms, A. W., Hunsaker, T. L., Collisson, T., Ebert,
P. J., Odom, R. and Johnson, J. E. (2001). Crossinhibitory
activities of Ngn1 and Math1 allow specification of distinct dorsal
interneurons. Neuron 31,219
-232.[CrossRef][Medline]
Gradwohl, G., Fode, C. and Guillemot, F.
(1996). Restricted expression of a novel murine atonal-related
bHLH protein in undifferentiated neural precursors. Dev.
Biol. 180,227
-241.[CrossRef][Medline]
Gross, M. K., Dottori, M. and Goulding, M.
(2002). Lbx1 specifies somatosensory association interneurons in
the dorsal spinal cord. Neuron
34,535
-549.[CrossRef][Medline]
Guillemot, F. and Joyner, A. (1993). Expression
of murine Achaete-Scute and Notch homologues in the developing central nervous
system. Mech. Dev. 42,171
-185.[CrossRef][Medline]
Guillemot, F., Lo, L. C., Johnson, J. E., Auerbach, A.,
Anderson, D. J. and Joyner, A. L. (1993). Mammalian
achaete-scute homolog 1 is required for the early development of olfactory and
autonomic neurons. Cell
75,463
-476.[CrossRef][Medline]
Helms, A. W. and Johnson, J. E. (1998).
Progenitors of dorsal commissural interneurons are defined by MATH1
expression. Development
125,919
-925.[Abstract]
Helms, A. W. and Johnson, J. E. (2003).
Specification of dorsal spinal cord interneurons. Curr. Opin.
Neurobiol. 13,42
-49.[CrossRef][Medline]
Hogan, B., Costantini, F. and Lacy, E. (1986).
Manipulating the Mouse Embryo: A Laboratory Manual.
Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Horton, S., Meredith, A., Richardson, J. A. and Johnson, J.
E. (1999). Correct coordination of neuronal differentiation
events in ventral forebrain requires the bHLH factor MASH1. Mol.
Cell. Neurosci. 14,355
-369.[CrossRef][Medline]
Jessell, T. M. (2000). Neuronal specification
in the spinal cord: inductive signals and transcriptional codes.
Nat. Rev. Genetics 1,20
-29.[CrossRef][Medline]
Krapp, A., Knofler, M., Frutiger, S., Hughes, G. J.,
Hagen-buchle, O. and Wellauer, P. K. (1996). The p48
DNA-binding subunit of transcription factor PTF1 is a new exocrine
pancreas-specific basic helix-loop-helix protein. EMBO
J. 15,4317
-4329.[Medline]
Kriks, S., Lanuza, G. M., Mizuguchi, R., Nakafuku, M. and
Goulding, M. (2005). Gsh2 is required for the repression of
Ngn1 and specification of dorsal interneuron fate in the spinal cord.
Development (in press).
Lanuza, G. M., Gosgnach, S., Pierani, A., Jessell, T. M. and
Goulding, M. (2004). Genetic identification of spinal
interneurons that coordinate left-right locomotor activity necessary for
walking movements. Neuron
42,375
-386.[CrossRef][Medline]
Lee, K. J., Mendelsohn, M. and Jessell, T. M.
(1998). Neuronal patterning by BMPs: a requirement for GDF7 in
the generation of a discrete class of commissural interneurons in the mouse
spinal cord. Genes Dev.
12,3394
-3407.
Lee, K. J., Dietrich, P. and Jessell, T. M.
(2000). Genetic ablation reveals that the roof plate is essential
for dorsal interneuron specification. Nature
403,734
-740.[CrossRef][Medline]
Lee, S.-K. and Pfaff, S. L. (2003).
Synchronization of neurogenesis and motor neuron specification by direct
coupling of bHLH and homeodomain transription factors.
Neuron 38,731
-745.[CrossRef][Medline]
Lee, S.-K., Lee, B., Ruiz, E. C. and Pfaff, S. L.
(2005). Olig2 and Ngn2 function in opposition to modulate gene
expression in motor neuron progenitor cells. Genes
Dev. 19,282
-294.
Lindsell, C. E., Boulter, J., diSibio, G., Gossler, A. and
Weinmaster, G. (1996). Expression patterns of Jagged,
Delta1, Notch1, Notch2, and Notch3 genes identify
ligand-receptor pairs that may function in neural development. Mol.
Cell. Neurosci. 8,14
-27.[CrossRef][Medline]
Lo, L.-C., Johnson, J. E., Wuenschell, C. W., Saito, T. and
Anderson, D. J. (1991). Mammalian achaete-scute
homolog 1 is transiently expressed by spatially-restricted subsets of early
neuroepithelial and neural crest cells. Genes Dev.
5,1524
-1537.
Lo, L. C., Dormand, E., Greenwood, A. and Anderson, D. J.
(2002). Comparison of the generic neuronal differentiation and
neuron subtype specification functions of mammalian achaete-scute and atonal
homologs in cultured neural progenitor cells.
Development 129,1553
-1567.
Ma, Q., Sommer, L., Cserjesi, P. and Anderson, D. J.
(1997). Mash1 and neurogenin1 expression patterns define
complementary domains of neuroepithelium in the developing CNS and are
correlated with regions expressing notch ligands. J.
Neurosci. 17,3644
-3652.
Ma, Q., Chen, Z., del Barco Barrantes, I., de la Pompa, J. L.
and Anderson, D. J. (1998). neurogenin1 is essential
for the determination of neuronal precursors for proximal cranial sensory
ganglia. Neuron 120,469
-482.
Matsunaga, E., Araki, I. and Nakamura, H.
(2001). Role of Pax3/7 in the tectum regionalization.
Development 128,4069
-4077.
Meredith, A. and Johnson, J. E. (2000).
Negative regulation of Mash1 expression in CNS development.
Dev. Biol. 222,336
-346.[CrossRef][Medline]
Müller, T., Brohmann, H., Pierani, A., Heppenstall, P. A.,
Lewin, G. R., Jessell, T. M. and Birchmeier, C. (2002). The
homeodomain factor Lbx1 distinguishes two major programs of neuronal
differentiation in the dorsal spinal cord. Neuron
34,551
-562.[CrossRef][Medline]
Müller, T., Anlag, K., Wildner, H., Britsch, S., Treier, M.
and Birchmeier, C. (2005). The bHLH factor Olig3 coordinates
the specification of dorsal neurons in the spinal cord. Genes
Dev. 19,733
-743.
Muramatsu, T., Mizutani, Y., Ohmori, Y. and Okumura, J.
(1997). Comparison of three nonviral transfection methods for
foreign gene expression in early chicken embryos in ovo. Biochem.
Biophys. Res. Commun. 230,376
-380.[CrossRef][Medline]
Nakada, Y., Hunsaker, T. L., Henke, R. M. and Johnson, J. E.
(2004). Distinct domains within Mash1 and Math1 are required for
function in neuronal differentiation versus cell-type specification.
Development 131,1319
-1330.
Parras, C. M., Schuurmans, C., Scardigli, R., Kim, J., Anderson,
D. J. and Guillemot, F. (2002). Divergent functions of the
proneural genes Mash1 and Ngn2 in the specification of
neuronal subtype identity. Genes Dev.
16,324
-338.
Perez, S. E., Rebelo, S. and Anderson, D. J.
(1999). Early specification of sensory neuron fate revealed by
expression and function of neurogenins in the chick embryo.
Development 126,1715
-1728.[Abstract]
Pierani, A., Moran-Rivard, L., Sunshine, M. J., Littman, D. R.,
Goulding, M. and Jessell, T. M. (2001). Control of
interneuron fate in the developing spinal cord by the progenitor homeodomain
protein Dbx1. Neuron 29,367
-384.[CrossRef][Medline]
Qian, Y., Shirasawa, S., Chen, C., Cheng, L. and Ma, Q.
(2002). Proper development of relay somatic sensory neurons and
D2/D4 interneurons requires homeobox genes Rnx/Tlx3 and Tlx1.Genes Dev. 16,1220
-1233.
Scardigli, R., Schuurmans, C., Gradwohl, G. and Guillemot,
F. (2001). Crossregulation between neurogenin2 and
pathways specifying neuronal identity in the spinal cord.
Neuron 31,203
-217.[CrossRef][Medline]
Sommer, L., Ma, Q. and Anderson, D. J. (1996).
Neurogenins, a novel family of atonal-related bHLH transcription factors, are
putative mammalian neuronal determination genes that reveal progenitor cell
heterogenity in the developing CNS and PNS. Mol. Cell.
Neurosci. 8,221
-241.[CrossRef][Medline]
Srinivas, S., Watanabe, T., Lin, C. S., William, C. M., Tanabe,
Y., Jessell, T. M. and Costantini, F. (2001). Cre reporter
strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus.
BMC Dev. Biol. 1,4
.[CrossRef][Medline]
Suemori, H., Kadodawa, Y., Goto, K., Araki, I., Kondoh, H. and
Nakatsuji, N. (1990). A mouse embryonic stem cell line
showing pluripotency of differentiation in early embryos and ubiquitous
beta-galactosidase expression. Cell Differ. Dev.
29,181
-186.[CrossRef][Medline]
Tsuchida, T., Ensini, M., Morton, S. B., Baldassare, M., Edlund,
T., Jessell, T. M. and Pfaff, S. L. (1994). Topographic
organization of embryonic motor neurons defined by expression of LIM homeobox
genes. Cell 79,957
-970.[CrossRef][Medline]
Yang, X. W., Model, P. and Heintz, N. (1997).
Homologous recombination based modification in Escherichia coli and germline
transmission in transgenic mice of a bacterial artificial chromosome.
Nat. Biotechnol. 15,859
-865.[CrossRef][Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
R. M. Henke, T. K. Savage, D. M. Meredith, S. M. Glasgow, K. Hori, J. Dumas, R. J. MacDonald, and J. E. Johnson Neurog2 is a direct downstream target of the Ptf1a-Rbpj transcription complex in dorsal spinal cord Development, September 1, 2009; 136(17): 2945 - 2954. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Iulianella, M. Sharma, G. B. Vanden Heuvel, and P. A. Trainor Cux2 functions downstream of Notch signaling to regulate dorsal interneuron formation in the spinal cord Development, July 15, 2009; 136(14): 2329 - 2334. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Prasad, X. Wang, P. A. Gray, and J. A. Weiner A differential developmental pattern of spinal interneuron apoptosis during synaptogenesis: insights from genetic analyses of the protocadherin-{gamma} gene cluster Development, December 15, 2008; 135(24): 4153 - 4164. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sugimori, M. Nagao, C. M. Parras, H. Nakatani, M. Lebel, F. Guillemot, and M. Nakafuku Ascl1 is required for oligodendrocyte development in the spinal cord Development, April 1, 2008; 135(7): 1271 - 1281. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Iulianella, M. Sharma, M. Durnin, G. B. Vanden Heuvel, and P. A. Trainor Cux2 (Cutl2) integrates neural progenitor development with cell-cycle progression during spinal cord neurogenesis Development, February 15, 2008; 135(4): 729 - 741. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hori, J. Cholewa-Waclaw, Y. Nakada, S. M. Glasgow, T. Masui, R. M. Henke, H. Wildner, B. Martarelli, T. M. Beres, J. A. Epstein, et al. A nonclassical bHLH Rbpj transcription factor complex is required for specification of GABAergic neurons independent of Notch signaling Genes & Dev., January 15, 2008; 22(2): 166 - 178. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Briscoe and B. G Novitch Regulatory pathways linking progenitor patterning, cell fates and neurogenesis in the ventral neural tube Phil Trans R Soc B, January 12, 2008; 363(1489): 57 - 70. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Kim, C. T. Leung, R. R. Reed, and J. E. Johnson In Vivo Analysis of Ascl1 Defined Progenitors Reveals Distinct Developmental Dynamics during Adult Neurogenesis and Gliogenesis J. Neurosci., November 21, 2007; 27(47): 12764 - 12774. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nakatani, Y. Minaki, M. Kumai, and Y. Ono Helt determines GABAergic over glutamatergic neuronal fate by repressing Ngn genes in the developing mesencephalon Development, August 1, 2007; 134(15): 2783 - 2793. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Parras, C. Hunt, M. Sugimori, M. Nakafuku, D. Rowitch, and F. Guillemot The Proneural Gene Mash1 Specifies an Early Population of Telencephalic Oligodendrocytes J. Neurosci., April 18, 2007; 27(16): 4233 - 4242. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sugimori, M. Nagao, N. Bertrand, C. M. Parras, F. Guillemot, and M. Nakafuku Combinatorial actions of patterning and HLH transcription factors in the spatiotemporal control of neurogenesis and gliogenesis in the developing spinal cord Development, April 15, 2007; 134(8): 1617 - 1629. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Battiste, A. W. Helms, E. J. Kim, T. K. Savage, D. C. Lagace, C. D. Mandyam, A. J. Eisch, G. Miyoshi, and J. E. Johnson Ascl1 defines sequentially generated lineage-restricted neuronal and oligodendrocyte precursor cells in the spinal cord Development, January 15, 2007; 134(2): 285 - 293. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Ma Transcriptional regulation of neuronal phenotype in mammals J. Physiol., September 1, 2006; 575(2): 379 - 387. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-H. Park, J. S. Kang, J.-S. Kim, S. Chung, J.-Y. Koh, E.-H. Yoon, A. Y. Jo, M.-Y. Chang, H.-C. Koh, S. Hwang, et al. Differential actions of the proneural genes encoding Mash1 and neurogenins in Nurr1-induced dopamine neuron differentiation J. Cell Sci., June 1, 2006; 119(11): 2310 - 2320. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wildner, T. Muller, S.-H. Cho, D. Brohl, C. L. Cepko, F. Guillemot, and C. Birchmeier dILA neurons in the dorsal spinal cord are the product of terminal and non-terminal asymmetric progenitor cell divisions, and require Mash1 for their development Development, June 1, 2006; 133(11): 2105 - 2113. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kele, N. Simplicio, A. L. M. Ferri, H. Mira, F. Guillemot, E. Arenas, and S.-L. Ang Neurogenin 2 is required for the development of ventral midbrain dopaminergic neurons Development, February 1, 2006; 133(3): 495 - 505. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E Lewis How do genes regulate simple behaviours? Understanding how different neurons in the vertebrate spinal cord are genetically specified Phil Trans R Soc B, January 29, 2006; 361(1465): 45 - 66. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Glasgow, R. M. Henke, R. J. MacDonald, C. V. E. Wright, and J. E. Johnson Ptf1a determines GABAergic over glutamatergic neuronal cell fate in the spinal cord dorsal horn Development, December 15, 2005; 132(24): 5461 - 5469. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||