|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 18 May 2005
doi: 10.1242/dev.01865
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Graduate training program in Mechanisms of Disease and Therapy, Mount Sinai
School of Medicine, New York, NY 10029, USA
2 Department of Pharmacology and Biological Chemistry, Mount Sinai School of
Medicine, New York, NY 10029, USA
* Author for correspondence (e-mail: daniel.weinstein{at}mssm.edu)
Accepted 15 April 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Xenopus, Xema, Mesendoderm, Mesoderm, Fox
| Introduction |
|---|
|
|
|---|
Two classes of secreted molecules have been found to possess
mesoderm-inducing activity. Addition of Fibroblast Growth Factor (Fgf) or
members of the Activin/Nodal-related class of the Transforming Growth Factor
ß (Tgfß) ligand family will induce mesoderm in explants of competent
ectoderm, whereas inhibition of the signaling cascades downstream of these
factors blocks mesoderm formation in vivo
(Harland and Gerhart, 1997
;
Slack, 1994
). Although
considerably less attention has been focused on the signals governing endoderm
formation, recent studies have demonstrated that this germ layer is also
dependent on Tgfß signaling, as well as on a cascade of transcription
factors that act cell autonomously to ensure commitment to an endodermal fate
(Shivdasani, 2002
). The
recognition that similar mechanisms underlie the formation of both mesoderm
and endoderm are reflected in the notion of a `mesendodermal' field in the
early embryo, containing both mesodermal and endodermal precursors, from which
the distinct germ layers emerge only during gastrulation. A second, distinct
domain thought to contain only mesodermal precursors has also been described
(Rodaway and Patient, 2001
).
In this report, we will use the term `mesendoderm' somewhat more loosely, to
describe all early mesodermal and/or endodermal cells. Although the mechanisms
regulating early patterning of the vertebrate ectoderm have been the subject
of considerable debate, it has, until recently, been generally assumed that
the development of the presumptive ectoderm is governed in large part by the
absence of mesoderm- or endoderm-promoting cues.
Although growth factor-mediated induction clearly drives mesoderm formation
in the vertebrate embryo, recent studies in the mouse and frog suggest that
germ layer suppression is also crucial in establishing the early vertebrate
body plan. For example, the Tgfß ligand Nodal plays an essential role
during mesoderm and endoderm formation in the mouse, as nodal mutant mice lack
a primitive streak, a posterior structure from which embryonic and
extra-embryonic mesoderm, and embryonic endoderm are derived
(Conlon et al., 1994
;
Whitman, 2001
;
Zhou et al., 1993
).
Surprisingly, prior to gastrulation, Nodal is transiently expressed throughout
the early epiblast (Whitman,
2001
). Recent studies suggest that the anterior visceral endoderm
(AVE), an extraembryonic tissue overlying the anterior epiblast, is a crucial
source of Nodal antagonism (Beddington and
Robertson, 1999
; Perea-Gomez
et al., 2002
); the AVE expresses at least two secreted Nodal
antagonists, Cerberus-like (Cer1) and a Tgfß superfamily molecule, Lefty1
(Perea-Gomez et al., 2001
). A
subset of compound Cer1-/-;Lefty1-/- mutant
embryos develop ectopic primitive streaks
(Perea-Gomez et al., 2002
);
this phenotype is partially rescued in mice containing a single copy of
Nodal, suggesting that Cer1 and Lefty1, secreted by the AVE, function
to restrict ectopic streak formation by inhibiting Nodal activity anteriorly.
Recent evidence points to Nodal antagonism at several additional levels during
early development: both the transcriptional co-repressor DRAP1, and Dpr2,
which promote the lysosomal degradation of Nodal receptors, have been shown to
limit Nodal activity in the vertebrate embryo
(Iratni et al., 2002
;
Zhang et al., 2004
).
Several recent studies have suggested that inhibition of ectopic germ layer
formation is also crucial during early development of the frog Xenopus
laevis. For example, an analysis of the Xenopus brachyury
promoter found that the restricted expression of this gene in the cells of the
mesoderm is in part the result of specific repression in both endoderm and
ectoderm; along with one or more as yet undefined homeodomain proteins, the
EF1 repressor family Smad-interacting protein-1 (Sip1) appears to be
required for this repression (Lerchner et
al., 2000
). Recently, Wardle and Smith reported the presence of a
significant number of cells found throughout the early gastrula-stage
Xenopus embryo that express mesendodermal markers inappropriate to
their location and, on occasion, do not correspond to any single regional fate
(Wardle and Smith, 2004
);
these `rogue' cells are largely undetectable by late gastrula stages,
suggesting that they are either converted to the fate of their neighbors, or
eliminated via as yet uncharacterized mechanisms. Finally, the Forkhead box
(Fox) DNA-binding protein Hepatocyte Nuclear Factor 3ß
(Hnf3ß)/Foxa2, expressed throughout the Xenopus deep endoderm at
early gastrula stages, also inhibits inappropriate germ layer development in
the frog: misexpression of Hnf3ß in the marginal zone leads to a loss of
mesoderm and dorsal mesendoderm, whereas suppression of Hnf3ß target
genes leads to ectopic axis formation in the endoderm
(Suri et al., 2004
).
Consistently, gene targeting studies have implicated a requirement for murine
Hnf3ß in mesoderm suppression: targeted deletion of both Hnf3ß and
the LIM homeodomain protein Lim1 in the visceral endoderm leads to the
production of ectopic ventral mesoderm in the epiblast, a phenotype not
observed following the deletion of either gene alone
(Ang and Rossant, 1994
;
Dufort et al., 1998
;
Perea-Gomez et al., 1999
;
Weinstein et al., 1994
). Thus,
the expression of Hnf3ß in the Xenopus deep endoderm and the
mammalian extra-embryonic endoderm appears to be involved in the suppression
of ectopic mesendoderm in, respectively, both lower and higher vertebrates.
The molecular basis for this requirement, however, remains largely
unknown.
We report here that a Fox-mediated, mesendoderm-suppressing mechanism is also active within the Xenopus ectoderm, and is required for normal development. We describe the characterization of Xema, a Fox protein expressed exclusively in the ectoderm during early Xenopus development. Misexpression of Xema blocks mesendoderm induction in vivo and by inducing agents, while Xema knockdown promotes mesendoderm development in gastrula stage animal cap explants, demonstrating a requirement for Xema in the inhibition of ectopic germ layer formation in the animal pole. Taken together with studies on Hnf3ß from our laboratory and others, this body of research supports a model in which Fox proteins are fundamental mediators of the widespread suppression of ectopic germ layer development during early vertebrate embryogenesis.
| Materials and methods |
|---|
|
|
|---|
RT-PCR
RT-PCR was performed as described
(Wilson and Hemmati-Brivanlou,
1995
). Primers designed specifically for this study were as
follows: Xema-U, 5'-AGTAGGTCAGTTCCACTTGG; Xema-D,
5'-AAGGACTTTGTCGTGACTGC. All other primer sequences were as described
previously (Suri et al.,
2004
).
Subtractive hybridization screen
PCR-based differential screens were performed to identify genes with
expression enriched in or limited to the gastrula-stage ectoderm, relative to
levels found in other regions of the embryo or after treatment with various
mesoderm-inducing reagents. In the screen from which Xema was isolated, cDNA
was generated from 1 µg of mRNA isolated from uninjected animal caps and
animal caps injected with EnR-Hnf3ß RNA; expression of this
construct generates ectopic mesoderm in both endoderm and ectoderm
(Suri et al., 2004
) (data not
shown). cDNA pools were hybridized and differentially expressed genes were
selected using a PCR-based subtraction method (Clontech PCR-Select cDNA
Subtraction kit), both in the laboratory and using the `Custom PCR-Select
Subtraction Analysis' service (Clontech). Clones whose expression was found to
be downregulated in induced explants were selected, amplified and sequenced.
Primers were generated and RT-PCR was performed to confirm differential
expression using cDNA derived from independent experimental samples.
Whole-mount in situ hybridization, immunohistochemistry and ß-gal staining
Protocols for whole-mount in situ hybridization were derived from Harland
(Harland, 1991
) with the
following changes: (1) RNase steps were eliminated; and (2) BM purple AP
substrate (Boehringer Mannheim) replaced BCIP/NBT. The antisense Xema
and Xbra probes were synthesized in the presence of
digoxigenin-11-UTP (Boehringer Mannheim). Whole-mount ß-gal detection was
performed as described (Smith and Harland,
1992
). Whole-mount antibody staining was performed as described
(Hemmati-Brivanlou and Melton,
1994
). The 12/101 antibody (ascites, Developmental Studies
Hybridoma Bank) was used at a 1:1 dilution. Secondary antibody was a donkey
anti-mouse IgG coupled to horseradish peroxidase (Jackson Laboratories), and
was used at a 1:1000 dilution. Color reactions were performed using the Vector
SG and DAB kits (Vector Laboratories).
Preparation of Xema fusion proteins
Xema fusion constructs were generated by PCR. For EnR-Xema, residues 1-298
of the Drosophila Engrailed repressor
(Kessler, 1997
) were fused
upstream of full-length Xema. For VP-Xema, residues 410-490 of the VP16
activator (Kessler, 1997
) were
fused upstream of full-length Xema.
Morpholinos
Morpholino oligonucleotides (Gene Tools) were heated for five minutes at
65°C then quenched on ice, prior to injection at the two- or four-cell
stage. Sequences were as follows: Xema MO-1, GTGCTTGTGGATCAAATGCACTCAT; Xema
MO-2, AGGTCACAAATACACCTGTACTAGC; control morpholino (mismatch-1/MM-1),
GTcCTTGTaATgAAATcCACTgAT
| Results |
|---|
|
|
|---|
In order to determine the temporal range of Xema expression during
early development, we performed reverse-transcription polymerase chain
reactions (RT-PCR) on RNA harvested from embryos at various embryonic stages.
Xema is not expressed maternally, as transcripts are present only
after the initiation of zygotic transcription at stage 8.5
(Fig. 2A). Expression is
highest at early gastrula stages (stage 10) and is maintained throughout
neurula, tailbud and early tadpole stages. To analyze the spatial distribution
of Xema transcripts, we performed whole-mount in situ hybridization
studies. Xema transcripts were observed in the cells of the animal
pole at late blastula and gastrula stages
(Fig. 2B and data not shown).
Xema transcripts were not detected in the marginal zone during early
(stage 10+) or mid (stage 11) gastrula stages; Xbra expression,
restricted to the gastrula marginal zone, is shown for comparison
(Fig. 2B) (Smith et al., 1991
).
Xema expression is restricted to the ventral ectoderm during early
neurula stages; this epidermal expression persists through tailbud stages
(Fig. 2B and data not shown).
In order to confirm the regional distribution of Xema transcripts, we
performed RT-PCR analysis on early gastrula stage explants. These assays
support the in situ analysis: Xema is expressed in the animal pole
(AP) ectoderm, and is excluded from the ventral and dorsal marginal zone (VMZ
and DMZ), as well as the vegetal pole (VP)
(Fig. 2C). Thus, Xema
is expressed zygotically in the ectoderm during early Xenopus
development, and is excluded from regions of the embryo that contribute to
mesodermal and endodermal lineages.
Ectopic Xema suppresses mesendoderm formation
We have previously demonstrated that the Fox gene Hnf3ß is expressed
throughout the deep endoderm during Xenopus gastrulation, and is
involved in suppressing ectopic mesoderm and dorsal mesendoderm in this region
(Suri et al., 2004
). The
gastrula-stage expression of Xema suggested that this Fox gene might
be involved in the suppression of ectopic germ layer formation in the
presumptive ectoderm. Dorsal marginal zone expression of Xema RNA
gives rise to embryos, the majority of which lack heads and show little
discernable polarity (69%; n=35); ventral injection of Xema
RNA results in variable and more modest defects in trunk and tail development
(31% with clear abnormalities; n=29)
(Fig. 3A). Whole-mount
immunohistochemistry with the somite-specific antibody 12/101 demonstrated
that formation of the somites, a paraxial mesoderm derivative, is dramatically
inhibited by dorsal injection of Xema RNA
(Fig. 3B)
(Kintner and Brockes, 1984
).
Consistently, Xema misexpression in dorsal marginal zone (DMZ) explants leads
to a reduction of Xbra expression, as well as a dramatic decrease in
the expression of dorsal endomesodermal markers, including chordin
and goosecoid (Fig.
3C, compare lanes 1 and 2) (Cho
et al., 1991
; Sasai et al.,
1994
). We found that Xema expression in dorsal cells often leads
to a reduction in or absence of dorsal lip invagination (see
Fig. 3D, and data not shown).
Introduction of Xema RNA into ventral cells leads to a strong
reduction in the expression of both Xbra and the ventrolateral marker
Xwnt8 (Fig. 3C;
compare lanes 3 and 4) (Smith and Harland,
1991
); VMZ inhibition of Xbra is often more dramatic than
that observed in the DMZ (Fig.
3C and data not shown). Marginal zone expression of epidermal
keratin is upregulated in dorsal but not ventral explants, suggesting
that Xema misexpression may promote ectodermal fates in some contexts, in
addition to inhibiting mesendodermal ones
(Fig. 3C). Consistent with our
explant data, Xbra expression is also blocked by Xema RNA
injection in both the dorsal and ventral marginal zones in intact embryos, as
demonstrated by whole-mount in situ hybridization analysis
(Fig. 3D).
|
|
|
Repression of Xema target genes induces mesoderm formation
We next sought to determine whether repression of Xema target genes
promotes mesendoderm. For these studies, we constructed a Drosophila
Engrailed repressor-Xema fusion protein, EnR-Xema
(Kessler, 1997
). Gastrula
stage animal pole explants excised from embryos injected with
EnR-Xema express both Xbra and Xwnt8; expression of
the dorsal endomesodermal marker chordin is not stimulated by
EnR-Xema (Fig. 4B). As
expected, EnR-Xema does not inhibit mesoderm induction by Activin and, in
fact, modestly synergizes with low levels of Activin (data not shown). These
data suggest that the transcriptional repression of one or more genes by
EnR-Xema is sufficient to stimulate mesodermal differentiation in the
presumptive ectoderm.
|
Xema knockdown induces mesoderm
We have shown that Xema misexpression in the marginal zone blocks
mesendoderm formation, and that repression of Xema target genes results in
ectopic mesoderm. These data, coupled with the localization of Xema
transcripts in the early Xenopus ectoderm, suggest that this factor
is normally involved in inhibiting ectopic germ layer development in the
animal pole. Results with the EnR-Xema construct, however, may differ from
loss-of-function studies in several crucial ways. First, because EnR-Xema is
likely to function as a dominant-negative reagent, other related proteins may
act redundantly with Xema during mesendodermal suppression in vivo. Second,
and perhaps more crucially, EnR-Xema may repress the transcription of genes in
the ectoderm to which Xema can bind but does not normally activate. To
determine whether mesendodermal suppression by Xema is required for normal
development, we attempted to inhibit Xema function using antisense morpholino
oligonucleotides. We designed and purchased (from GeneTools) two morpholinos
against Xema, MO-1 and MO-2, both of which effectively block the translation
of Xema RNA in vitro (Fig.
5A; compare lane 1 with lanes 3 and 4). Co-expression of MO-1 and
MO-2 leads to a more effective inhibition of Xema translation than is observed
with either morpholino alone (Fig.
5A; compare lanes 3, 4 and 5). Expression of a control morpholino,
identical to MO-1 with the exception of five base-pair mismatches
(mismatch-1/MM-1), has no effect on Xema translation
(Fig. 5A; compare lanes 1 and
2). Consistent with the in vitro data, we find that injection of either MO-1
or MO-2 inhibits the expression of a 3'-Myc-tagged Xema protein
(Xema-Myc) in Xenopus embryos
(Fig. 5B; compare lane 1 with
lanes 3 and 4). Co-expression of MO-1 and MO-2 causes a greater block to
expression than does injection of either morpholino alone and, as expected,
Xema MM-1 does not inhibit the expression of Xema-Myc
(Fig. 5B). These data suggest
that Xema MO-1 and MO-2 act specifically to block translation of Xema
RNA in vitro and in the context of the early embryo.
We next attempted to use the Xema morpholino oligonucleotides in
`knockdown' loss-of-function studies. For these experiments, the same doses of
MO-1 and MO-2 were used as for the Xema-Myc assay shown in
Fig. 5B. Injection of either
Xema MO-1 (Fig. 5C) or MO-2
(see Fig. 5D, and data not
shown) stimulates expression of Xbra, Xwnt8, chordin and the
endodermal marker Sox17ß in animal cap explants, and reduces the
expression of the ventral ectodermal marker epidermal keratin
(Jonas et al., 1985
);
crucially, injection of the control morpholino MM-1 has no effect on
mesodermal or endodermal gene expression
(Fig. 5C). Most strikingly,
co-injection of MO-1 and MO-2 leads to a strong increase in the expression of
a number of endodermal and mesodermal markers, including Xbra, Xwnt8,
chordin, Xnr3, goosecoid, Sox17ß and Xhex, none of which
are expressed in control ectodermal explants
(Fig. 5D). It has been
difficult to observe the effects of Xema knockdown in intact embryos past the
late blastula stage: doses required to generate mesendodermal marker
expression in intact caps are lethal in gastrula stage embryos, with toxicity
readily apparent by stage 10+; we have thus not been able to score for axial
duplications or ectopic expression of marker genes by in situ hybridization.
Co-injection of 2-fold lower doses of the Xema morpholinos, however, does
result in the formation of secondary lateral structures, resembling those
observed following EnR-Xema RNA injection, in 52% of morphant embryos
(n=65); co-expressed lineage tracers are heavily concentrated in the
ectopic structures (Fig.
5E).
Finally, in an attempt to demonstrate the specificity of the Xema
morpholinos, we engineered a 5'-Myc tagged Xema-fusion protein
(Myc-Xema); this construct, which contains six tandem Myc epitopes upstream of
the Xema coding sequence, was designed to bypass morpholino-mediated
translational repression, which is most effective at or near the translational
start site (Summerton, 1999
).
We find that co-injection of Myc-Xema RNA inhibits Xema
knockdown-mediated mesendoderm formation, and rescues expression of
epidermal keratin (Fig.
5F). Taken together, these data demonstrate that inhibition of
Xema function stimulates mesendoderm formation in the animal pole, and
strongly suggest that Xema is required to prevent inappropriate mesendodermal
differentiation in the cells of the presumptive ectoderm.
|
| Discussion |
|---|
|
|
|---|
|
The source and nature of the `mesendodermalizing' signal or signals
suppressed by Xema are not known. One possibility is that decreased expression
of Xema targets in the ectoderm leads to increased sensitivity of these cells
to inducing signals from the vegetal pole. In Xenopus, the primary
mesendoderm-inducing signal secreted by the vegetal pole is thought to be a
Tgfß ligand of the Nodal/Activin class, the expression of which is
initiated at the start of zygotic transcription by the action of the
transcription factor VegT (Whitman,
2001
). Our data suggest that extracellular Tgfß signaling is
not the primary activity suppressed by Xema, although the occasional, albeit
modest, effects seen following Tgfß inhibition suggest some role for
`canonical' signals in the mesendodermalizing activity unveiled by Xema
knockdown. We also cannot exclude the possibility that the Xema morpholinos
promote mesendodermal development indirectly, by affecting cell movements to
`reroute' marginal zone and vegetal pole cells to the animal pole.
Alternatively, or additionally, Xema may function to suppress a
mesendodermalizing activity native to the animal pole. A role for such a
signal is suggested by the demonstration that Fgf signaling is required for
Xema knockdown-mediated ventral mesoderm development
(Fig. 6), as it has been
demonstrated that MAP kinase activity is present in the early gastrula
ectoderm (LaBonne and Whitman,
1997
); Xema may function in part to blunt the mesoderm-inducing
potential of this activity. We note also that our studies with the truncated
Activin receptor do not rule out the potential contribution of Tgfß
pathway stimulation to the mesendodermalizing signal downstream of the
receptor and thus autonomous to the animal pole. Finally, it will be important
to examine the relationship between Xema and the recently described `rogue
cells', found throughout the early gastrula embryo, that express one or more
location-inappropriate molecular markers
(Wardle and Smith, 2004
). A
subset of these cells is found in the animal pole at early gastrula stages and
express mesodermal and/or endodermal markers, but they are largely
undetectable by late gastrula stages
(Wardle and Smith, 2004
); Xema
may thus be involved in the conversion and/or elimination of these cells
during gastrulation.
Although our data suggest that transactivation of as yet uncharacterized Xema target genes leads to the suppression of ectopic mesendoderm, we do not yet have a clear sense of how Xema targets function to suppress inappropriate cell fate, nor, in a related issue, do we have a firm understanding of the eventual fate of the misexpressing cells. Our data suggest that, at least in the context of the dorsal marginal zone, Xema expression can promote the conversion of mesendoderm into ventral ectoderm; this effect is not seen in the ventral marginal zone or in Activin-treated animal caps. However, these assays all involve ectopic Xema and may not correlate precisely with endogenous Xema function in the presumptive ectoderm. Alternatively, Xema may induce or facilitate the elimination of ectopic mesendoderm during gastrulation. We have not observed any increase in TUNEL staining in embryos injected with Xema RNA, however, suggesting that mesendodermal suppression by Xema is not mediated via apoptosis (data not shown).
What relationships, if any, can be drawn between Xema and other proteins
involved in the suppression of mesendodermal fate? The secreted Nodal
antagonists, described earlier, are likely to play only a limited role in
Xema-mediated germ layer inhibition. Sprouty proteins are Fgf antagonists
involved in the regulation of a number of developmental processes
(Kim and Bar-Sagi, 2004
).
Xenopus Sprouty2 antagonizes Fgf-mediated convergent extension
movements, but appears to act independently of the Ras/MAPK branch of the
cascade, required for mesoderm formation
(Nutt et al., 2001
). The C-Src
Kinase (Csk) functions as an inhibitor of the Src family of non-receptor
tyrosine kinases (Brown and Cooper,
1996
); these latter proteins are involved in Fgf-mediated mesoderm
induction in Xenopus (Weinstein
et al., 1998
). Strikingly, expression of a dominant-inhibitory
form of Xenopus Csk (Xcsk) in the animal pole synergizes with
sub-inducing doses of the Src kinase Laloo to form ventrolateral mesoderm and
secondary tails, suggesting that Xcsk is involved in suppressing mesoderm
formation in the presumptive ectoderm
(Song et al., 2001
). Xcsk is
widely expressed during early development
(Song et al., 2001
); thus, any
regulation of Xcsk by Xema would probably be mediated post-transcriptionally.
As Xema appears to function as a transcriptional activator, however, Xcsk is
unlikely to be a direct Xema target. Xenopus Sip1 (Xsip1), is a
direct repressor of Xbra, and thus represents a potential target and
partial mediator of Xema (Lerchner et al.,
2000
; Papin et al.,
2002
). Xsip1 transcripts are detected in the dorsal
ectoderm of early gastrulae, suggesting that, at least at this stage, Xsip1
expression could be mediated by Xema
(Eisaki et al., 2000
;
van Grunsven et al., 2000
),
either directly or through stimulation of the recently identified Churchill
(Sheng et al., 2003
). However,
neither Xsip1 nor Churchill expression are stimulated by ectopic Xema
RNA in the gastrula stage ectoderm, suggesting that mesoderm suppression by
Xema is independent of Xsip1 (data not shown). Regardless, it is clear that
Xema does not function solely as an Fgf pathway antagonist. While a role for
Xema in the antagonism of intracellular Tgfß signaling remains to be
explored, a detailed appreciation of the mechanisms underlying germ layer
suppression by Xema and other Fox proteins is likely to require the
identification and characterization of direct transcriptional targets.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Amaya, E., Musci, T. J. and Kirschner, M. W. (1991). Expression of a dominant negative mutant of the FGF receptor disrupts mesoderm formation in Xenopus embryos. Cell 66,257 -270.[CrossRef][Medline]
Ang, S. L. and Rossant, J. (1994). HNF-3 beta is essential for node and notochord formation in mouse development. Cell 78,561 -574.[CrossRef][Medline]
Bassez, T., Paris, J., Omilli, F., Dorel, C. and Osborne, H.
B. (1990). Post-transcriptional regulation of ornithine
decarboxylase in Xenopus laevis oocytes.
Development 110,955
-962.
Beddington, R. S. and Robertson, E. J. (1999). Axis development and early asymmetry in mammals. Cell 96,195 -209.[CrossRef][Medline]
Bouwmeester, T., Kim, S., Sasai, Y., Lu, B. and De Robertis, E. M. (1996). Cerberus is a head-inducing secreted factor expressed in the anterior endoderm of Spemann's organizer. Nature 382,595 -601.[CrossRef][Medline]
Brown, M. T. and Cooper, J. A. (1996). Regulation, substrates and functions of src. Biochim. Biophys. Acta. 1287,121 -149.[Medline]
Carlsson, P. and Mahlapuu, M. (2002). Forkhead transcription factors: key players in development and metabolism. Dev. Biol. 250,1 -23.[CrossRef][Medline]
Cho, K. W., Blumberg, B., Steinbeisser, H. and De Robertis, E. M. (1991). Molecular nature of Spemann's organizer: the role of the Xenopus homeobox gene goosecoid. Cell 67,1111 -1120.[CrossRef][Medline]
Christian, J. L., McMahon, J. A., McMahon, A. P. and Moon, R.
T. (1991). Xwnt-8, a Xenopus Wnt-1/int-1-related gene
responsive to mesoderm-inducing growth factors, may play a role in ventral
mesodermal patterning during embryogenesis.
Development 111,1045
-1055.
Conlon, F. L., Lyons, K. M., Takaesu, N., Barth, K. S., Kispert, A., Herrmann, B. and Robertson, E. J. (1994). A primary requirement for nodal in the formation and maintenance of the primitive streak in the mouse. Development 120,1919 -1928.[Abstract]
Dale, L. and Slack, J. M. (1987). Regional
specification within the mesoderm of early embryos of Xenopus laevis.
Development 100,279
-295.
Dufort, D., Schwartz, L., Harpal, K. and Rossant, J. (1998). The transcription factor HNF3beta is required in visceral endoderm for normal primitive streak morphogenesis. Development 125,3015 -3025.[Abstract]
Eisaki, A., Kuroda, H., Fukui, A. and Asashima, M. (2000). XSIP1, a member of two-handed zinc finger proteins, induced anterior neural markers in Xenopus laevis animal cap. Biochem. Biophys. Res. Commun. 271,151 -157.[CrossRef][Medline]
Harland, R. and Gerhart, J. (1997). Formation and function of Spemann's organizer. Annu. Rev. Cell Dev. Biol. 13,611 -667.[CrossRef][Medline]
Harland, R. M. (1991). In situ hybridization: an improved whole-mount method for Xenopus embryos. Methods Cell Biol. 36,685 -695.[Medline]
Hemmati-Brivanlou, A. and Melton, D. A. (1992). A truncated activin receptor inhibits mesoderm induction and formation of axial structures in Xenopus embryos. Nature 359,609 -614.[CrossRef][Medline]
Hemmati-Brivanlou, A. and Melton, D. A. (1994). Inhibition of activin receptor signaling promotes neuralization in Xenopus. Cell 77,273 -281.[CrossRef][Medline]
Hudson, C., Clements, D., Friday, R. V., Stott, D. and Woodland, H. R. (1997). Xsox17alpha and -beta mediate endoderm formation in Xenopus. Cell 91,397 -405.[CrossRef][Medline]
Iratni, R., Yan, Y. T., Chen, C., Ding, J., Zhang, Y., Price, S.
M., Reinberg, D. and Shen, M. M. (2002). Inhibition of excess
nodal signaling during mouse gastrulation by the transcriptional corepressor
DRAP1. Science 298,1996
-1999.
Isaacs, H. V., Pownall, M. E. and Slack, J. M. (1994). eFGF regulates Xbra expression during Xenopus gastrulation. EMBO J. 13,4469 -4481.[Medline]
Jonas, E., Sargent, T. D. and Dawid, I. B.
(1985). Epidermal keratin gene expressed in embryos of Xenopus
laevis. Proc. Natl. Acad. Sci. USA
82,5413
-5417.
Jones, C. M., Broadbent, J., Thomas, P. Q., Smith, J. C. and Beddington, R. S. (1999). An anterior signalling centre in Xenopus revealed by the homeobox gene XHex. Curr. Biol. 9,946 -954.[CrossRef][Medline]
Kaestner, K. H., Knochel, W. and Martinez, D. E.
(2000). Unified nomenclature for the winged helix/forkhead
transcription factors. Genes Dev.
14,142
-146.
Kessler, D. S. (1997). Siamois is required for
formation of Spemann's organizer. Proc. Natl. Acad. Sci.
USA 94,13017
-13022.
Kim, H. J. and Bar-Sagi, D. (2004). Modulation of signalling by Sprouty: a developing story. Nat. Rev. Mol. Cell Biol. 5,441 -450.[CrossRef][Medline]
Kintner, C. R. and Brockes, J. P. (1984). Monoclonal antibodies identify blastemal cells derived from dedifferentiating limb regeneration. Nature 308, 67-69.[CrossRef][Medline]
Krieg, P. A., Varnum, S. M., Wormington, W. M. and Melton, D. A. (1989). The mRNA encoding elongation factor 1-alpha (EF-1 alpha) is a major transcript at the midblastula transition in Xenopus. Dev. Biol. 133,93 -100.[CrossRef][Medline]
LaBonne, C. and Whitman, M. (1997). Localization of MAP kinase activity in early Xenopus embryos: implications for endogenous FGF signaling. Dev. Biol. 183, 9-20.[CrossRef][Medline]
Lef, J., Clement, J. H., Oschwald, R., Koster, M. and Knochel, W. (1994). Spatial and temporal transcription patterns of the forkhead related XFD-2/XFD-2' genes in Xenopus laevis embryos. Mech. Dev. 45,117 -126.[CrossRef][Medline]
Lerchner, W., Latinkic, B. V., Remacle, J. E., Huylebroeck, D. and Smith, J. C. (2000). Region-specific activation of the Xenopus brachyury promoter involves active repression in ectoderm and endoderm: a study using transgenic frog embryos. Development 127,2729 -2739.[Abstract]
Newman, C. S., Chia, F. and Krieg, P. A. (1997). The XHex homeobox gene is expressed during development of the vascular endothelium: overexpression leads to an increase in vascular endothelial cell number. Mech. Dev. 66, 83-93.[CrossRef][Medline]
Nutt, S. L., Dingwell, K. S., Holt, C. E. and Amaya, E.
(2001). Xenopus Sprouty2 inhibits FGF-mediated
gastrulation movements but does not affect mesoderm induction and patterning.
Genes Dev. 15,1152
-1166.
Papin, C., van Grunsven, L. A., Verschueren, K., Huylebroeck, D. and Smith, J. C. (2002). Dynamic regulation of Brachyury expression in the amphibian embryo by XSIP1. Mech. Dev. 111,37 -46.[CrossRef][Medline]
Perea-Gomez, A., Shawlot, W., Sasaki, H., Behringer, R. R. and Ang, S. (1999). HNF3beta and Lim1 interact in the visceral endoderm to regulate primitive streak formation and anterior-posterior polarity in the mouse embryo. Development 126,4499 -4511.[Abstract]
Perea-Gomez, A., Rhinn, M. and Ang, S. L. (2001). Role of the anterior visceral endoderm in restricting posterior signals in the mouse embryo. Int. J. Dev. Biol. 45,311 -320.[Medline]
Perea-Gomez, A., Vella, F. D., Shawlot, W., Oulad-Abdelghani, M., Chazaud, C., Meno, C., Pfister, V., Chen, L., Robertson, E., Hamada, H. et al. (2002). Nodal antagonists in the anterior visceral endoderm prevent the formation of multiple primitive streaks. Dev. Cell 3,745 -756.[CrossRef][Medline]
Rodaway, A. and Patient, R. (2001). Mesendoderm. an ancient germ layer? Cell 105,169 -172.[CrossRef][Medline]
Sasai, Y., Lu, B., Steinbeisser, H., Geissert, D., Gont, L. K. and De Robertis, E. M. (1994). Xenopus chordin: a novel dorsalizing factor activated by organizer-specific homeobox genes. Cell 79,779 -790.[CrossRef][Medline]
Sheng, G., dos Reis, M. and Stern, C. D. (2003). Churchill, a zinc finger transcriptional activator, regulates the transition between gastrulation and neurulation. Cell 115,603 -613.[CrossRef][Medline]
Shivdasani, R. A. (2002). Molecular regulation of vertebrate early endoderm development. Dev. Biol. 249,191 -203.[CrossRef][Medline]
Slack, J. M. (1994). Inducing factors in Xenopus early embryos. Curr. Biol. 4, 116-126.[CrossRef][Medline]
Slack, J. M., Dale, L. and Smith, J. C. (1984). Analysis of embryonic induction by using cell lineage markers. Philos. Trans. R. Soc. London Series B 307,331 -336.
Smith, J. C., Price, B. M., Green, J. B., Weigel, D. and Herrmann, B. G. (1991). Expression of a Xenopus homolog of Brachyury (T) is an immediate-early response to mesoderm induction. Cell 67,79 -87.[CrossRef][Medline]
Smith, W. C. and Harland, R. M. (1991). Injected Xwnt-8 RNA acts early in Xenopus embryos to promote formation of a vegetal dorsalizing center. Cell 67,753 -765.[CrossRef][Medline]
Smith, W. C. and Harland, R. M. (1992). Expression cloning of noggin, a new dorsalizing factor localized to the Spemann organizer in Xenopus embryos. Cell 70,829 -840.[CrossRef][Medline]
Solomon, K. S., Logsdon, J. M., Jr and Fritz, A. (2003). Expression and phylogenetic analyses of three zebrafish FoxI class genes. Dev. Dyn. 228,301 -307.[CrossRef][Medline]
Song, Y., Cohler, A. N. and Weinstein, D. C. (2001). Regulation of Laloo by the Xenopus C-terminal Src kinase (Xcsk) during early vertebrate development. Oncogene 20,5210 -5214.[CrossRef][Medline]
Summerton, J. (1999). Morpholino antisense oligomers: the case for an RNase H-independent structural type. Biochim. Biophys. Acta. 1489,141 -158.[Medline]
Suri, C., Haremaki, T. and Weinstein, D. C. (2004). Inhibition of mesodermal fate by Xenopus HNF3beta/FoxA2. Dev. Biol. 265,90 -104.[CrossRef][Medline]
van Grunsven, L. A., Papin, C., Avalosse, B., Opdecamp, K., Huylebroeck, D., Smith, J. C. and Bellefroid, E. J. (2000). XSIP1, a Xenopus zinc finger/homeodomain encoding gene highly expressed during early neural development. Mech. Dev. 94,189 -193.[CrossRef][Medline]
Wardle, F. C. and Smith, J. C. (2004).
Refinement of gene expression patterns in the early Xenopus embryo.
Development 131,4687
-4696.
Weinstein, D. C., Ruiz i Altaba, A., Chen, W. S., Hoodless, P., Prezioso, V. R., Jessell, T. M. and Darnell, J. E., Jr (1994). The winged-helix transcription factor HNF-3 beta is required for notochord development in the mouse embryo. Cell 78,575 -588.[CrossRef][Medline]
Weinstein, D. C., Marden, J., Carnevali, F. and Hemmati-Brivanlou, A. (1998). FGF-mediated mesoderm induction involves the Src-family kinase Laloo. Nature 394,904 -908.[CrossRef][Medline]
Whitman, M. (2001). Nodal signaling in early vertebrate embryos: themes and variations. Dev. Cell 1, 605-617.[CrossRef][Medline]
Wilson, P. A. and Hemmati-Brivanlou, A. (1995). Induction of epidermis and inhibition of neural fate by Bmp-4. Nature 376,331 -333.[CrossRef][Medline]
Zhang, L., Zhou, H., Su, Y., Sun, Z., Zhang, H., Zhang, Y.,
Ning, Y., Chen, Y. G. and Meng, A. (2004). Zebrafish Dpr2
inhibits mesoderm induction by promoting degradation of nodal receptors.
Science 306,114
-117.
Zhou, X., Sasaki, H., Lowe, L., Hogan, B. L. and Kuehn, M. R. (1993). Nodal is a novel TGF-beta-like gene expressed in the mouse node during gastrulation. Nature 361,543 -547.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
C. Chang and R. M. Harland Neural induction requires continued suppression of both Smad1 and Smad2 signals during gastrulation Development, November 1, 2007; 134(21): 3861 - 3872. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-H. Yun, S.-C. Choi, E. Park, S.-J. Kim, A.-S. Chung, H.-K. Lee, H.-J. Lee, and J.-K. Han Negative regulation of Activin/Nodal signaling by SRF during Xenopus gastrulation Development, February 15, 2007; 134(4): 769 - 777. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Mir, M. Kofron, A. M. Zorn, M. Bajzer, M. Haque, J. Heasman, and C. C. Wylie FoxI1e activates ectoderm formation and controls cell position in the Xenopus blastula Development, February 15, 2007; 134(4): 779 - 788. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Steiner, M. J. Engleka, Q. Lu, E. C. Piwarzyk, S. Yaklichkin, J. L. Lefebvre, J. W. Walters, L. Pineda-Salgado, P. A. Labosky, and D. S. Kessler FoxD3 regulation of Nodal in the Spemann organizer is essential for Xenopus dorsal mesoderm development Development, December 15, 2006; 133(24): 4827 - 4838. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Heasman Patterning the early Xenopus embryo. Development, April 1, 2006; 133(7): 1205 - 1217. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. C. Weinstein Mesodermal Differentiation: Signal Integration During Development Sci. Signal., August 30, 2005; 2005(299): tr23 - tr23. [Abstract] [Ful |