|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 18 May 2005
doi: 10.1242/dev.01863
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Cell Biology, The Johns Hopkins University School of Medicine, 725 North Wolfe Street, Baltimore, MD 21205, USA
* Author for correspondence (e-mail: dandrew{at}jhmi.edu)
Accepted 14 April 2005
| SUMMARY |
|---|
|
|
|---|
Key words: CrebA, Fkh, Drosophila, Salivary gland, Secretory pathway
| Introduction |
|---|
|
|
|---|
and HNF3ß, and the nuclear receptor
superfamily member HNF4 converge on the regulation of the
homeodomain-containing transcription factor HNF1
(Cereghini, 1996
(indirectly
through HNF3ß) are themselves regulated by the leucine-zipper
transcription factor C/EBP
(Samadani et al., 1995
In the case of pharyngeal development in the nematode C. elegans,
transcriptional regulation appears to be simpler. In this organ, PHA-4, a
winged-helix transcription factor homologous to mammalian HNF3ß and
Drosophila Fork head, is crucial for both pharynx specification and
subsequent differentiation. The pharynx completely fails to form in
pha-4 mutants and ectopic expression of pha-4 can activate
at least one pharynx-specific gene in new places
(Kalb et al., 1998
).
PHA-4-binding sites are present upstream of all tested pharyngeal genes, and
temporal expression correlates with PHA-4-binding site affinity
(Gaudet and Mango, 2002
). In
general, early genes have relatively strong binding sites for PHA-4, whereas
later genes have relatively weak sites. Correspondingly, early in organ
development, low levels of PHA-4 are present and are sufficient to activate
the early-expressed genes. As levels of PHA-4 increase temporally, late genes
are expressed. By using a temperature sensitive allele of pha-4, the
same group confirmed that the late expression of pha-4 is indeed
important for proper organ development
(Gaudet and Mango, 2002
).
Thus, the role of pha-4 is not only to initiate a downstream
regulatory cascade but also to function throughout the development of the
C. elegans pharynx by directly regulating genes pivotal to its final
form and function. Whether this single-tier mode of regulation is a recurring
theme in organ development remains to be determined.
The Drosophila salivary gland is an excellent model for
investigating how a tissue acquires specialized function, as much is already
known with respect to how the gland is specified (reviewed by
Andrew et al., 2000
;
Abrams et al., 2003
). In
addition, large-scale expression studies suggest that a significant number of
genes are expressed to high levels in the salivary gland, and therefore access
to a large pool of potential downstream targets is available
(http://www.fruitfly.org/EST/index.shtml).
Salivary gland formation requires the homeotic transcription factors, Sex
Combs Reduced (Scr), Extradenticle (Exd) and Homothorax (Hth); in
loss-of-function mutants of any of these genes, salivary glands fail to form.
Moreover, ectopic expression of Scr, the one component of the complex
with limited spatial expression, leads to the formation of additional salivary
glands (Panzer et al., 1992
;
Andrew et al., 1994
). Although
the Scr/Exd/Hth complex is required for the expression of every tested
salivary gland gene, expression of Scr and hth and nuclear
localization of Exd disappear shortly after the salivary gland initiates
morphogenesis (Henderson and Andrew,
2000
), suggesting that, unlike in the C. elegans pharynx,
the genes that specify the Drosophila salivary gland cell fate are not
involved in its terminal differentiation. Genes encoding three early
transcription factors are known to be expressed in the early salivary gland
under the control of Scr/Exd/Hth (Panzer
et al., 1992
; Andrew et al.,
1994
): fork head (fkh), which encodes the
winged-helix transcription factor homologous to C. elegans PHA-4;
CrebA, which encodes the Cyclic AMP Response Element Binding protein
A; and huckebein (hkb), which encodes an Sp1/egr-like
transcription factor. In the embryo, Fkh controls apical constriction of the
salivary cells as they invaginate and promotes salivary cell survival by
inhibiting apoptosis (Myat and Andrew,
2000b
). During larval development, Fkh is required to activate
expression of the sgs glue genes
(Lehmann and Korge, 1996
;
Mach et al., 1996
). The SGS
glue proteins play a role in the adherence of the pupal case to a substratum.
Thus, Fkh is similar to C. elegans PHA-4 in as far as it is important
throughout salivary gland development and function. However, a significant
number of salivary gland markers are still expressed in the uninvaginated
salivary cells of fkh mutant embryos
(Myat and Andrew, 2000b
;
Bradley and Andrew, 2001
) (E.
Grevengoed, U. Ng and D.J.A., unpublished), suggesting that Fkh is not an
organ-specifying gene. CrebA has been shown to be important in
cuticle patterning and in promoting the integrity of the larval cuticle
(Andrew et al., 1997
). Its role
in the salivary gland, however, has been less clear, although a low percentage
of CrebA embryos have crooked salivary glands
(Andrew et al., 1997
). Hkb is
required for proper morphogenesis of the secretory tube. In hkb
mutants, dome-shaped salivary glands form instead of elongated tubes because
of a failure to generate and deliver sufficient apical membrane
(Myat and Andrew, 2000a
;
Myat and Andrew, 2002
). Thus,
fkh and hkb have genetically defined roles in the
morphogenesis of the salivary gland, whereas the role of CrebA in salivary
gland development remains elusive.
To learn how the salivary gland is programmed for its primary function,
secretion, we focused on the regulation of genes encoding early secretory
pathway components. The secretory components crucial for targeting proteins to
the endoplasmic reticulum (ER), for signal peptide processing and for
vesicular trafficking between the ER and Golgi have been studied extensively
in yeast and in mammalian tissue culture cells (reviewed by
Harter, 1995
;
Kalies and Hartmann, 1996
;
Romisch, 1999
;
Wild et al., 2002
; Barlowe,
2003a). Clear homologs of most of these proteins exist in flies based on
sequence comparisons (Adams et al.,
2000
), although very few have been characterized to any extent
(Valcarcel et al., 1999
).
Here, we show that genes encoding the Drosophila homologs to the
yeast and/or mammalian early secretory pathway proteins are expressed at high
levels in the Drosophila embryonic salivary gland and other secretory
tissues, and that CrebA is essential for this high level salivary gland
expression. Fkh is required for late expression of these genes and functions
indirectly through maintenance of CrebA expression. Correspondingly, CrebA is
required for enhanced secretory activity in the salivary gland. CrebA also
activates SPCG expression in the embryonic epidermis, explaining the cuticle
defects observed in CrebA mutant larvae.
| Materials and methods |
|---|
|
|
|---|
Fly strains
For fkh mutants, we used the null fkh6 allele
in an H99 background to prevent secretory cell apoptosis and to thus simplify
the analysis (Myat and Andrew,
2000b
). Accordingly, we performed the same experiments in H99 only
lines as a control. For CrebA mutants, we used the protein null
allele CrebAwR23
(Andrew et al., 1997
); for
hkb mutants, we used hkb2
(Bronner et al., 1994
).
l(3)01031 (sec13), l(3)j13C8 (sec23),
l(3)rK561 (SrpRß) and l(3)05712
(sar1) are all lethal P-element lines; both stocks and plasmid rescue
data were obtained from FlyBase. CrebAwR23, fkh6
H99 and hkb2 were balanced over TM6B-Ubx lacZ.
l(3)j13C8 was balanced over TM3-ftz lacZ. The
lacZ-containing balancers were used to distinguish the homozygous
mutant embryos from siblings by staining with a lacZ probe.
Identification of CrebA and SPCG enhancers
A 2.8 kb HindIII fragment that maps
3.5 kb upstream of the
CrebA transcription start site and drives ß-gal expression in the
salivary gland and amnioserosa has been identified previously (K. D.
Henderson, PhD Thesis, Johns Hopkins University School of Medicine, 2000). The
following primer pairs were used to further isolate the CrebA salivary gland
enhancers: CrebA 1100 (5'GAATTCCTTCGCTGTCATGC and
3'GGATCCAGCGTCTTCTAGAGATAC), which amplify an 1100 bp sub-fragment of
HindIII 2.8 containing six potential Fkh binding sites
(Fig. 3); and CrebA 770
(5'GAATTCTAGAAGACGCTGGCGAATG and 3'GGATCCCATCTTCGATCTGGC), which
amplify a 770 bp sub-fragment of HindIII 2.8 containing four
potential Fkh-binding sites (Fig.
3).
Six candidate SPCG genes, representing members of distinct pathway
components, were selected and from 1.3 to 2.6 kb of upstream genomic sequence
of each gene was amplified. The length was limited by the exclusion of
BamHI and EcoRI sites, which were needed for subcloning the
resulting PCR fragments into the Casper ß-Gal reporter plasmid
(Thummel et al., 1988
). The
following genes and corresponding primer sets were used: srp68,
5'GAATTCGTTGTGTGCTTCTCCAGATTGC and 3'AGTGTACGGCTATGGCGAAT;
p24, 5'CAGGAACGTAAGCAGATCTCG and 3'TCCACGTAGACGATCTTGTGC;
srpR
, 5'GAATTCTGAAGACAGGCTAGGCTGG and
3'GGATCCGCGATCGAAGTCGTAGTCAT;
-cop,
5'GAATTCGGAGTTGAGCACCTCGTTG and 3'GGATCCAGGCGCTTCTCAACGTTC;
spase25, 5'GAATTCACACCATACACCGTACACC and
3'GTGCTTCACTGCGGATCCAT; and sec61ß,
5'GAATTCCACCGAATCGAACGACTC and 3'CACACCAATGCCTCAACAAG.
All of the resulting PCR fragments were subcloned into the Casper
ß-Gal reporter plasmid (Thummel et
al., 1988
) and used to transform w1118 flies
through standard methods (Spradling and
Rubin, 1982
). Individual lines were assayed for enhancer activity
by staining with anti-ß-Gal antibody.
Site-directed mutagenesis
Point mutations known to affect the binding of Fkh to defined binding sites
(E.W.A. and D.J.A., unpublished) were introduced into each of the six
potential Fkh-binding sites contained within the CrebA 1100 enhancer using the
QuikChange Multi Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA). The
following primers were used (bold nucleotides indicate changes): site 1,
ACTTCCTCCTATGAATGAATGCCTGTTATTGCGGGTTCCT; site 2,
CGAACACATAAAGACTATAGGTATCTGCTACCACGGCTTAGAGCCG; site 3,
CGCATTGAACAAAATTCTCTTGCCTAATGATATGCTATTATTA; site 4,
CCCAGTTTCATCATTATCATCACCCTGTCAAAAGCAGACTT; site 5,
GCGACAGCAAAGTCAGACAGGTAAGTCAGCACTACGTTCT; and site 6,
TAAATGATCTCATTGTTGACTGCCTGTTCTCCCTCAGGAC. The resulting mutant
constructs were used to transform w1118 flies and
individual lines were assayed for enhancer activity by anti-ß-Gal
staining.
In situ hybridization and antibody staining
In situ hybridization and antibody staining were performed as previously
described (Lehmann and Tautz,
1994
; Reuter et al.,
1990
). In each case, we compared the levels of expression in the
homozygotes to the levels observed in their heterozygous siblings to control
for experimental variation in staining levels. Antibody dilutions used in this
study are as follows:
-ß-galactosidase (1:5000),
-DSC73
(1:800),
-Pasilla (1:1000),
-PH4
-SG1 (1:5000) and
-En (1:200).
-PH4
-SG1 (E.W.A. and D.J.A., unpublished),
-Pasilla (Seshaiah et al.,
2001
) and
-DSC73 (D.J.A., unpublished) are polyclonal
antisera made in rat.
-En is a polyclonal antibody made in rabbit that
cross-reacts with unknown secretory products in the salivary gland
(Myat and Andrew, 2002
).
Approximately 40 pairs of salivary glands were analyzed for each mutant in the
En staining experiments to gauge changes in secretory granule levels. All
biotin-conjugated secondary antibodies were used at a dilution of 1:500
(Vector Labs; Burlingame, CA) and all fluorescent secondary antibodies were
used at a dilution of 1:400 (Molecular Probes; Eugene, OR). Confocal images
were obtained with the Ultraview Confocal Microscope (Perkin Elmer) at the
Johns Hopkins Microscope Facility. All other images were taken on a Zeiss
Axiophot microscope with a Nikon Coolpix 4500 digital camera.
Protein alignments and binding site searches
Homology searches of the Drosophila SPCGs to identify human
proteins were performed using BLAST
(http://www.ncbi.nlm.nih.gov).
Identities/similarities were calculated using CLUSTALW
(Combet et al., 2000
). To
identify conserved sequences upstream of the SPCGs, 500 nucleotides
immediately upstream of the translation start sites of all 34 SPCGs was
analyzed by MEME
(http://meme.sdsc.edu/meme/website/)
(Bailey and Elkan, 1994
). The
most conserved sequence (other than the runs of PolyA+ DNA) was a good match
for the mammalian Creb-binding site consensus
(http://www.cbrc.jp/research/dp/TFSEARCH.html/;
threshold score 86.1). We subsequently looked for this site in the 2 kb region
immediately upstream of the translation start sites of all of the SPCGs.
| Results |
|---|
|
|
|---|
|
-Pasilla (Ps), expression of which is
not affected by these mutations (Myat and
Andrew, 2000b
The signal recognition particle (Srp) interacts with the N-terminal signal
peptide as it emerges from the ribosome. Subsequently, the Srp interacts with
the Srp Receptor (SR)
-subunit, which is anchored to the cytoplasmic
face of the ER through the transmembrane SR ß-subunit
(Fig. 1)
(Legate et al., 2000
;
Song et al., 2000
). The Srp
complex is composed of a 7S RNA and six protein subunits, which are referred
to as the 9, 14, 19, 54, 68 and 72 kDa Srp subunits
(Fig. 1)
(Wild et al., 2002
). All of
the known protein subunits of the Srp and the SR are expressed to very high
levels in the embryonic salivary gland
(Fig. 2B; see Fig. S1B,C in the
supplementary material) and the levels are much higher than in other embryonic
tissues, with the exception of Srp14 and Srp19, which are expressed to
similarly high levels throughout the embryo (data not shown). Salivary gland
expression of the Srp and SR genes is unaltered in hkb mutants, but
is significantly diminished in later stages in both fkh and
CrebA mutants (stage 13 and beyond;
Fig. 2B; see Fig. S1B,C in the
supplementary material). Interestingly, there are differences in the early
expression of Srp and SR genes in fkh and CrebA mutants.
Whereas in the early fkh mutants, expression levels are comparable
with wild type, in the early CrebA mutants, expression is diminished
to levels seen in surrounding, non-salivary gland tissues or was barely
visible (Fig. 2D;
Table 2; see Fig. S1B,C in the
supplementary material). Thus, both fkh and CrebA are
required to achieve persistent high-level expression of Srp and SR genes in
the embryonic salivary gland; however, Fkh is required only to maintain and
not initiate expression. CrebA mutants also had diminished Srp and SR
gene expression in the late epidermis (where CrebA is also normally
expressed), indicating a more general requirement for CrebA in the
expression of these genes.
|
|
, sec61ß and sec61
subunits (Fig. 1)
(Schnell and Hebert, 2003
is expressed ubiquitously in the embryo and increased levels were
detectable only in the salivary gland prior to internalization (data not
shown). As the cells internalized, elevated expression of sec61
was
restricted to the salivary gland cells that were still on the surface of the
embryo (data not shown). In contrast to sec61
, high-level salivary
gland expression of both sec61ß and sec61
persists throughout the
remainder of embryogenesis. As with Srp and SR, salivary gland expression of
sec61ß and sec61
is unaffected by mutations in hkb and is
dramatically reduced in CrebA mutants at all embryonic stages
(Fig. 2B; see Fig. S1D in the
supplementary material). Similarly, mutations in fkh affect later but
not earlier expression of both sec61ß and sec61
(Fig. 2D; data not shown).
Epidermal expression of both genes is also diminished in CrebA
mutants (Fig. 2B; data not
shown).
The translocation-associating membrane protein (TRAM) is required for
efficient co-translational translocation of proteins into the ER and is
important for the incorporation of transmembrane proteins into the lipid
bilayer (Schnell and Hebert,
2003
). TRAM is highly expressed in the Drosophila
salivary gland and epidermis. This expression appears normal in early
fkh mutants and is attenuated but not completely removed in late
fkh embryos (see Fig. S1D in the supplementary material). TRAM
expression in both the salivary gland and epidermis is significantly reduced
at all stages in CrebA mutants and is unaffected by hkb (see
Fig. S1D in the supplementary material; data not shown).
|
The translocation-associated protein (TRAP) complex is composed of four
subunits,
, ß,
and
, and is thought to be
associated with the translocon machinery. Recently, the TRAP complex has been
shown to be required for the translocation of proteins in a substrate-specific
manner. For example, the secretory protein Prolactin is efficiently
translocated into the ER in the absence of functional TRAP. However, prion
protein (PrP), which enters the secretory pathway in three different
topographical configurations, requires TRAP
(Fons et al., 2003
). Homologs
to all four TRAP subunits exist in Drosophila, although the
expression of only TRAP
was analyzed in this study. TRAP
is
expressed at high levels in the salivary gland and epidermis. The salivary
gland expression requires fkh late and CrebA throughout
embryogenesis for wild-type expression in the salivary gland and epidermis
(Fig. 2B,D).
Soluble nascent polypeptides have their N-terminal signal peptides cleaved
off by the signal peptidase complex (SPC). The SPC is made up of five
transmembrane subunits (SPases) with the following masses: 12, 18, 21, 22/23
and 25 kDa (Fig. 1)
(Kalies and Hartmann, 1996
).
The gene encoding the 18 kDa homolog is not present in the Drosophila
genome and is most related to the 21 kDa subunit by sequence comparison. The
four recognizable Drosophila SPase genes require fkh for
late but not early expression (Fig.
2B; see Fig. S1E in the supplementary material). CrebA is
required for wild-type levels of SPase expression in the salivary gland at all
stages. As with all the other genes discussed so far, hkb mutants
have levels of SPase expression comparable with those in wild type
(Fig. 2B; data not shown).
Regulation of SPCGs involved in ER export and retrieval
Soluble proteins that are fully translocated, processed (e.g. signal
peptide cleaved, glycosylated) and destined to proceed through the secretory
pathway interact with proteins that recruit them to specialized domains (exit
sites) in the ER (Aridor et al.,
1998
; Tang et al.,
2001
). For soluble proteins, this recruitment is thought to occur,
in part, through interactions with cargo receptors of the p24 single
transmembrane family of proteins (Fiedler
et al., 1996
; Dominguez et
al., 1998
). In Drosophila, expression of three p24 family
members is upregulated in the salivary gland; this upregulated expression
requires CrebA at all embryonic stages and fkh from stage 13
onwards (Fig. 2C; see Fig. S2A
in the supplementary material; data not shown).
Once recruited to export sites in the ER, cargo molecules are packaged into
transport vesicles. COPII coatomer molecules assemble onto vesicles involved
in the anterograde movement of secretory products from the ER to the cis Golgi
(Fig. 1)
(Ellgaard et al., 1999
).
Transmembrane proteins destined to exit the ER contain cytoplasmic tails with
exit signals, which interact directly with COPII subunits
(Tang et al., 2001
). The
assembly of the coat from a cytoplasmic pool of soluble COPII subunits is
thought to drive the actual budding of vesicles. This process is regulated by
the small G protein Sarl, where hydrolysis of GTP-Sar1 to GDP-Sarl leads to
coat disassembly shortly after vesicle formation
(Barlowe, 2003b
). In
Drosophila, the genes encoding the COPII components Sec13, Sec31,
Sec23, Sec24 and Sar1 are conserved and require fkh and
CrebA for high levels of salivary gland expression
(Fig. 2C; see Fig S2B in the
supplementary material). However, as with the aforementioned SPCGs, expression
of the COPII subunits appears to be relatively independent of fkh
prior to stage 13 (Fig. 2D;
data not shown).
COPI coats are typically involved in retrograde movement of transport
vesicles, although in certain contexts they have been shown to also be
involved in anterograde movement (Orci et
al., 1997
). The COPI coatomer component genes,
, ß,
ß',
,
,
, and
-cop
(Rothman and Orci, 1992
) are
all conserved in Drosophila (Adams
et al., 2000
). As with COPII, COPI coat formation is regulated by
a small G-protein, ARF-1. Although each of the five Drosophila ARF-1
homologs is highly conserved (data not shown), ARF79F is the most homologous
to human ARF1 (Table 1).
Finally, the KDEL receptor (KDEL-R) has been shown in yeast and mammals to be
important in the retrieval of escaped resident proteins back to the ER
(Lewis et al., 1990
;
Lewis and Pelham, 1992
).
,
,
,
-cop, ARF79F and the KDEL-R genes are
upregulated in the salivary gland and require fkh for their elevated
expression from stage 13 and later (Fig.
2C; see Fig. S2C in the supplementary material). Although the
expression of these genes is reduced in the salivary glands of CrebA
mutants, both early and late expression of
-cop,
-cop and the
KDEL-R gene are not as reduced as the other SPCGs
(Table 2; Fig. S2C in the
supplementary material; data not shown).
|
Regulation of CrebA by Fkh is direct
To test whether regulation of CrebA by Fkh is direct, we
identified a 2.8 kb fragment upstream of the CrebA transcription unit
that could drive salivary gland expression of a lacZ reporter gene
(Fig. 3) (K. D. Henderson, PhD
Thesis, Johns Hopkins University School of Medicine, 2000). Two smaller
fragments from this enhancer resulted in salivary gland expression of the
lacZ reporter gene either only after invagination had begun and later
(CrebA-1100) or prior to invagination and later (CrebA-770)
(Fig. 3; top two rows of
embryos). As the later expression pattern fitted the timeframe for
Fkh-dependent salivary gland expression of CrebA, we further
characterized the CrebA-1100 construct, which contains six consensus
Fkh-binding sites (Kaufmann et al., 1994;
Lehmann and Korge, 1996
;
Mach et al., 1996
;
Takiya et al., 2003
).
ß-Gal expression in the salivary glands with the CrebA-1100 construct was
significantly reduced in fkh homozygotes although expression in the
amnioserosa was unaffected, indicating that we had identified a Fkh-dependent
salivary gland enhancer of CrebA
(Fig. 3, third row of embryos).
We next transformed flies with a CrebA-1100 reporter construct in which all
six consensus Fkh-binding sites were mutated (CrebA-1100 fkh1-6
lacZ). Both lines carrying the mutated construct had significantly
diminished salivary gland expression of ß-Gal, although ßGal
expression in other tissues, including the amnioserosa and hemocytes was
unaffected (Fig. 3, bottom
row). We conclude that Fkh functions directly to maintain late high-level
expression of CrebA in the salivary gland.
|
1-2 kb of DNA
further upstream (Fig. 4).
Transformant lines generated from five of the six constructs resulted in
embryonic salivary gland expression. The srp68 lacZ enhancer
construct did not express in the embryonic salivary gland
(Fig. 4A). Salivary gland
lacZ expression from the spase25 and sec61ß
enhancer constructs was detected from early stage 12 and throughout
embryogenesis (Fig. 4E,F).
Salivary gland lacZ expression from the p24-1, zCop and
SrpRa enhancer constructs was first detected during stage 13 and
later (Fig. 4B-D). Expression
of three of the constructs were examined in CrebA mutants; expression
of ß-Gal from both the zCop-lacZ and
sec61ß-lacZ constructs was completely absent in the
salivary glands (Fig. 4D,E),
whereas salivary gland ß-Gal expression from the spase25-lacZ
construct was significantly reduced (Fig.
4F). Thus, we have identified CrebA-dependent salivary gland
enhancers for at least three of the SPCGs.
A search of the regions immediately upstream of the translation start sites
of the SPCGs using MEME
(http://meme.sdsc.edu/meme/website/)
(Bailey and Elkan, 1994
)
revealed a motif that is an excellent match for a mammalian Creb-binding site
(http://www.cbrc.jp/research/dp/TFSEARCH.html/;
threshold score 86.1) and that is present within 2 kb upstream of 32 of the 34
SPCGs (Table 3). (The
translation start site is used as a reference point since transcription start
sites have not been mapped for any of the SPCGs.) Interestingly, of the two
SPCGs that do not contain this consensus, one (sec62) is among the
least affected by mutations in CrebA
(Fig. 2B) and the other,
srp19, is one of only two genes we examined that had ubiquitously
high levels of expression in all tissues, including the salivary gland
(Table 1). Even more compelling
is the finding that 13/32 have the site within 100 bp, another 7/32 have the
site within 200 bp and another 5/32 have the site within 500 bp of the
translation start site. All of the SPCG reporter gene constructs we built
contain this consensus site. Thus, not only do we predict that the site is
important for salivary gland expression of the SPCGs, but that this could be
the site through which CrebA acts to elevate transcription. The proximal
location of these putative binding sites with respect to the start site of
translation is consistent with the finding that mammalian Creb proteins bind
close to the start of transcription (Mayr
and Montminy, 2001
). Also of relevance to these studies was the
failure to discover consensus Fkh-binding sites conserved among the SPCGs
through MEME analysis, further supporting an indirect role for Fkh in SPCG
regulation.
|
SG1, a resident ER protein (E.W.A. and D.J.A.,
unpublished). At early stages, the localization of these markers in the
CrebA mutants was indistinguishable from wild type. By embryonic
stage 15, however, far fewer En-positive vesicles were observed in the
salivary gland cells of CrebA mutants compared with their wild-type
and heterozygous siblings (Fig.
5A, arrows). The difference in vesicle accumulation in salivary
gland cells was even more pronounced at embryonic stage 17, where the number
of En-positive vesicles in wild-type embryos increased substantially relative
to earlier stages, yet few could be detected in the stage 17 CrebA
mutants (Fig. 5B, arrows and
arrowheads). These results indicate that loss of CrebA function is
associated specifically with a decrease in the secretory vesicle population in
late embryos, supporting a role for CrebA in the increased secretory
function associated with the salivary gland. We also tried to determine whether zygotic loss-of-function mutations in individual secretory pathway component genes had secretion defects similar to those observed with CrebA mutants. For these experiments, we obtained lethal P-element insertions in several early secretory genes: srpRß, sec13, sec23 and sar1. The P-elements had inserted in the coding region (sec13), the 5' UTRs (srpRß and sec23) or the first intron (sar1), and thus, would be expected to either eliminate or severely attenuate gene function. The accumulation of En-positive secretory vesicles was not altered detectably in any of the single secretory pathway mutants (Fig. 5C; data not shown). These observations suggest that residual zygotic function in combination with maternally supplied mRNAs are sufficient to support salivary gland secretory function of these single secretory pathway components during embryogenesis.
|
The defects in the larval cuticles of CrebA and SPCG mutants
support a crucial role for these genes in cuticle secretion. In wild-type
animals, secretion begins at about 12 hours after egg laying (AEL)
(Martinez-Arias, 1993
), which
roughly corresponds to embryonic stage 15
(Campos-Ortega and Hartenstein,
1997
). To determine if secretory defects could be detected at this
earlier stage, we stained CrebA and wild-type embryos with antibodies
to DSC73, a secreted protein expressed to high levels in all cells that form
the denticles and hairs of the larva (D.J.A., unpublished). Wild-type stage 15
and older embryos showed high-level DSC73 staining in all epidermal cells that
form the denticles and hairs (Fig.
6D; top two rows). Such consistent and uniform DSC73 staining was
not observed in the CrebA mutants. In the ventral cuticle precursors,
CrebA mutants showed variable DSC73 staining, with levels ranging
from almost wild type to barely detectable
(Fig. 6D; bottom two rows).
DSC73 levels in the dorsal cuticle were only slightly diminished, if at all,
when compared with wild-type levels. DSC73 staining did reveal a significant
lag in dorsal closure in the CrebA mutants, a defect likely to be linked to
the dorsal holes frequently observed in the CrebA larval cuticles.
Thus, defects in secretion in both the salivary gland and epidermis can be
detected in CrebA mutants as early as 12 hours AEL, during embryonic
stage 15.
|
| Discussion |
|---|
|
|
|---|
CrebA and secretory function
CrebA is expressed at very high levels in the early salivary gland
and this high level expression persists throughout larval life. Nonetheless,
embryonic salivary glands in CrebA mutant embryos are relatively
normal, showing only a mildly crooked phenotype when compared with the
salivary glands of wild-type embryos
(Andrew et al., 1997
). This
study indicates a role for CrebA in mediating salivary gland secretory
function through the transcriptional upregulation of genes encoding early
components of the secretory pathway (Figs
2,
4), supporting a physiological
rather than morphogenetic role for this protein. Even so, in the
CrebA mutants, where over 30 SPCGs are expressed at significantly
reduced levels, effects on salivary gland secretion were not evident until
late embryonic stages, when we observed a significant reduction of secretory
vesicles (Fig. 5A,B). The late
occurrence of overt defects in secretion in the CrebA mutants could
reflect not only the increased secretory load on these cells that occurs only
at the later embryonic stages, but also some level of maternal rescue of
secretory function, as CrebA is provided maternally
(Smolik et al., 1992
).
Interestingly, loss-of-function mutations in single secretory pathway
component genes did not show the same loss of secretory activity observed in
CrebA mutant salivary glands. The residual function of each of the
individual SPCGs, from either maternal supplies or the remaining function of
the P-element insertional alleles, appears to suffice when all other
components are present at wild-type levels, at least with regards to salivary
secretion during late embryonic stages.
CrebA mutants have major defects in cuticular development
(Fig. 6); the larval cuticles
are smaller and weaker than the cuticles of their wild-type siblings, the
mouthparts and filzkörper are poorly formed, and CrebA mutants
frequently have large holes in the dorsal cuticle
(Andrew et al., 1997
). In
addition, there appears to be a general defect in patterning of the cuticle,
with dorsal and ventral structures appearing more lateralized
(Andrew et al., 1997
). Embryos
mutant for individual SPCGs, whose epidermal expression is also dependent on
CrebA, had nearly identical defects in the larval cuticle
(Fig. 6). The similarity in
CrebA and the individual SPCG mutant cuticles suggests that
CrebA defects could be entirely due to compromised secretory function
in the epidermal cells that produce the cuticle. The lateralized appearance of
the denticles and hairs could simply reflect compromised secretory function,
which would limit the types of cuticular structures that form to the smaller,
less pigmented structures that are characteristic of the lateral cuticle.
Direct regulation of SPCGs by CrebA
Our expression studies of the SPCGs indicate that CrebA could directly
activate their high level expression. Moreover, we have discovered a conserved
motif upstream of the SPCGs that is not only a good fit with the mammalian
Creb-consensus binding site (TGACGTG G/T C/A;
Table 3), but that also matches
the first six nucleotides of the sequence that was used to discover
CrebA (TGACGTCAG)
(Smolik et al., 1992
).
However, the experiments of Smolik et al. were designed to discover the
Drosophila homolog of the cAMP-regulated Creb protein, which turns
out to be what is now known as CrebB (Usui
et al., 1993
). Gel shift experiments (EMSAs) indicate that CrebA
can bind the to the TGACGTCAG consensus but not with the same high affinity
and specificity as the mammalian cAMP-regulated Creb protein
(Smolik et al., 1992
); thus,
CrebA may bind instead with high affinity to the site discovered in our MEME
motif search of the regions upstream of the SPCGs to regulate their
expression. The CrebA-dependent SPCG enhancers we have characterized so far
(for z-cop; sec61ß and spase25) contain at
least two copies of the consensus motif.
A new and indirect role for the FoxA protein, Fkh, in the salivary gland
Fkh has several roles in salivary gland development and function, including
mediating the cell shape changes of invagination
(Myat and Andrew, 2000b
),
maintaining secretory cell viability (Myat
and Andrew, 2000b
) and transcriptional activation of the
sgs genes in late larval life
(Lehmann and Korge, 1996
;
Mach et al., 1996
). In
addition to these positive roles, FKH also represses the expression of
salivary duct-specific genes in the secretory cells
(Haberman et al., 2003
). Here,
we discover yet another role for fkh in the salivary gland: the
maintenance of SPCG expression.
fkh is a direct transcriptional target of Scr and Exd
(Ryoo and Mann, 1999
) and the
temporal expression of CrebA and the presence of consensus
Scr/Exd-binding sites upstream of the gene suggest that CrebA may
also be directly controlled by Scr and its co-factors. Late expression of
CrebA, however, requires fkh
(Myat and Andrew, 2000b
), as
does late expression of fkh itself
(Zhou et al., 2001
). Here, we
show that Fkh functions directly to maintain CrebA expression in the
salivary gland (Fig. 3). Based
on the requirement for CrebA for expression of the SPCGs at all
embryonic stages and the requirement for fkh only at late stages, our
data support a model in which CrebA controls the expression of the SPCGs and
Fkh is required only because of its role in maintaining CrebA
expression (Fig. 7). A direct
test of this model would be to express CrebA in the salivary glands
of embryos missing fkh function; this experiment, unfortunately,
could not be carried out because Fkh-independent drivers capable of providing
high-level salivary gland-specific expression of CrebA are not yet
available.
|
Note added in proof
Salivary gland expression of the srpR
lacZ
construct shown in Fig. 4C is
completely lost in a CrebA mutant background, indicating that at
least four CrebA-dependent salivary gland SPCG enhancers have been
identified.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/132/12/2743/DC1
| REFERENCES |
|---|
|
|
|---|
Abrams, E. W., Vining, M. S. and Andrew, D. J. (2003). Constructing an organ: the Drosophila salivary gland as a model for tube formation. Trends Cell Biol. 13,247 -254.[CrossRef][Medline]
Adams, M. D., Celniker, S. E., Holt, R. A., Evans, C. A.,
Gocayne, J. D., Amanatides, P. G., Scherer, S. E., Li, P. W., Hoskins, R. A.,
Galle, R. F. et al. (2000). The genome sequence of Drosophila
melanogaster. Science
287,2185
-2195.
Andrew, D. J., Horner, M. A., Petitt, M. G., Smolik, S. M. and Scott, M. P. (1994). Setting limits on homeotic gene function: restraint of Sex combs reduced activity by teashirt and other homeotic genes. EMBO J. 13,1132 -1144.[Medline]
Andrew, D. J., Baig, A., Bhanot, P., Smolik, S. M. and Henderson, K. D. (1997). The Drosophila dCREB-A gene is required for dorsal/ventral patterning of the larval cuticle. Development 124,181 -193.[Abstract]
Andrew, D. J., Henderson, K. D. and Seshaiah, P. (2000). Salivary gland development in Drosophila melanogaster. Mech. Dev. 92,5 -17.[CrossRef][Medline]
Aridor, M., Weissman, J., Bannykh, S., Nuoffer, C. and Balch, W.
E. (1998). Cargo selection by the COPII budding machinery
during export from the ER. J. Cell Biol.
141, 61-70.
Bailey, T. L. and Elkan, C. (1994). Fitting a mixture model by expectation maximization to discover motifs in biopolymers. In Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, pp.28 -36. Menlo Park, CA: AAAI Press.
Barlow, C. (2003a). Molecular recognition of cargo by the COPII complex: a most accommodating coat. Cell 114,395 -397.[CrossRef][Medline]
Barlowe, C. (2003b). Signals for COPII-dependent export from the ER: what's the ticket out? Trends Cell Biol. 13,295 -300.[CrossRef][Medline]
Bradley, P. L. and Andrew, D. J. (2001). ribbon
encodes a novel BTB/POZ protein required for directed cell migration in
Drosophila melanogaster. Development
128,3001
-3015.
Bronner, G., Chu-LaGraff, Q., Doe, C. Q., Cohen, B., Weigel, D., Taubert, H. and Jackle, H. (1994). Sp1/egr-like zinc-finger protein required for endoderm specification and germ-layer formation in Drosophila. Nature 369,664 -668.[CrossRef][Medline]
Campos-Ortega, J. and Hartenstein, V. (1997).The Embryonic Development of Drosophila melanogaster . Berlin Heidelberg: Springer-Verlag.
Cereghini, S. (1996). Liver-enriched transcription f