|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online June 1, 2005
doi: 10.1242/10.1242/dev.01858
1 Program in Developmental Biology, Baylor College of Medicine, Houston, TX
77030, USA
2 Department of Molecular Genetics, University of Texas, M. D. Anderson Cancer
Center, Houston, TX 77030, USA
3 Department of Molecular and Cellular Biology, Harvard University, Cambridge,
MA 02138, USA
4 Department of Urology, Columbia University, College of Physicians and
Surgeons, New York, NY 10032, USA
* Author for correspondence (e-mail: rrb{at}mdanderson.org)
Accepted 18 April 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Lhx1, Lim1, Mesonephros, Metanephros, Müllerian duct
| Introduction |
|---|
|
|
|---|
To understand tissue-specific gene function in kidney organogenesis, in
vitro tissue recombination assays have been used by culturing the ureteric bud
and metanephric mesenchyme from wild-type and mutant animals
(Grobstein, 1953
;
Grobstein, 1956
;
Miyamoto et al., 1997
).
However, this technique is limited if mutants die before metanephros induction
occurs or fail to form the ureteric bud or metanephric mesenchyme. Moreover,
some cell types in the metanephros (e.g. endothelial cells and neurons) are
not generated in the metanephros cultured in vitro
(Vainio and Lin, 2002
).
Recently, conditional knockout strategies including the Cre-loxP
recombination system in mice have been developed, which enables the study of
tissue-specific gene function in vivo, avoiding embryonic lethality and/or
early defects in precursor tissues (Kwan,
2002
; Nagy,
2000
).
The nephric duct also differentiates into the Wolffian duct, the primordium
of the male reproductive tract that includes the epididymis, vas deferens and
seminal vesicle. Subsequently, the Müllerian duct, the primordium of the
oviduct, uterus and vagina of the female reproductive tract, is formed
adjacent to the Wolffian duct in both male and female embryos before sexual
dimorphic differentiation occurs
(Kobayashi and Behringer,
2003
). Thus, the formation of the genital ducts of the
reproductive system is linked with the development of the excretory
system.
The LIM-class homeodomain transcription factor, Lim1 (Lhx1 Mouse
Genome Informatics), is expressed in a dynamic pattern throughout urinary
system development (Barnes et al.,
1994
; Fujii et al.,
1994
; Karavanov et al.,
1998
; Kobayashi et al.,
2004
; Kume et al.,
2000
; Tsang et al.,
2000
). In the mouse, Lim1 is expressed in the
intermediate mesoderm at E7.5 and the nephric duct and mesonephric tubules by
E10.5. Lim1 is also expressed in the metanephros. Lim1 is
expressed in the tip of the ureteric bud in the cortical region. In
metanephric mesenchyme-derived tissues, Lim1 expression is observed
in the pretubular aggregate, the comma- and S-shaped bodies, and the podocyte
of the immature glomerulus, and diminishes in the mature glomerulus
(Karavanov et al., 1998
;
Sariola, 2002
). Although
almost all Lim1-null mutants die around E10.0 because of failure of
chorioallantoic fusion for placenta formation, a few rare Lim1-null
neonates are born and lack the metanephros
(Shawlot and Behringer, 1995
).
This agenesis of the metanephros results from the failure of proper formation
of the nephric duct (Tsang et al.,
2000
), which secondarily causes the lack of metanephros induction.
Because there is both embryonic lethality and failure of proper formation of
the nephric duct in Lim1-null mutants prior to the initiation of
metanephros development, Lim1 function in development of the
mesonephros and metanephros remains unclear.
Here, we have examined Lim1 function in mesonephros and metanephros development by avoiding the early defects of Lim1-null mutants, using BAC transgene rescue, tissue-specific knockout and chimera analysis. Our results demonstrate sequential, dosage-sensitive and distinct tissue-specific roles for Lim1 in tubular morphogenesis during kidney organogenesis.
| Materials and methods |
|---|
|
|
|---|
Lim1lz/+ (Kania et
al., 2000
) and Lim1flox/flox
(Kwan and Behringer, 2002
)
mice were maintained on a B6x129/SvEv mixed genetic background,
Limneo/+ (Shawlot and
Behringer, 1995
) on a B6 congenic background,
Hoxb7-Cretg/+ (Yu et
al., 2002
) on a B6 inbred genetic background, and R26R
(Soriano, 1999
) and
Wnt4+/ (Stark
et al., 1994
) on a B6 x 129/Sv mixed background.
PCR genotyping
The following primers were used for genotyping mice by PCR. For BAC-rescued
Lim1 mutant mice: mLim1-Fw8, GGCTACCTAAGCAACAACTACA; PGK-FX3,
AGACTGCCTTGGGAAAAGCGC; BAC-Fw5, GTAAAACAAGCCACAGTTCTGAC; BAC-Rv6,
TATTCAGCTACTGTTCCGTCAGC; Rap-A, AGGACTGGGTGGCTTCCAACTCCCAGACAC; Rap-B,
AGCTTCTCATTGCTGCGCGCCAGGTTCAGG; lacZ-A, GCATCGAGCTGGGTAATAAGGGTTGGCAAT; and
lacZ-B, GACACCAGACCAACTGGTAATGGTAGCGAC (Lim1neo,
230 bp; BAC, 281 bp;
Rap, 590 bp; lacZ, 822 bp). For Hoxb7-Cretg/+ mice:
mHoxb7-Fw1, TGGGCCGGGGTCACGTGGTCAGA; Cre-Rv2, CGACGATGAAGCATGTTTAGCTG
(
500 bp). For Rarb2-Cretg/+ mice: Cre-Fw6,
GAAACAGGGGCAATGGTGCGCCTGCTG; mMt1-Rv1, AGGAAGACGCTGGGTTGGTCCGATACT (
1.1
kb). Lim1lz/+, Lim1neo/+,
Lim1flox/flox and Wnt4+/ mice
were genotyped as described previously
(Kobayashi et al., 2004
;
Kwan and Behringer, 2002
;
Stark et al., 1994
).
X-gal staining of embryos
X-gal staining was performed as described
(Nagy et al., 2003
). For
histological analysis, paraffin embedded tissues were sectioned at 7 µm and
counterstained with 0.33% eosin Y.
Whole-mount in situ hybridization
Whole-mount in situ hybridization was performed as described
(Shawlot and Behringer,
1995
).
Mouse chimeras
Lim1+/+; R26tg/+
wild-type and
Lim1/; R26tg/+
wild-type
chimeric mice were generated as previously described
(Shawlot et al., 1999
).
| Results |
|---|
|
|
|---|
Hypomorphic phenotypes in BAC-rescued Lim1 mutants
Although most Lim1-null mutants die during embryogenesis around
E10, there are rare homozygous mutants that can survive to birth, which
appears to be influenced by genetic background
(Kobayashi et al., 2004
). Two
male and four female Lim1-null neonates were generated and all lacked
the anterior head, metanephros and ureter
(Fig. 1D,H). Lim1-null
males had normal appearing testes but lacked the male reproductive tract, and
female Lim1-null mutants had normal ovaries but lacked the female
reproductive tract (Fig. 1H and
data not shown) (Kobayashi et al.,
2004
).
|
208 kb C57BL/6J strain BAC clone (RP23-123A17) with the
Lim1 locus centrally located (Fig.
1A). Five Lim1 BAC transgenic founders were generated and
bred with Lim1 heterozygous mice of two different null alleles,
Lim1neo/+ and Lim1lz/+, to place the
BAC transgenes on a Lim1-null background
(Fig. 1B). BAC-rescued
Lim1 mutants (Lim1lz/neo; BACtg/+)
were readily recovered at birth using two independent BAC transgenic lines
(lines 5 and 7) (Fig. 1C). We found that all BAC-rescued Lim1 mutants died within 1 day of birth for both transgenic lines, and displayed hypomorphic phenotypes in tissues requiring Lim1 for their development, including the head, kidney and Müllerian duct derivatives (Fig. 1E,F,I,J). For line 7, some BAC-rescued Lim1 mutants (21.7%, n=23) had craniofacial abnormalities, including a shortened snout, eye defects and loss of the lower jaw (Fig. 1F and data not shown). The female BAC-rescued mutants also frequently (46.2%, n=13) lacked the posterior part of the uterus (Fig. 1J). All of the BAC-rescued mutants for line 7 (n=23) had metanephroi that were smaller in comparison with wild-type controls (Fig. 1J,K). For line 5, the phenotypes of BAC-rescued Lim1 mutants were more severe than line 7. All of the BAC-rescued Lim1 mutants for line 5 (n=4) lacked most of the anterior head, which was smaller than those of rescued mutants for line 7 (Fig. 1E-G). These BAC-rescued Lim1 mutants had two separate ears (Fig. 1E), whereas Lim1-null neonates usually have a single fused ear at the midline (Fig. 1D). All of the BAC-rescued Lim1 mutants for line 5 lacked most of the uterus in females (n=3) (Fig. 1I) and had smaller metanephroi in both sexes (n=4) than those of BAC-rescued Lim1 mutants for line 7 or wild type (Fig. 1I-K).
All of the BAC-rescued Lim1 mutants for both transgenic lines 5 and 7 (n=27) had a shrunken bladder without urine (data not shown), suggesting that the smaller metanephroi were not functional. Histological analysis of the metanephroi of BAC-rescued Lim1 mutants suggested retarded development of the ureteric bud and abnormalities of the medulla (Fig. 1L-N), although collecting ducts (the ducts of Bellini) were present (Fig. 1O-Q). The metanephros of BAC-rescued Lim1 mutants also completely lacked nephrons, including glomeruli and associated tubules of the nephron as well as comma- and S-shaped bodies (Fig. 1O-Q).
Using line 7, we examined Lim1 expression in BAC-rescued Lim1 mutants. The level of BAC-derived Lim1 expression was very low in all organs examined, including the metanephros, Müllerian duct and neural tube (Fig. 1R-Y, data not shown).
Nephric duct epithelium- and nephric mesenchyme-specific Cre transgenic mice
Lim1 is expressed in both ureteric bud- or metanephric
mesenchyme-derived tissues and both ureteric bud- or metanephric
mesenchyme-derived tissues have defects in BAC-rescued Lim1 mutants.
Because there are reciprocal interactions between these tissues, it is not
clear if Lim1 activity is required in the ureteric bud- or
metanephric mesenchyme-derived tissues, or both. Therefore, we inactivated
Lim1 function individually in two distinct tissues of the metanephros
using the Cre-loxP recombination system in vivo to bypass the nephric
duct defect and early lethality of Lim1-null mutants.
For Lim1 inactivation in nephric duct- and ureteric bud-derived
tissues, we used Hoxb7-Cre transgenic mice
(Yu et al., 2002
). To
inactivate Lim1 in the nephric mesenchyme, including the metanephric
mesenchyme, we generated a new Cre transgenic mouse line using a retinoic acid
receptor ß isoform 2 (Rarb2) gene promoter
(Mendelsohn et al., 1991
). To
examine Cre recombinase activity in these transgenic mice, we crossed them
with R26R Cre reporter mice (Soriano,
1999
). Cre reporter expression was detected in the urogenital
system from E9.5 in both Hoxb7- and Rarb2-Cre mice
(Fig. 2A,B). For
Hoxb7-Cre, reporter expression was detected in the entire nephric
duct epithelium, but not in the nephric mesenchyme, at E9.5
(Fig. 2A,C). At the same stage,
for Rarb2-Cre, reporter expression was restricted to the nephric
mesenchyme in the anterior region of the mesonephros, but not in the nephric
duct epithelium (Fig. 2B,D).
Reporter expression for Rarb2-Cre was also detected in the anterior
central nervous system (Fig.
2B; data not shown).
At E10.5, Hoxb7-Cre reporter expression remains restricted to the
nephric duct epithelium, including the ureteric bud
(Fig. 2E,G,I,K). At the same
stage, Rarb2-Cre reporter expression extended posteriorly along the
entire nephric duct mesenchyme, but not in the ureteric bud except for a few
rare cells (Fig. 2F,H,J,L; data
not shown). It has been proposed that cranial mesonephric tubules are derived
from the nephric duct and caudal mesonephric tubules are derived from the
nephric mesenchyme (Sainio et al.,
1997
). Consistent with this, Hoxb7-Cre and
Rarb2-Cre reporter expression were also detected in the cranial and
caudal mesonephros, respectively (Fig.
2G,H). Rarb2-Cre reporter expression was also observed in
the limb mesenchyme and neuroretina of the eye
(Fig. 2F; data not shown).
At E12.5 and E14.5, Hoxb7-Cre reporter expression remained in the nephric duct epithelium derivatives such as the epithelium of the Wolffian duct, ureter and ureteric bud (Fig. 2M,O,Q,S,U,W). At the same stages, Rarb2-Cre reporter expression remains restricted to the metanephric mesenchyme derivatives, including the condensed mesenchyme, cortical stroma, pretubular aggregate, comma- and S-shaped bodies, Bowman's capsule, proximal and distal tubules of the nephron and mesenchyme of the ureter and reproductive tracts (Fig. 2P,R,V,X). Rarb2-Cre reporter expression was also detected in the gubernaculum (Fig. 2N,T). No Cre reporter expression was detected in medullary (inner) stromal cells and glomerular capillary cells that are surrounded by Bowman's capsule, which include endothelial and mesangial cells, in either Hoxb7-Cre or Rarb2-Cre mice (Fig. 2U-X).
Distinct urogenital system phenotypes in nephric duct epithelium- and nephric mesenchyme-specific Lim1 knockout mice
Using the Hoxb7- and Rarb2-Cre mice with a Lim1
conditional null (flox) allele, we inactivated Lim1 function
in nephric duct epithelium- or nephric mesenchyme-derived tissues during
kidney development, respectively. In Hoxb7-Cretg/+;
Lim1lz/flox mutants, we found that Lim1 expression in
the ureteric bud was absent but Lim1 expression in the pretubular
aggregate and its derivative tissues was detected
(Fig. 3B,E). In
Rarb2-Cretg/+; Lim1lz/flox mutants,
Lim1 expression in the pretubular aggregate-derived tissues was not
detected but Lim1 expression in the ureteric bud was intact
(Fig. 3C,F).
When Lim1 was inactivated specifically in nephric duct-derived tissues using Hoxb7-Cre, the Hoxb7-Cretg/+; Lim1lz/flox mutants were viable and could survive to adulthood. However, when Lim1 in metanephric mesenchyme-derived tissues was specifically inactivated by Rarb2-Cre, all of the Rarb2-Cretg/+; Lim1lz/flox mutants died within the first day of birth. All other mice with genotypes including Lim1lz/flox, Hoxb7-Cretg/+, Rarb2-Cretg/+, Hoxb7-Cretg/+; Lim1flox/+ and Rarb2-Cretg/+; Lim1flox/+ were phenotypically identical to wild type.
At birth, the Hoxb7-Cretg/+; Lim1lz/flox
mutant neonates had small metanephroi (Fig.
3H,N). Urine was observed in the bladder (data not shown),
suggesting that the smaller metanephroi were functional. In some
Hoxb7-Cretg/+; Lim1lz/flox mutants (40.0%,
n=15), hydronephrosis and hydroureter were observed
(Fig. 3N), suggesting urine
production but abnormal development of the distal ureter, which results in
obstruction of urinary excretion into the bladder
(Batourina et al., 2002
).
Serial sections of these mice with hydronephrosis and hydroureter revealed
that the distal ureter was closed in both sexes or ended abnormally into the
uterus in some females (data not shown). These nephric duct-specific
Lim1 mutants also had abnormal reproductive tracts. In all
Hoxb7-Cretg/+; Lim1lz/flox mutant males
(n=8), most parts of the male reproductive tract such as the
epididymis and vas deferens were absent, except for some residual tissue
(Fig. 3K). In some
Hoxb7-Cretg/+; Lim1lz/flox mutant females
(57.1%, n=7), uteri were completely or partially absent with residual
uterine tissue discontinuously present
(Fig. 3Q and data not shown).
The posterior uterus was more frequently absent compared with its anterior
region (see Fig. S2 in the supplementary material; data not shown).
|
Requirement of Lim1 for formation and maintenance of the nephric duct
We found that the nephric duct was initially formed normally in
Hoxb7-Cretg/+; Lim1lz/flox mice
(Fig. 4C,F), which allowed
induction of the metanephros by the ureteric bud and subsequent formation of
the ureter (Fig. 3H,N).
However, after formation of the nephric duct, Lim1 expression in the
nephric duct epithelium is inactivated by Hoxb7-Cre from E9.5
(Fig. 2A). The
Lim1lz reporter was used to follow Lim1-null
cells in Hoxb7-Cretg/+; Lim1lz/flox mice. At
E11.5, Lim1-lacZ expression in the nephric duct epithelium was
discontinuous (Fig. 4H,J).
Histological analysis of Hoxb7-Cretg/+;
Lim1lz/flox mice revealed that the epithelial tissues of the
nephric duct were not present where lacZ expression was absent (data
not shown). This degeneration of the nephric duct epithelium results in the
absence of most of the male reproductive tract such as the epididymis and vas
deferens (Fig. 3K,
Fig. 4R; see Fig. S2 in the
supplementary material). The Lim1-lacZ reporter also revealed a loss
of caudal mesonephric tubules, which are derived from the nephric mesenchyme
(Fig. 2H), although the cranial
mesonephros, which is derived from the nephric duct
(Fig. 2G), was present
(Fig. 4J).
|
Lim1 function in ureteric bud epithelium-derived tissues is essential for ureteric bud growth
The metanephros of Hoxb7-Cretg/+;
Lim1lz/flox mice had morphologically normal medulla and
glomeruli (Fig. 5B,F). However,
the metanephroi of Hoxb7-Cretg/+; Lim1lz/flox
mice was hypoplastic with reduced number of glomeruli
(Fig. 3H,N;
Fig. 5B,F; data not shown).
To understand Lim1 function in the nephric duct epithelium derivatives, we examined Lim1-lacZ expression in the metanephros of Hoxb7-Cretg/+; Lim1lz/flox neonates. In neonates, Lim1-lacZ staining continues to show strong expression in the developing nephrons and weak expression in the ureteric bud (Fig. 5I,M). We found that the number of developing nephrons was greatly reduced at birth (Fig. 5J). Furthermore, the distribution of nephron progenitors is disorganized and there are scattered regions lacking nephron progenitors (Fig. 5J). In the metanephros of Hoxb7-Cretg/+; Lim1lz/flox embryos, nephrons are found at every ureteric bud branching tip (Fig. 5R).
By tail somite (ts) stage 6, Lim-lacZ expression revealed that the nephric duct reaches the posterior region of the urogenital system adjacent to the metanephric mesenchyme in both control and Hoxb7-Cretg/+; Lim1lz/flox embryos (Fig. 6A,B), which is consistent with the previous observation of normal formation of the nephric duct in Hoxb7-Cretg/+; Lim1lz/flox embryos initially (Fig. 4F). However, induction of the ureteric bud is delayed in Hoxb7-Cretg/+; Lim1lz/flox embryos (Fig. 6B), although Lim1-lacZ expression is upregulated for ureteric bud induction in the posterior part of the nephric duct (Fig. 6B).
Several molecules have been shown to be required for ureteric bud
development (Carroll and McMahon,
2003
; Lechner and Dressler,
1997
; Pohl et al.,
2000
; Shah et al.,
2004
). Ret is required for formation, growth and
branching of the ureteric bud (Schuchardt
et al., 1994
). It is weakly expressed in the nephric duct and its
expression is upregulated in the ureteric bud tip
(Fig. 6C). However, in
Hoxb7-Cretg/+; Lim1lz/flox embryos, the
upregulation of Ret at the posterior region of the nephric duct was
not as robust as their control littermates
(Fig. 6D). Glial cell
line-derived neurotrophic factor (GDNF) is a ligand for Ret expressed in the
metanephric mesenchyme and is also required for ureteric bud formation, growth
and branching (Moore et al.,
1996
; Pichel et al.,
1996
; Sanchez et al.,
1996
). We found that Gdnf is normally expressed in the
metanephric mesenchyme of Hoxb7-Cretg/+;
Lim1lz/flox embryos at ts9
(Fig. 6G,H). Other molecular
markers for the metanephric mesenchyme, such as Eya1 and
Pax2, were also normally detected in Hoxb7-Cretg/+;
Lim1lz/flox embryos at the same stage
(Fig. 6I,J; data not shown).
Wnt11 is expressed in the tip of the ureteric bud
(Kispert et al., 1996
) and its
function is required for proper ureteric branching interacting with Ret
(Majumdar et al., 2003
). At
ts9, Wnt11 expression is detected in the swollen-shaped tip of the
ureteric bud (Fig. 6E).
Although the pattern of Wnt11 expression appears thinner, its
expression is correctly upregulated in the posterior nephric duct of
Hoxb7-Cretg/+; Lim1lz/flox embryos
(Fig. 6F).
|
|
Lim1 function in metanephric mesenchyme-derived tissue is essential for formation of the nephron, but not induction of nephron precursors
Histological analysis of the metanephroi of Rarb2-Cretg/+;
Lim1lz/flox neonates revealed that the medulla was not
correctly formed and there were no nephron tissues such as glomeruli and their
associated tubules (Fig. 5C,G).
However, Lim1-lacZ expression in the metanephros of
Rarb2-Cretg/+; Lim1lz/flox embryos at E12.5
showed the presence of nephron progenitors
(Fig. 5S).
Although the number of developing pretubular aggregates was slightly reduced in the smaller metanephroi of Rarb2-Cretg/+; Lim1lz/flox mutants, we found that the distribution pattern of the nephron progenitors was normal (Fig. 5K), in contrast to the abnormal pattern found in the metanephroi of Hoxb7-Cretg/+; Lim1lz/flox mice (Fig. 5J). Histological analysis revealed that nephron development is arrested at the stage of the renal vesicle, which are Lim1-lacZ positive (Fig. 5O). Apparently, these Lim1-lacZ positive tissues subsequently degenerate (Fig. 5O, white arrowheads).
It has previously been shown that Wnt4-null mutants also lack
nephrons (Stark et al., 1994
).
Because Lim1 and Wnt4 are co-expressed in the pretubular
aggregate, it has been proposed that these genes may be involved in the same
pathway for nephron development (Sariola,
2002
). Therefore, we examined this possibility by comparing
Rarb2-Cretg/+; Lim1lz/flox mutant mice with
Wnt4-null mice. We found that the metanephroi of Wnt4-null
mice were severely hypoplastic compared with those of
Rarb2-Cretg/+; Lim1lz/flox mutant mice
(Fig. 5C,D). Surprisingly, we
also found that the small metanephroi of Wnt4-null mice can form a
few glomeruli, nephron tubules and medulla-like structures
(Fig. 5D,H), which are
completely absent in Rarb2-Cretg/+; Lim1lz/flox
mutant mice.
|
|
|
Lim1 function is required for renal vesicle patterning
During nephron development, Wnt4, Pax8 and Fgf8
expression are initiated in the pretubular aggregate and persist in the renal
vesicles (Fig. 7A,C; data not
shown) (Stark et al., 1994
).
In the Rarb2-Cretg/+; Lim1lz/flox mutants, the
expression patterns of Wnt4, Pax8 and Fgf8 are correctly
induced and persist in the renal vesicle
(Fig. 7B,D; data not shown).
Dll1 expression is initially expressed very weakly in the renal
vesicle and Dll1 expression is upregulated in a subset of cells in
the renal vesicle during its maturation and persists in the presumptive
proximal tubule of the S-shaped body (Fig.
7E,G; data not shown)
(Leimeister et al., 2003
). In
the Rarb2-Cretg/+; Lim1lz/flox mutants, the
upregulation of Dll1 expression was not observed
(Fig. 7F,H). Expression of
Brn1 (also known as Pou3f3) is initiated in a subset of
cells in the renal vesicle proximal to the ureteric bud and its function is
required for the loop of Henle and distal tubule
(Fig. 7I; data not shown)
(Nakai et al., 2003
). In the
renal vesicles of the Rarb2-Cretg/+;
Lim1lz/flox mutants, the polarized Brn1 expression
was not observed (Fig. 7J).
Expression patterns of a ureteric bud marker Wnt9b
(Fig. 7K,L) and a stroma marker
Bf2 (Fig. 7M,N) did
not change in the Rarb2-Cretg/+; Lim1lz/flox
mutants.
Lim1 acts cell-autonomously in multiple steps during kidney development
To obtain more information about Lim1 function during kidney
development, we performed a chimera analysis
(Tam and Rossant, 2003
). To
generate chimeric mice, we injected Lim1/;
Rosa26tg/+ embryonic stem (ES) cells into wild-type
blastocysts (Shawlot et al.,
1999
). Subsequently, we examined the distribution of
Lim1-null cells by lacZ expression in the chimeric embryos.
In control experiments, Lim1+/+; Rosa26tg/+ ES
cells were injected into wild-type blastocysts. Chimeric kidneys from 57
embryos were analyzed. In control chimeras, Lim1+/+ cells
could extensively contribute to all cell types in the urogenital systems
(Fig. 8A,C,E,G,I,L,O,Q).
We found that Lim1/ cells could not contribute to the epithelium of the nephric duct in chimeric mice at E9.5 (Fig. 8B). By contrast, Lim1/ cells could contribute to the nephric mesenchyme at the same stage (Fig. 8B). In the caudal mesonephros of chimeric mice at the E10.5, Lim1/ cells were excluded from the epithelial renal vesicles of the mesonephros (Fig. 8D). The renal vesicles of the caudal mesonephros are derived from the nephric mesenchyme (Fig. 2H), where Lim1/ cells could contribute one day before at E9.5 (Fig. 8B). At the posterior end of the nephric duct at E10.5, Lim1/ cells could contribute to the metanephric mesenchyme, although Lim1/ cells remained excluded from the ureteric bud, which is derived from the nephric duct epithelium (Fig. 8F). These findings suggest that Lim1 acts cell autonomously for epithelium development of the nephric duct by E9.5 and for renal vesicle formation in the mesonephros between E9.5 and E10.5.
At later stages of development, Lim1/
cells could contribute to the condensed mesenchyme and pretubular aggregate in
the metanephros (Fig. 8H).
Although Lim1/ cells could initially
contribute to the renal vesicle at early stages
(Fig. 8J), Lim1/ cells were not found in the region of
the renal vesicle proximal to the ureteric bud
(Fig. 8K), although
Lim1 is expressed in the entire renal vesicle at this stage (see Fig.
S1 in the supplementary material; data not shown)
(Karavanov et al., 1998
). The
epithelial tissue of the renal vesicle that lacks
Lim1/ cells invaginates to form the cleft of
the comma-shaped body (Fig.
8M,N). Subsequently, Lim1/ cells
were not present in the region opposite to the first cleft of differentiating
comma-shaped bodies (Fig. 8N,
white arrow), which subsequently invaginates to form the second cleft of the
S-shaped body (Fig. 8P).
Lim1/ cells could contribute to the proximal
tip of the S-shaped body (Fig.
8P, dashed box). Subsequently,
Lim1/ cells were not found in a subset of
cells that faces towards the cleft within the proximal tip of the S-shaped
body (Fig. 8R). This small
epithelial tissue where Lim1/ cells could
not contribute expanded extensively and formed podocytes of the glomerulus
(Fig. 8S,T).
Lim1/ cells could contribute to the
glomerular capillaries and outer epithelium layer of Bowman's capsule
(Fig. 8T).
| Discussion |
|---|
|
|
|---|
Hypomorphic phenotypes in BAC transgene-rescued Lim1 mutants
It is likely that the 208 kb BAC clone contains most, if not all,
tissue-specific transcriptional enhancer elements for Lim1
expression. It is currently unclear why none of our BAC transgenes could
completely rescue the defects of Lim1-null mutants. Perhaps
overexpression of Lim1 and/or other genes from the BAC clone during
embryogenesis or after birth is lethal, leading to a pre-selection for lower
expressing transgenic mice. These BAC transgene rescue findings suggest that
Lim1 function is dose sensitive, i.e. higher expression levels of
Lim1 are required for nephron formation.
Nephric duct epithelium- and metanephric mesenchyme fates during kidney organogenesis
Although the Hoxb7-Cre mouse line used in our study was previously
generated for Cre-mediated gene manipulations in the nephric duct and ureteric
bud (Basson et al., 2005
;
Rubera et al., 2003
;
Yu et al., 2002
), there was no
Cre mouse line specifically for the metanephric mesenchyme, but not in the
ureteric bud, from its early stage of development
(Bouchard et al., 2004
;
Ohyama and Groves, 2004
;
Oxburgh et al., 2004
). In this
study, we generated a novel resource for metanephric mesenchyme-specific gene
modifications, the Rarb2-Cre mouse. These two transgenic mouse lines
will serve as basic tools to dissect tissue-specific gene functions in the
ureteric bud or metanephric mesenchyme.
In the metanephros, Rarb2 gene expression is restricted to the
kidney stroma (Batourina et al.,
2001
; Mendelsohn et al.,
1999
). The 4.8 kb Rarb2 sequences that we used to
generate the Rarb2-Cre transgenic mouse line were previously tested
with a lacZ reporter; however, Rarb2-lacZ transgenes did not
direct metanephric mesenchyme-specific expression
(Dolle et al., 1990
;
Mendelsohn et al., 1991
;
Reynolds et al., 1991
;
Shen et al., 1992
). Thus, we
were surprised to find that our Rarb2-Cre transgenic mouse line
directed Cre reporter expression in metanephric mesenchyme and its
derivatives. One possibility is that the Cre reporter assay is more sensitive
than a lacZ transgene. Alternatively, sequences around the site of
Rarb2-Cre transgene integration were either permissive or
fortuitously provided enhancer elements for expression in the metanephric
mesenchyme.
Recombinase reporter systems can be used for cell-lineage analysis and fate
mapping (Lewandoski, 2001
).
Recently, it has been suggested that some glomerular capillary cells may
derive from the metanephric mesenchyme
(Woolf and Loughna, 1998
).
However, there was no definitive cell-lineage analysis for these cell types.
In this study, we found that glomerular capillary cells were Cre reporter
negative in Hoxb7-Cre; R26R and Rarb2-Cre;
R26R mice, suggesting that glomerular capillaries are not derived
from either the ureteric bud or metanephric mesenchyme. Similar observations
were obtained for the medullary stromal cells. We suggest that glomerular
capillary and medullary stromal cells are derived from precursors that arise
outside of the ureteric bud and metanephric mesenchyme and that these
precursor cells migrate into the developing metanephros after E10.5 in the
mouse. Consistent with this idea, it is known that endothelial cells do not
form when ureteric bud and metanephric mesenchyme are isolated from embryos at
E10.5, recombined, and cultured in vitro to form nephrons
(Vainio and Lin, 2002
).
Wolffian duct supports Müllerian duct elongation and maintenance
It is widely believed that the upper region of the vagina derives from the
Müllerian duct and the lower part from the urogenital sinus
(Forsberg, 1973
). However, a
recent study suggests that the entire vagina derives from the Müllerian
duct (Drews et al., 2002
). In
this study, we found that loss of the posterior part of the Müllerian
duct causes the complete loss of the vagina. One explanation is that the
entire vagina derives from the Müllerian duct. Alternatively, the
urogenital sinus may be induced by the Müllerian duct to form the lower
region of the vagina.
During embryogenesis, the Wolffian duct forms first, and subsequently the
Müllerian duct forms adjacent to the Wolffian duct
(Kobayashi and Behringer,
2003
). Experimental interruption of the Wolffian duct in chick
embryos resulted in Müllerian duct growth defects
(Gruenwald, 1941
); however, it
is unclear how the Wolffian duct is required for Müllerian duct
development. Our data suggest that the Wolffian duct is essential for both
elongation and maintenance of the Müllerian duct, but not for
initiation.
Distinct tissue-specific Lim1 functions in kidney development
It has previously been shown that Lim1 is essential for proper
nephric duct formation (Tsang et al.,
2000
). Here, we found that Lim1 function is also required
for maintenance of the nephric duct after its formation. Furthermore, tubule
formation of the caudal mesonephros from the nephric mesenchyme is also
disturbed when Lim1 is inactivated in the nephric duct epithelium.
These data suggest that there are nephric duct-derived inductive molecules for
mesonephric tubule formation from mesonephric mesenchyme.
Using the Hoxb7-Cre and Rarb2-Cre transgenic mouse lines, we could dissect Lim1 functions tissue specifically in the ureteric bud- and metanephric mesenchyme-derived tissues, respectively. Although both tissue-specific mutants have hypoplastic kidneys, Hoxb7-Cre; Lim1 mutants are alive and have metanephroi with all structures but with abnormal ureter development, whereas Rarb2-Cre; Lim1 mutants are lethal at birth and have metanephroi without nephrons but with a proper ureteric branching pattern. These observations also indicate that Lim1 functions within these two tissues may be largely independent during metanephros development. Consistent with this idea, the metanephros of Hoxb7-Cretg/+; Rarb2-Cretg/+; Lim1lz/flox mutants was as small as Hoxb7-Cre; Lim1 mutants and lacked nephrons in the same way as did Rarb2-Cre; Lim1 mutants (A.K., unpublished), indicating that defects of Lim1 mutants in ureteric bud- and metanephric mesenchyme-derived tissues are additive rather than synergistic.
Lim1 in nephric duct-derived tissues for ureteric bud development
Ureteric bud growth and branching is severely perturbed in Ret
mutants (Schuchardt et al.,
1994
), whereas Wnt11 mutants have relatively moderate
defects in ureteric bud development
(Majumdar et al., 2003
). It
has also been shown that Wnt11 and Gdnf/Ret pathways
synergistically interact with each other in ureteric bud development
(Majumdar et al., 2003
). In
Hoxb7-Cre; Lim1 mutants, upregulation of Ret expression was
not observed in the ureteric bud tip, although Wnt11 expression was
normally initiated and maintained. Consistent with these expression patterns,
the metanephros was more hypoplastic and ureteric bud growth is severely
disturbed in Hoxb7-Cre; Lim1 mutants compared with those in
Wnt11 mutants. Thus, Lim1 may act as an upstream regulator
for upregulation of Ret expression in the ureteric bud tips to
regulate ureteric bud growth. Indeed, Lim1 and Ret
expression patterns are similar in the developing ureteric bud with highest
levels at the ureteric bud tips.
Retinoic acid receptor (Rar) genes in the stromal component are required
for Ret expression in the ureteric bud
(Batourina et al., 2001
). It is
unlikely that Lim1 functions through the stroma because Lim1
is required to upregulate Ret at E10.5 before Rar gene expression
initiates in the stromal components around E11. Consistent with this idea,
Bf2-positive stromal components are normally formed in Hoxb7-Cre;
Lim1 mutants at E11.5 (data not shown).
Lim1 function in metanephric mesenchyme-derived tissues for nephron development
The basic unit of the kidney, the nephron, is a long tubule with highly
specialized domains, including the glomerulus, distal and proximal tubules,
and loop of Henle. It is not clear how the complicated tubular structure of
the nephron develops from a simple epithelial sphere, the renal vesicle. Here,
we show that Lim1 is required for the initial step of nephron
patterning, renal vesicle patterning. Our chimera analysis indicates that
successive cell-autonomous Lim1 function is also required for comma-
to S-shape body morphogenesis and podocyte development.
Although Lim1 is homogeneously expressed in the renal vesicle, comma-shaped bodies and Bowman's capsule of immature glomeruli, our chimera analysis revealed that Lim1 function is cell-autonomously required only in specific subregions in these tissues. This may indicate that Lim1 expression establishes a permissive tissue identity that can respond to unidentified regional signals that induce epithelial tissues to undergo morphological changes. Indeed, involution of the renal vesicle to form the comma-shaped body is initiated at the same region relative to the position of the ureteric bud, indicating instructive signals that determine renal vesicle patterning emanate from the ureteric tip or stalk, or the surrounding stroma.
Brn1 is essential for development of the distal tubule and loop of
Henle (Nakai et al., 2003
) and
Notch signaling is required for formation of the proximal tubules, podocytes
and glomerular capillaries (Cheng et al.,
2003
; McCright et al.,
2001
; Wang et al.,
2003
). Expression of these genes is restricted to a subset of
cells in the renal vesicle, but we found that Brn1 and a component in
Notch signaling pathway, Dll1, are not expressed in the renal vesicle
of Rarb2-Cre; Lim1 mutants. These observations indicate that regional
identities already established at the renal vesicle stage are not present in
the absence of Lim1 function and the loss of these cell types may
block further nephrogenesis.
Relationship between Lim1 and Wnt4 in nephron development
Lim1 and Wnt4 are co-expressed in developing nephrons,
leading to the idea that these genes may act in the same pathway for
pretubular aggregate development (Sariola,
2002
). Surprisingly, we found nephrons and developing nephrons in
the hypoplastic kidneys of neonatal and E14.5 Wnt4-null mutants,
respectively. However, at E12.5 no developing nephrons were found in
Wnt4-null mutants. Our observations are somewhat contrary to a
previous report, indicating that Wnt4 is essential for the
mesenchyme-to-epithelial transition during nephron development
(Stark et al., 1994
). This may
be because of genetic background differences between the mice used in the two
studies, indicating genetic modifiers that regulate nephron development in the
absence of Wnt4.
The Wnt4 expression pattern in the pretubular aggregate is broader than the Lim1 expression pattern, which is restricted to the presumptive renal vesicle, and Lim1 expression is not detected in the pretubular aggregate of Wnt4-null mutants at early stages. This indicates that Wnt4 may function at an early stage of pretubular aggregate differentiation before Lim1 expression initiates in this tissue. It is possible that Lim1 and Wnt4 may regulate independent pathways in nephron progenitors. Alternatively, Wnt4 is essential for the normal onset of nephrogenesis acting as an upstream factor for Lim1 expression, but a Wnt4-independent process that upregulates Lim1 can give rise to a limited number of nephrons in Wnt4-null kidneys.
In addition to reduced and delayed nephron development, the growth of the metanephros and development of the ureteric bud is severely retarded in Wnt4 mutants compared with Rarb2-Cretg/+; Lim1lz/flox mutants, in which metanephros growth and ureteric bud branching are relatively normal even when nephrons are completely absent. These data suggest that renal vesicles, which Wnt4-null mutants essentially lack, may transmit promoting signals to regulate kidney growth and ureteric bud development. Alternatively, Wnt4 in the pretubular aggregate itself may also be the promoting signal for ureteric bud development.
Lim1 is a primary genetic factor for amniote kidney organogenesis
The embryonic development of the three successive kidneys of amniotes
recapitulates the evolution of this organ system
(Saxen, 1987
). Whereas there
are many genes with restricted expression patterns in diverse tissues and
stages that regulate one particular aspect of kidney development, there are
very few genes that are expressed in each of the three kidney types
(Vainio and Lin, 2002
). A
small set of transcription factors (Pax2, Pax8 and Lim1) are expressed in
tubule-forming tissues in each of the three kidney types. Mutants for
Lim1 and Pax2 have nephric duct defects that lead to an
absence of mesonephros and metanephros development
(Bouchard et al., 2004
;
Shawlot et al., 1999
;
Torres et al., 1995
;
Tsang et al., 2000
).
Pax8 mutants do not have kidney defects but genetic studies indicate
that Pax2 and Pax8 act redundantly for nephric duct
formation, perhaps upstream of Lim1
(Bouchard et al., 2002
;
Mansouri et al., 1998
). In
addition, overexpression of both XPax-8 and XLim-1 together
in frog embryos leads to embryonic kidney overgrowth and ectopic pronephric
tubules (Carroll and Vize,
1999
). The results presented here and by others suggest that
Lim1 is crucially required in the tubule-forming tissues at multiple
steps of kidney development. Although the precise relationships between
Pax2, Pax8 and Lim1 are complex, it is clear that they are
each used at multiple steps of kidney organogenesis.
The development of the amniote excretory system (pronephros, mesonephros,
and metanephros) suggests that it has evolved by elaborating on a fundamental
developmental process, tubulogenesis. A simple way to evolve such an organ
system would be to use that process repeatedly and exploit a fundamental
genetic program. It would appear that the set of transcription factors
mentioned above serves as a fundamental genetic cassette for tubulogenesis
during kidney development. Interestingly, the mechanism regulated by
Lim1 for nephric duct, Wolffian and Müllerian duct, mesonephric
tubule and ureteric bud formation appear to be similar, i.e. a cell-autonomous
action for maintenance and/or growth of the ductal epithelium. However, this
mechanism appears to be fundamentally different for nephron formation, i.e.
formation of a permissive tissue identity, resulting in regional patterning of
the renal vesicle for subsequent morphogenesis. Thus, it would appear that a
new elaboration of our proposed primary genetic cassette evolved for nephron
formation in the metanephros. This may have been facilitated by the ability of
LIM-class homeodomain proteins to complex with other factors to regulate
transcription (Bach et al.,
1997
).
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/132/12/2809/DC1
| REFERENCES |
|---|
|
|
|---|
Bach, I., Carriere, C., Ostendorff, H. P., Andersen, B. and
Rosenfeld, M. G. (1997). A family of LIM domain-associated
cofactors confer transcriptional synergism between LIM and Otx homeodomain
proteins. Genes Dev. 11,1370
-1380.
Bard, J. B., Gordon, A., Sharp, L. and Sellers, W. I.
(2001). Early nephron formation in the developing mouse kidney.
J. Anat. 199,385
-392.[CrossRef][Medline]
Barnes, J. D., Crosby, J. L., Jones, C. M., Wright, C. V. and
Hogan, B. L. (1994). Embryonic expression of Lim-1, the mouse
homolog of Xenopus Xlim-1, suggests a role in lateral mesoderm
differentiation and neurogenesis. Dev. Biol.
161,168
-178.[CrossRef][Medline]
Basson, M. A., Akbulut, S., Watson-Johnson, J., Simon, R.,
Carroll, T. J., Shakya, R., Gross, I., Martin, G. R., Lufkin, T. and McMahon,
A. P. (2005). Sprouty1 is a critical regulator of
GDNF/RET-mediated kidney induction. Dev. Cell
8, 229-239.[CrossRef][Medline]
Batourina, E., Gim, S., Bello, N., Shy, M., Clagett-Dame, M.,
Srinivas, S., Costantini, F. and Mendelsohn, C. (2001).
Vitamin A controls epithelial/mesenchymal interactions through Ret expression.
Nat. Genet. 27,74
-78.[Medline]
Batourina, E., Choi, C., Paragas, N., Bello, N., Hensle, T.,
Costantini, F. D., Schuchardt, A., Bacallao, R. L. and Mendelsohn, C. L.
(2002). Distal ureter morphogenesis depends on epithelial cell
remodeling mediated by vitamin A and Ret. Nat. Genet.
32,109
-115.[CrossRef][Medline]
Bouchard, M., Souabni, A., Mandler, M., Neubuser, A. and
Busslinger, M. (2002). Nephric lineage specification by Pax2
and Pax8. Genes Dev. 16,2958
-2970.
Bouchard, M., Souabni, A. and Busslinger, M.
(2004). Tissue-specific expression of cre recombinase from the
Pax8 locus. Genesis 38,105
-109.[CrossRef][Medline]
Carroll, T. J. and Vize, P. D. (1999).
Synergism between Pax-8 and lim-1 in embryonic kidney development.
Dev. Biol. 214,46
-59.[CrossRef][Medline]
Carroll, T. J. and McMahon, A. P. (2003).
Overview: the molecular basis of kidney development. In The
kidney (ed. P. D. Vize, A. S. Woolf and J. B. L. Bard), pp.343
-376. London: Academic Press.
Cheng, H. T., Miner, J. H., Lin, M., Tansey, M. G., Roth, K. and
Kopan, R. (2003). Gamma-secretase activity is dispensable for
mesenchyme-to-epithelium transition but required for podocyte and proximal
tubule formation in developing mouse kidney.
Development 130,5031
-5042.
Davies, J. (2001). Intracellular and
extracellular regulation of ureteric bud morphogenesis. J.
Anat. 198,257
-264.[CrossRef][Medline]
Davies, J. A. and Davey, M. G. (1999).
Collecting duct morphogenesis. Pediatr. Nephrol.
13,535
-541.[CrossRef][Medline]
Dolle, P., Ruberte, E., Leroy, P., Morriss-Kay, G. and Chambon,
P. (1990). Retinoic acid receptors and cellular retinoid
binding proteins. I. A systematic study of their differential pattern of
transcription during mouse organogenesis. Development
110,1133
-1151.
Dressler, G. (2002). Tubulogenesis in the
developing mammalian kidney. Trends Cell Biol.
12,390
-395.[CrossRef][Medline]
Drews, U., Sulak, O. and Schenck, P. A. (2002).
Androgens and the development of the vagina. Biol.
Reprod. 67,1353
-1359.
Forsberg, J. G. (1973). Cervicovaginal
epithelium: its origin and development. Am. J. Obstet.
Gynecol. 115,1025
-1043.[Medline]
Fujii, T., Pichel, J. G., Taira, M., Toyama, R., Dawid, I. B.
and Westphal, H. (1994). Expression patterns of the murine
LIM class homeobox gene lim1 in the developing brain and excretory
system. Dev. Dyn. 199,73
-83.[Medline]
Grobstein, C. (1953). Inductive
epitheliomesenchymal interaction in cultured organ rudiments of the mouse.
Science 118,52
-55.
Grobstein, C. (1956). Trans-filter induction of
tubules in mouse metanephrogenic mesenchyme. Exp. Cell
Res. 10,424
-440.[CrossRef][Medline]
Gruenwald, P. (1941). The relation of the
growing Mullerian duct to the Wolffian duct and its importance for the genesis
of malformations. Anat. Rec.
81, 1-19.[CrossRef]
Hatini, V., Huh, S. O., Herzlinger, D., Soares, V. C. and Lai,
E. (1996). Essential role of stromal mesenchyme in kidney
morphogenesis revealed by targeted disruption of Winged Helix transcription
factor BF-2. Genes Dev.
10,1467
-1478.
Hogan, B. L. and Kolodziej, P. A. (2002).
Organogenesis: molecular mechanisms of tubulogenesis. Nat. Rev.
Genet. 3,513
-523.[CrossRef][Medline]
Kania, A., Johnson, R. L. and Jessell, T. M.
(2000). Coordinate roles for LIM homeobox genes in directing the
dorsoventral trajectory of motor axons in the vertebrate limb.
Cell 102,161
-173.[CrossRef][Medline]
Karavanov, A. A., Karavanova, I., Perantoni, A. and Dawid, I.
B. (1998). Expression pattern of the rat Lim-1 homeobox gene
suggests a dual role during kidney development. Int. J. Dev.
Biol. 42,61
-66.[Medline]
Kispert, A., Vainio, S., Shen, L., Rowitch, D. H. and McMahon,
A. P. (1996). Proteoglycans are required for maintenance of
Wnt-11 expression in the ureter tips. Development
122,3627
-3637.[Abstract]
Kobayashi, A. and Behringer, R. R. (2003).
Developmental genetics of the female reproductive tract in mammals.
Nat. Rev. Genet. 4,969
-980.[CrossRef][Medline]
Kobayashi, A., Shawlot, W., Kania, A. and Behringer, R. R.
(2004). Requirement of Lim1 for female reproductive tract
development. Development
131,539
-549.
Kume, T., Deng, K. and Hogan, B. L. (2000).
Murine forkhead/winged helix genes Foxc1 (Mf1) and Foxc2 (Mfh1) are required
for the early organogenesis of the kidney and urinary tract.
Development 127,1387
-1395.[Abstract]
Kuure, S., Vuolteenaho, R. and Vainio, S.
(2000). Kidney morphogenesis: cellular and molecular regulation.
Mech. Dev. 92,31
-45.[CrossRef][Medline]
Kwan, K. M. (2002). Conditional alleles in
mice: practical considerations for tissue-specific knockouts.
Genesis 32,49
-62.[CrossRef][Medline]
Kwan, K. M. and Behringer, R. R. (2002).
Conditional inactivation of Lim1 function. Genesis
32,118
-120.[CrossRef][Medline]
Lechner, M. S. and Dressler, G. R. (1997). The
molecular basis of embryonic kidney development. Mech.
Dev. 62,105
-120.[CrossRef][Medline]
Leimeister, C., Schumacher, N. and Gessler, M.
(2003). Expression of Notch pathway genes in the embryonic mouse
metanephros suggests a role in proximal tubule development. Gene
Expr. Patterns 3,595
-598.[CrossRef][Medline]
Lewandoski, M. (2001). Conditional control of
gene expression in the mouse. Nat. Rev. Genet
2, 743-755.[CrossRef][Medline]
Lubarsky, B. and Krasnow, M. A. (2003). Tube
morphogenesis: making and shaping biological tubes.
Cell 112,19
-28.[CrossRef][Medline]
Majumdar, A., Vainio, S., Kispert, A., McMahon, J. and McMahon,
A. P. (2003). Wnt11 and Ret/Gdnf pathways cooperate in
regulating ureteric branching during metanephric kidney development.
Development 130,3175
-3185.
Mansouri, A., Chowdhury, K. and Gruss, P.
(1998). Follicular cells of the thyroid gland require Pax8 gene
function. Nat. Genet.
19, 87-90.[CrossRef][Medline]
McCright, B., Gao, X., Shen, L., Lozier, J., Lan, Y., Maguire,
M., Herzlinger, D., Weinmaster, G., Jiang, R. and Gridley, T.
(2001). Defects in development of the kidney, heart and eye
vasculature in mice homozygous for a hypomorphic Notch2 mutation.
Development 128,491
-502.[Abstract]
Mendelsohn, C., Ruberte, E., LeMeur, M., Morriss-Kay, G. and
Chambon, P. (1991). Developmental analysis of the retinoic
acid-inducible RAR-beta 2 promoter in transgenic animals.
Development 113,723
-734.[Abstract]
Mendelsohn, C., Batourina, E., Fung, S., Gilbert, T. and Dodd,
J. (1999). Stromal cells mediate retinoid-dependent functions
essential for renal development. Development
126,1139
-1148.[Abstract]
Miyamoto, N., Yoshida, M., Kuratani, S., Matsuo, I. and Aizawa,
S. (1997). Defects of urogenital development in mice lacking
Emx2. Development 124,1653
-1664.[Abstract]
Moore, M. W., Klein, R. D., Farinas, I., Sauer, H., Armanini,
M., Phillips, H., Reichardt, L. F., Ryan, A. M., Carver-Moore, K. and
Rosenthal, A. (1996). Renal and neuronal abnormalities in
mice lacking GDNF. Nature
382, 76-79.[CrossRef][Medline]
Nagy, A. (2000). Cre recombinase: the universal
reagent for genome tailoring. Genesis
26, 99-109.[CrossRef][Medline]
Nagy, A., Gertsenstein, M., Vintersten, K. and Behringer, R.
R. (2003). Manipulating the Mouse Embryo: A
Laboratory Manual. Cold Spring Harbor: Cold Spring Harbor
Laboratory Press.
Nakai, S., Sugitani, Y., Sato, H., Ito, S., Miura, Y., Ogawa,
M., Nishi, M., Jishage, K., Minowa, O. and Noda, T. (2003).
Crucial roles of Brn1 in distal tubule formation and function in mouse kidney.
Development 130,4751
-4759.
Obara-Ishihara, T., Kuhlman, J., Niswander, L. and Herzlinger,
D. (1999). The surface ectoderm is essential for nephric duct
formation in intermediate mesoderm. Development
126,1103
-1108.[Abstract]
Ohyama, T. and Groves, A. K. (2004). Generation
of Pax2-Cre mice by modification of a Pax2 bacterial artificial chromosome.
Genesis 38,195
-199.[CrossRef][Medline]
Oxburgh, L., Chu, G. C., Michael, S. K. and Robertson, E. J.
(2004). TGFbeta superfamily signals are required for
morphogenesis of the kidney mesenchyme progenitor population.
Development 131,4593
-4605.
Pichel, J. G., Shen, L., Sheng, H. Z., Granholm, A. C., Drago,
J., Grinberg, A., Lee, E. J., Huang, S. P., Saarma, M., Hoffer, B. J. et
al. (1996). Defects in enteric innervation and kidney
development in mice lacking GDNF. Nature
382, 73-76.[CrossRef][Medline]
Pohl, M., Stuart, R. O., Sakurai, H. and Nigam, S. K.
(2000). Branching morphogenesis during kidney development.
Annu. Rev. Physiol. 62,595
-620.[CrossRef][Medline]
Reynolds, K., Mezey, E. and Zimmer, A. (1991).
Activity of the beta-retinoic acid receptor promoter in transgenic mice.
Mech. Dev. 36,15
-29.[CrossRef][Medline]
Rubera, I., Loffing, J., Palmer, L. G., Frindt, G.,
Fowler-Jaeger, N., Sauter, D., Carroll, T., McMahon, A., Hummler, E. and
Rossier, B. C. (2003). Collecting duct-specific gene
inactivation of alphaENaC in the mouse kidney does not impair sodium and
potassium balance. J. Clin. Invest.
112,554
-565.[CrossRef][Medline]
Sainio, K. and Raatikainen-Ahokas, A. (1999).
Mesonephric kidney a stem cell factory? Int. J. Dev.
Biol. 43,435
-439.[Medline]
Sainio, K., Hellstedt, P., Kreidberg, J. A., Saxen, L. and
Sariola, H. (1997). Differential regulation of two sets of
mesonephric tubules by WT-1. Development
124,1293
-1299.[Abstract]
Sanchez, M. P., Silos-Santiago, I., Frisen, J., He, B., Lira, S.
A. and Barbacid, M. (1996). Renal agenesis and the absence of
enteric neurons in mice lacking GDNF. Nature
382, 70-73.[CrossRef][Medline]
Sariola, H. (2002). Nephron induction
revisited: from caps to condensates. Curr. Opin. Nephrol.
Hypertens. 11,17
-21.[CrossRef][Medline]
Sauer, B. and Henderson, N. (1990). Targeted
insertion of exogenous DNA into the eukaryotic genome by the Cre recombinase.
New Biol. 2,441
-449.[Medline]
Saxen, L. (1987). Organogenesis of
the Kidney. New York: Cambridge University Press.
Schuchardt, A., D'Agati, V., Larsson-Blomberg, L., Costantini,
F. and Pachnis, V. (1994). Defects in the kidney and enteric
nervous system of mice lacking the tyrosine kinase receptor Ret.
Nature 367,380
-383.[CrossRef][Medline]
Shah, M. M., Sampogna, R. V., Sakurai, H., Bush, K. T. and
Nigam, S. K. (2004). Branching morphogenesis and kidney
disease. Development
131,1449
-1462.
Shawlot, W. and Behringer, R. R. (1995).
Requirement for Lim1 in head-organizer function.
Nature 374,425
-430.[CrossRef][Medline]
Shawlot, W., Wakamiya, M., Kwan, K. M., Kania, A., Jessell, T.
M. and Behringer, R. R. (1999). Lim1 is required in both
primitive streak-derived tissues and visceral endoderm for head formation in
the mouse. Development
126,4925
-4932.[Abstract]
Shen, S., van den Brink, C. E., Kruijer, W. and van der Saag, P.
T. (1992). Embryonic stem cells stably transfected with mRAR
beta 2-lacZ exhibit specific expression in chimeric embryos. Int.
J. Dev. Biol. 36,465
-476.[Medline]
Soriano, P. (1999). Generalized lacZ expression
with the ROSA26 Cre reporter strain. Nat. Genet.
21, 70-71.[CrossRef][Medline]
Stark, K., Vainio, S., Vassileva, G. and McMahon, A. P.
(1994). Epithelial transformation of metanephric mesenchyme in
the developing kidney regulated by Wnt-4. Nature
372,679
-683.[CrossRef][Medline]
Tam, P. P. and Rossant, J. (2003). Mouse
embryonic chimeras: tools for studying mammalian development.
Development 130,6155
-6163.
Torres, M., Gomez-Pardo, E., Dressler, G. R. and Gruss, P.
(1995). Pax-2 controls multiple steps of urogenital development.
Development 121,4057
-4065.[Abstract]
Tsang, T. E., Shawlot, W., Kinder, S. J., Kobayashi, A., Kwan,
K. M., Schughart, K., Kania, A., Jessell, T. M., Behringer, R. R. and Tam, P.
P. (2000). Lim1 activity is required for intermediate
mesoderm differentiation in the mouse embryo. Dev.
Biol. 223,77
-90.[CrossRef][Medline]
Vainio, S. and Lin, Y. (2002). Coordinating
early kidney development: lessons from gene targeting. Nat. Rev.
Genet. 3,533
-543.[CrossRef][Medline]
Wang, P., Pereira, F. A., Beasley, D. and Zheng, H.
(2003). Presenilins are required for the formation of comma- and
S-shaped bodies during nephrogenesis. Development
130,5019
-5029.
Woolf, A. S. and Loughna, S. (1998). Origin of
glomerular capillaries: is the verdict in? Exp.
Nephrol. 6,17
-21.[CrossRef][Medline]
Yu, J., Carroll, T. J. and McMahon, A. P.
(2002). Sonic hedgehog regulates proliferation and
differentiation of mesenchymal cells in the mouse metanephric kidney.
Development 129,5301
-5312.
Related articles in Development:
This article has been cited by other articles:
![]() |
X. Zhang, G. Mernaugh, D.-H. Yang, L. Gewin, M. B. Srichai, R. C. Harris, J. M. Iturregui, R. D. Nelson, D. E. Kohan, D. Abrahamson, et al. {beta}1 integrin is necessary for ureteric bud branching morphogenesis and maintenance of collecting duct structural integrity Development, October 1, 2009; 136(19): 3357 - 3366. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Raile, E. Klopocki, M. Holder, T. Wessel, A. Galler, D. Deiss, D. Muller, T. Riebel, D. Horn, M. Maringa, et al. Expanded Clinical Spectrum in Hepatocyte Nuclear Factor 1B-Maturity-Onset Diabetes of the Young J. Clin. Endocrinol. Metab., July 1, 2009; 94(7): 2658 - 2664. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Yu, T. J. Carroll, J. Rajagopal, A. Kobayashi, Q. Ren, and A. P. McMahon A Wnt7b-dependent pathway regulates the orientation of epithelial cell division and establishes the cortico-medullary axis of the mammalian kidney Development, January 1, 2009; 136(1): 161 - 171. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. El-Dahr, K. Aboudehen, and Z. Saifudeen Transcriptional control of terminal nephron differentiation Am J Physiol Renal Physiol, June 1, 2008; 294(6): F1273 - F1278. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Poche, K. M. Kwan, M. A. Raven, Y. Furuta, B. E. Reese, and R. R. Behringer Lim1 Is Essential for the Correct Laminar Positioning of Retinal Horizontal Cells J. Neurosci., December 19, 2007; 27(51): 14099 - 14107. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Viana, E. Batourina, H. Huang, G. R. Dressler, A. Kobayashi, R. R. Behringer, E. Shapiro, T. Hensle, S. Lambert, and C. Mendelsohn The development of the bladder trigone, the center of the anti-reflux mechanism Development, October 15, 2007; 134(20): 3763 - 3769. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Reggiani, D. Raciti, R. Airik, A. Kispert, and A. W. Brandli The prepattern transcription factor Irx3 directs nephron segment identity Genes & Dev., September 15, 2007; 21(18): 2358 - 2370. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Schmidt-Ott, T. N. H. Masckauchan, X. Chen, B. J. Hirsh, A. Sarkar, J. Yang, N. Paragas, V. A. Wallace, D. Dufort, P. Pavlidis, et al. {beta}-catenin/TCF/Lef controls a differentiation-associated transcriptional program in renal epithelial progenitors Development, September 1, 2007; 134(17): 3177 - 3190. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhao, K.-M. Kwan, C. M. Mailloux, W.-K. Lee, A. Grinberg, W. Wurst, R. R. Behringer, and H. Westphal LIM-homeodomain proteins Lhx1 and Lhx5, and their cofactor Ldb1, control Purkinje cell differentiation in the developing cerebellum PNAS, August 7, 2007; 104(32): 13182 - 13186. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Kopan, H.-T. Cheng, and K. Surendran Molecular Insights into Segmentation along the Proximal Distal Axis of the Nephron J. Am. Soc. Nephrol., July 1, 2007; 18(7): 2014 - 2020. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-S. Park, M. T. Valerius, and A. P. McMahon Wnt/{beta}-catenin signaling regulates nephron induction during mouse kidney development Development, July 1, 2007; 134(13): 2533 - 2539. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Iizuka-Kogo, T. Ishidao, T. Akiyama, and T. Senda Abnormal development of urogenital organs in Dlgh1-deficient mice Development, May 1, 2007; 134(9): 1799 - 1807. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Narlis, D. Grote, Y. Gaitan, S. K. Boualia, and M. Bouchard Pax2 and Pax8 Regulate Branching Morphogenesis and Nephron Differentiation in the Developing Kidney J. Am. Soc. Nephrol., April 1, 2007; 18(4): 1121 - 1129. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kuure, A. Popsueva, M. Jakobson, K. Sainio, and H. Sariola Glycogen Synthase Kinase-3 Inactivation and Stabilization of beta-Catenin Induce Nephron Differentiation in Isolated Mouse and Rat Kidney Mesenchymes J. Am. Soc. Nephrol., April 1, 2007; 18(4): 1130 - 1139. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-T. Cheng, M. Kim, M. T. Valerius, K. Surendran, K. Schuster-Gossler, A. Gossler, A. P. McMahon, and R. Kopan Notch2, but not Notch1, is required for proximal fate acquisition in the mammalian nephron Development, February 15, 2007; 134(4): 801 - 811. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Pillai, A. Mansouri, R. Behringer, H. Westphal, and M. Goulding Lhx1 and Lhx5 maintain the inhibitory-neurotransmitter status of interneurons in the dorsal spinal cord Development, January 15, 2007; 134(2): 357 - 366. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Wilhelm, S. Palmer, and P. Koopman Sex Determination and Gonadal Development in Mammals Physiol Rev, January 1, 2007; 87(1): 1 - 28. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. G. James, C. N. Kamei, Q. Wang, R. Jiang, and T. M. Schultheiss Odd-skipped related 1 is required for development of the metanephric kidney and regulates formation and differentiation of kidney precursor cells Development, August 1, 2006; 133(15): 2995 - 3004. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Boyle and M. de Caestecker Role of transcriptional networks in coordinating early events during kidney development Am J Physiol Renal Physiol, July 1, 2006; 291(1): F1 - F8. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. O. Perantoni, O. Timofeeva, F. Naillat, C. Richman, S. Pajni-Underwood, C. Wilson, S. Vainio, L. F. Dove, and M. Lewandoski Inactivation of FGF8 in early mesoderm reveals an essential role in kidney development Development, September 1, 2005; 132(17): 3859 - 3871. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Grieshammer, C. Cebrian, R. Ilagan, E. Meyers, D. Herzlinger, and G. R. Martin FGF8 is required for cell survival at distinct stages of nephrogenesis and for regulation of gene expression in nascent nephrons Development, September 1, 2005; 132(17): 3847 - 3857. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||