|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online June 1, 2005
doi: 10.1242/10.1242/dev.01872

Hubrecht Laboratory, Netherlands Institute for Developmental Biology, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands
Author for correspondence (e-mail:
tony{at}niob.knaw.nl)
Accepted 19 April 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Hox, PG1, Xenopus, Hindbrain, Neural crest
| Introduction |
|---|
|
|
|---|
Often however, the removal of the function of one particular Hox gene, or
even one complete cluster, does not have dramatic consequences for the embryo
(Spitz et al., 2001
;
Suemori and Noguchi, 2000
).
This, together with the observation that paralogous genes often have similar
functions as well as similar expression domains, points to the possibility of
functional redundancy between genes from the same paralogous group (PG). This
indeed appears to be the case. The loss of function of complete paralogous
groups have been shown to be more severe than knockouts of single Hox genes in
both zebrafish [PG2 (Hunter and Prince,
2002
)] and mouse [PG8 (van den
Akker et al., 2001
)]. Thus the knockdown of a single Hox gene may
not reveal its complete function, and entire paralogous groups may need to be
abrogated before their shared role can be illuminated.
Here we investigate the function of the PG1 genes, which are the homologues
of the Drosophila labial gene. These are the earliest of the Hox
genes, with expression starting during gastrulation, and they eventually have
their anterior boundary in the hindbrain at the level of rhombomeres (r) 3/4
in most vertebrates (Frohman et al.,
1990
; Frohman and Martin,
1992
; Godsave et al.,
1994
; Kolm and Sive,
1995
; Murphy and Hill,
1991
; Sundin et al.,
1990
; Wilkinson et al.,
1989
). Hoxa1 is also expressed at a later stage in the
fore/midbrain (McClintock et al.,
2002
; Shih et al.,
2001
).
Knockout studies in mouse have concentrated on the Hoxa1 and
-b1 genes, and have implicated these genes in hindbrain and
craniofacial development. In the Hoxa1 null mutant, r5 is either
absent or severely reduced, r4 is reduced and there are defects in the
hindbrain and associated nerves in the region between r3 and r8
(Carpenter et al., 1993
;
Chisaka et al., 1992
;
Dolle et al., 1993
;
Lufkin et al., 1991
;
Mark et al., 1993
). In the
Hoxb1 knockout the identity of r4 is altered, but segmentation is not
affected (Goddard et al.,
1996
; Studer et al.,
1996
). When both Hoxa1 and Hoxb1 are deleted, a
more severe phenotype is observed than in either of the single knockouts, with
both r4 and r5 being mis-specified
(Gavalas et al., 1998
;
Studer et al., 1998
) and
eventually deleted (Rossel and Capecchi,
1999
) as well as the 2nd pharyngeal arch and its derived tissues
being lost. In zebrafish, knockdown of the Hoxb1b gene (thought to be
the functional equivalent of the mouse Hoxa1 gene) leads to
disruption of r4 and Hoxb1a, like mouse Hoxb1, is involved
in the specification of nerves originating in r4. The double knockdown of
Hoxb1b and Hoxb1a also implies some degree of functional
redundancy between these genes. However, the phenotype of the double knockdown
is not as severe as that observed in mouse, with r4 and r5 always present,
albeit reduced (McClintock et al.,
2002
).
Despite the intense interest in these anterior Hox genes, a complete knockdown of all PG1 genes has not yet been performed. Therefore any function that is shared between all of the genes may still be hidden. To address this question we knocked down all the Xenopus laevis Hox PG1 genes. In Xenopus, the early expression of the three PG1 genes (Hoxa1, Hoxb1 and Hoxd1) is highly overlapping and they are all expressed in the presumptive hindbrain region. Here we use the morpholino (MO) knockdown technique to demonstrate that the complete loss of PG1 gene function has deeper implications for the development of the embryo than the loss of the individual genes.
| Materials and methods |
|---|
|
|
|---|
Cloning of the Xenopus Hoxd1 morpholino insensitive construct
The complete open reading frame of Xenopus Hoxd1
(Sive and Cheng, 1991
) was
amplified using primers incorporating BamHI and XhoI
restriction sites (for:
5'CCGGGATCCGCCGCCACCATGAATTCCTACCTAGAATACACTTCTTGCGGG; rev:
5'TGCACTCGAGCTAGGGTGAAGCGTCCTTGGATGGCG). After ligation of
the PCR product into the pGEM-T Easy vector (Promega), Hoxd1 was
excised by BamHI/XhoI digestion, ligated into the CS2+
vector (Turner and Weintraub,
1994
), and checked by sequencing.
Injection of morpholinos and mRNA
Two morpholinos were designed for each Hox PG1 gene (Gene-Tools Inc.) The
pseudo-tetraploidy of Xenopus laevis was taken into consideration and
the morpholinos were all designed to be effective against both alleles present
- determined by 5' RACE analysis for Hoxd1 and comparison with
available EST data for Hoxa1 and Hoxb1. Sequence of
morpholinos is as follows: Hoxa1,
MO1-5'CTCATCCTCCTCGCATAGTCCATCT, MO2-5'CTCGCATAGTCCATCTATCACTAGG;
Hoxb1, MO1-5'AGGAACTCATTCTGCTATTGTCCAT,
MO2-5'ATCTGCCAGTGATGGAGGAGGGTCA; Hoxd1,
MO1-5'AGGAACCTGCTGATCCCTCAATCTT, MO2-5'TAGGTAGGAATTCATCTCTAGGGAG.
Morpholinos and mRNAs were diluted in Gurdon's buffer (15 mM Tris pH 7.5, 88
mM NaCl, 1 mM KCl) and injected at the four-cell stage into both left
blastomeres with GFP mRNA co-injected as a lineage tracer. Before
fixation the GFP was checked to ensure that the injections were on the correct
side. Amounts injected ranged from 5 ng to 30 ng of PG1 morpholinos and 7.5 ng
to 60 ng of control morpholino. Whenever a comparison was made between single,
double or triple MO injections the total amount of MO was equalised by adding
control morpholino. Several combinations of the 1st and 2nd MOs were analysed
with the Krox20 and Engrailed-2 probes and gave the same
result. In all experiments control morpholino (standard control, Gene-Tools
Inc.) was also injected and the embryos included in subsequent analyses, but
this never gave different results from the non-injected controls. CS2+GFP (25
pg) and CS2+xHoxd1 (100 pg) were linearised with NotI and transcribed
with Sp6 polymerase.
Detection of gene expression by in situ hybridisation
The whole mount in situ hybridisation protocol used was described
previously (Wacker et al.,
2004b
), as modified from a previous protocol
(Harland, 1991
). Antisense,
digoxigenin-labelled probes were: Hoxd1
(Sive and Cheng, 1991
);
Hoxa1, Hoxb1, Hoxc6, Hoxb9
(Wacker et al., 2004a
);
Krox20 (Bradley et al.,
1993
); Engrailed-2
(Hemmati-Brivanlou et al.,
1991
); Nrp1 (Richter
et al., 1990
); Gbx2
(von Bubnoff et al., 1996
);
Xslug (Mayor et al.,
1995
); Xsnail (Mayor
et al., 1993
); dll4
(Papalopulu and Kintner,
1993
); Otx2 (Pannese
et al., 1995
); Hoxa2
(Pasqualetti et al., 2000
);
Myod (Hopwood et al.,
1989
); EST clones from the I.M.A.G.E. Consortium [LLNL] cDNA
library (Lennon et al., 1996
),
Hoxa3 (IMAGE4405749), or the NIBB library, Hoxd3 (XL012i13);
Hoxd4 (XL094l20); Hoxa5 (XL045g13).
Neural antibody analysis and cartilage staining
After bleaching (80% methanol, 6% H2O2, 15 mM NaOH),
stage 46 embryos were washed (4 x30 minutes PBS+0.2% Tween), blocked (30
minutes PBS+ 0.2% Tween, 3% BSA) and incubated overnight at 4°C with the
neural antibody 2G9 (Jones and Woodland,
1989
). The embryos were then washed and incubated overnight at
4°C with a secondary antibody conjugated to the Cy5 fluorophore. After
washing, the embryos were dehydrated and fixed step-wise in methanol (25%,
50%, 75%, 100%). Before analysis embryos were cleared in Murrays and the
hindbrain was visualised using scanning confocal microscopy (Leica TCS-NT). To
visualize the cartilage, stage 49 embryos were fixed and stained with Alcian
Blue (Pasqualetti et al.,
2000
).
| Results |
|---|
|
|
|---|
Knockdown of individual Hox PG1 genes leads to defects in rhombomere 4 formation
To analyse the role of the Hox PG1 genes we used the morpholino knockdown
approach. Two morpholinos were designed for each PG1 gene and the effect on
hindbrain patterning was investigated. To have an internal control, injections
were performed at the four-cell stage into the left-hand side (lhs) of the
embryo only (Fig. 2). For all
three genes, both morpholinos gave the same phenotype, albeit at different
concentrations (within a range of 10-30 ng), confirming the specificity of
these morpholinos. The knockdown of each of the PG1 genes led to a defect in
hindbrain patterning. For all three of them, r3 and r5 (shown by
Krox20 expression) were closer together on the injected side,
indicating the reduction of r4, with the greatest reduction seen with the
Hoxa1 morpholinos (Fig.
2B,C). The expression domain of Engrailed-2 however, a
marker of the midbrain-hindbrain boundary
(Hemmati-Brivanlou et al.,
1991
), was generally unaffected, although the width of this stripe
often appeared to be smaller on the injected side.
For Hoxa1 and Hoxb1 this reflects the phenotypes observed
in zebrafish and mice (Carpenter et al.,
1993
; Goddard et al.,
1996
; McClintock et al.,
2002
), but there is less information on the Hoxd1 loss
function phenotype. Therefore we decided to further check the specificity of
the Hoxd1 morpholino. To this end we tried to rescue the hindbrain
phenotype with a Xenopus Hoxd1 mRNA construct which lacks the
5' UTR and therefore is not recognised by any of the morpholinos.
Co-injection (in the lhs) of Hoxd1 mRNA rescued the Hoxd1
morpholino phenotype, as shown by Krox20 expression
(Fig. 2K,L). Rhombomeres 3 and
4 were restored and in some cases were even larger than on the control side,
as also seen in the simple Hoxd1 overexpression phenotype
(Fig. 2J). This demonstrates
that the Hoxd1 morpholino is specific and that in Xenopus laevis,
Hoxd1 has a role in hindbrain patterning.
|
We attempted to rescue this phenotype with the morpholino insensitive xHoxd1 expression construct (Fig. 4). When this was co-injected with the triple MO combination the majority of embryos changed from having no Krox20 expression, or only one faint narrow stripe, to having two stripes or one broad stripe spanning the r3-r5 region (Fig. 4E-G). This indicates that xHoxd1 can partially rescue the triple knockdown phenotype and bring back some degree of patterning to the r3-r5 region of the hindbrain. We also attempted to rescue the phenotype with Hoxa1 and Hoxb1 constructs, but as the overexpression of these genes leads to a loss of the r3 Krox20 stripe, interpretation of the rescue was difficult.
|
Hox PG1 gene function is necessary for correct hindbrain patterning and segmentation
To further analyse the effect on hindbrain patterning of losing all PG1
function we carried out a detailed marker analysis of embryos injected with
all three PG1 morpholinos (Fig.
5). It is clear that although hindbrain patterning is severely
affected, as shown by the loss of Krox20 stripes
(Fig. 5G,H), the cells still
adopt a neural fate, as the pan neural marker, Nrp1
(Richter et al., 1990
), is
unaffected (Fig. 5A,B). In
addition the most anterior domain of the embryo, expressing Otx2
(Pannese et al., 1995
) is not
altered (Fig. 5C,D), and
neither is the midbrain/hindbrain boundary, as shown by Engrailed-2
expression (Fig. 3C). However,
as we move posteriorly along the axis, a transformation of posterior hindbrain
into anterior hindbrain becomes apparent. This is shown by the expansion of
Gbx2. This gene has a stripe of expression at the boundary between
the midbrain and hindbrain and in r1 (von
Bubnoff et al., 1996
), and on the side of the embryo injected with
the PG1 morpholinos this stripe is expanded posteriorly
(Fig. 5E,F). This posterior
expansion was only partially rescued by co-injection of the Hoxd1
mRNA (75% phenotype, reduced to 58%), indicating that at least one of the
other Hox PG1 genes may be necessary for the restriction of Gbx2
expression. More posterior hindbrain markers, such as Krox20 and
certain Hox genes (see following section), are either severely reduced or lost
completely with the triple MO combination. Later analysis of the hindbrain
using a neural specific antibody (Jones
and Woodland, 1989
) and confocal imaging indicated that not only
was the patterning of the hindbrain affected, but also its morphology. In the
triple MO injected side there were no clear rhombomere boundaries and the
hindbrain appeared to be shorter and thinner compared with the control side
(Fig. 5I,J). The midbrain also
looked slightly affected but this could be a secondary effect due to the
shortened hindbrain. Thus PG1 function is necessary for the correct
segmentation of the hindbrain, as well as being involved in its
patterning.
|
|
When the other Hox genes were analysed it became apparent that the function
of the PG1 genes is necessary for the establishment of the `Hox code'. Both
PG2 genes, Hoxa2 and Hoxb2, normally expressed up to the
anterior boundary of r2 and r3, respectively
(Pasqualetti et al., 2000
)
were almost completely absent (shown for Hoxa2,
Fig. 6C,D). For PG3 the effect
was less uniform; Hoxa3 and b3 [expressed up to the r4/r5
boundary and in the neural crest derived cells of the 3rd pharyngeal arch
(Godsave et al., 1994
)] were
severely reduced, with only the most posterior expression remaining (shown for
Hoxa3, Fig. 6E,F). The
effect on Hoxd3 was less severe; its lateral stripe of expression was
lost and its hindbrain and neural tube expression was fainter and shifted
posteriorly, but slightly expanded laterally
(Fig. 6G,H). This could be due
to the inability of the neural crest to migrate (see following section) and
thus the faint, expanded domain could be expression in the premigratory neural
crest cells. Hoxd4 is expressed up to the r6/r7 boundary and when PG1
function is lost the anterior expression domain is shifted posteriorly and
again the neural crest stripe is lost (Fig.
6I,J). Thus, the expression of Hox genes in r2-r7 is either
reduced or completely absent.
We also investigated several more posterior Hox genes, which have their anterior expression boundaries in the spinal cord. For all of these genes (Hoxa5, Hoxc6 and Hoxb9) the most anterior, spinal cord expression was lost in the triple PG1 knockdown, but the diffuse mesodermal expression (in particular of Hoxa5 and Hoxc6), and more posterior spinal cord expression, was unaffected (Fig. 6K-P).
To establish the specificity of this effect of the morpholinos, and to determine the degree to which reintroducing just one of the Hox PG1 genes would restore the Hox code, we utilised the Hoxd1 morpholino-insensitive mRNA (Fig. 7). When this was injected alone, it induced anterior expansion of the expression of Hoxb2 (Fig. 7A), but the other Hox genes analysed (Hoxa3, Hoxd4 and Hoxc6) were unaffected. When Hoxd1 mRNA was co-injected with the triple PG1 morpholino combination, however, it rescued the expression patterns of all of these Hox genes (Fig. 7C,F,I,L). This indicates that there may be a degree of redundancy between the PG1 genes and this is borne out by preliminary analyses of injections of the single morpholinos (Fig. 8). These showed that Hoxa2 and Hoxb2 expression was still present in all of the single knockdowns (shown for Hoxb2, Fig. 8A-D), although Hoxb2 was slightly reduced with the Hoxa1 and Hoxd1 morpholinos. Hoxa3 hindbrain expression however was reduced with the Hoxa1 morpholino, and not affected by the other individual morpholinos despite being rescued in the triple PG1 knockdown by the Hoxd1 mRNA (Fig. 8E-H, Fig. 7D-F). Hoxd4 was affected by the Hoxd1 morpholino, which appeared to give a similar phenotype to the triple combination (Fig. 8I-L). Thus different Hox genes appear to be dependant on different Hox PG1 genes, or a combination thereof, but these interactions will require further investigation before they are fully elucidated. However, these data do indicate that PG1 function in general is necessary for the establishment or maintenance of the expression patterns of both anterior and posterior Hox genes. For the more posterior genes this requirement is restricted to the anterior, ectodermal expression domains, and the expression in the mesoderm and posterior ectoderm is unaffected.
|
Thus, in the absence of Hox PG1 function, cranial neural crest cells are specified but they cannot migrate away from the hindbrain. Subsequent development of the pharyngeal arches and their derivatives is severely affected, with the complete loss of the gill cartilages.
| Discussion |
|---|
|
|
|---|
|
When we knock down the function of all three PG1 genes we observe a more
severe effect than in either the single or double knockdowns.
Fig. 10 shows a schematic for
the effect on the hindbrain of the stepwise elimination of Hox PG1 genes, with
increasingly more severe phenotypes occurring when there is less PG1 function
present. In Xenopus, the hindbrain expression of the r3/r5 marker,
Krox20, is completely lost in the triple knockdown, whereas its
expression domain is merely altered (indicating a reduction in the r3-r5
region) when at least one PG1 gene remains functional. Preliminary results
indicated that the triple knockdown phenotype is a synergistic, rather than an
additive effect, which implies a degree of redundancy between the PG1 genes
and, thus, we concentrated on the triple knockdown to elucidate the basic PG1
group function. We cannot therefore rule out effects being due to the double
morpholino combinations. However, defects in the hindbrain of Xenopus
embryos completely deficient in PG1 function were more extensive than any
previously reported for single or double PG1 knockouts in other organisms.
Expression of markers for r2-r7 was downregulated in the triple knockdown,
whereas the expression of an r1 marker, Gbx-2 was expanded
posteriorly, indicating a possible transformation of more posterior hindbrain
to an r1 type identity. Later morphological analysis showed that the hindbrain
is reduced in size and segmentation is perturbed. This phenotype is actually
similar to the situation in zebrafish when the functions of Hox cofactors from
the Meis and Pbx families are compromised
(Fig. 10). In Pbx4
(lazarus) mutants that have been injected with a Pbx2
morpholino (to achieve a total block of early Pbx function) the hindbrain is
not segmented and r2-r7 acquire an r1-like identity, referred to as the
hindbrain ground state (Waskiewicz et al.,
2002
). Likewise, when the function of Meis is blocked,
using two dominant-negative constructs, a similar, non-segmented hindbrain is
produced (Choe and Sagerstrom,
2004
). The similarity of these phenotypes to the triple PG1 MO
phenotype suggests that they could, at least partially, be due to the blocking
of PG1 gene function. A recent study in Xenopus showed that hindbrain
Krox20 stripes were eliminated when either a Meis morpholino
or a dominant-negative Hoxd1 RNA construct (which may also block
Hoxa1 and Hoxb1 function and, thus, be similar to the triple
MO situation) were injected into the embryo
(Dibner et al., 2004
). It has
also been noted in one Hoxa1 knockout study in mouse that
segmentation is completely blocked, but again all three of the PG1 genes could
be affected, as the truncated Hoxa1 splice variant still present
could perhaps act as a dominant-negative
(Chisaka et al., 1992
).
|
|
|
|
It is interesting to note that in the Hoxa1/b1 double knockout in
mouse, neural crest cells fail to delaminate from the presumptive r4
territory, although they delaminate normally from the other rhombomeres
(Gavalas et al., 2001
). This
failure could be more widespread in the triple PG1 knockdown, leading to a
wholesale block of cranial neural crest cell migration. This could be due to
the effect on the Hox code, as many of the Hox genes downregulated are also
expressed in the neural crest, or are known to be involved in their patterning
(Trainor and Krumlauf,
2001
).
Major defects in the craniofacial structures are later seen in embryos
lacking PG1 function, which are probably due to the inability of the cranial
neural crest cells to migrate. Derivatives of all the pharyngeal arches are
affected and most strikingly, the gill cartilages, derived from the 3rd and
4th pharyngeal arches, are completely missing. Effects such as this have not
previously been seen in PG1 mutants, where generally only the 1st and 2nd
pharyngeal arches are affected (Gavalas et
al., 1998
). Thus the complete abrogation of PG1 function has
identified additional regions of the embryo which are ultimately dependant
upon these genes for their formation.
In conclusion, we have knocked down the function of the complete Hox Paralogous Group 1 and illustrated that these genes have a degree of functional redundancy in their role of patterning the Xenopus hindbrain. We have demonstrated that PG1 function is essential for the correct establishment of the `Hox code'. In the absence of PG1 function, and perhaps as a consequence of `Hox code' disruption, hindbrain segmentation is perturbed and r2-r7 are mis-specified. In addition we have identified a novel requirement for Hox PG1 function in the migration of the cranial neural crest and the development of the pharyngeal arches.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Amsellem, S., Pflumio, F., Bardinet, D., Izac, B., Charneau, P.,
Romeo, P. H., Dubart-Kupperschmitt, A. and Fichelson, S.
(2003). Ex vivo expansion of human hematopoietic stem cells by
direct delivery of the HOXB4 homeoprotein. Nat. Med.
9,1423
-1427.[CrossRef][Medline]
Bradley, L. C., Snape, A., Bhatt, S. and Wilkinson, D. G.
(1993). The structure and expression of the Xenopus
Krox-20 gene: conserved and divergent patterns of expression in
rhombomeres and neural crest. Mech. Dev.
40, 73-84.[CrossRef][Medline]
Carpenter, E. M., Goddard, J. M., Chisaka, O., Manley, N. R. and
Capecchi, M. R. (1993). Loss of Hox-A1 (Hox-1.6) function
results in the reorganization of the murine hindbrain.
Development 118,1063
-1075.[Abstract]
Chatelin, L., Volovitch, M., Joliot, A. H., Perez, F. and
Prochiantz, A. (1996). Transcription factor hoxa-5 is taken
up by cells in culture and conveyed to their nuclei. Mech.
Dev. 55,111
-117.[CrossRef][Medline]
Chisaka, O., Musci, T. S. and Capecchi, M. R.
(1992). Developmental defects of the ear, cranial nerves and
hindbrain resulting from targeted disruption of the mouse homeobox gene
Hox-1.6. Nature 355,516
-520.[CrossRef][Medline]
Choe, S. K. and Sagerstrom, C. G. (2004).
Paralog group 1 hox genes regulate rhombomere 5/6 expression of vhnf1, a
repressor of rostral hindbrain fates, in a meis-dependent manner.
Dev. Biol. 271,350
-361.[CrossRef][Medline]
Davenne, M., Maconochie, M. K., Neun, R., Pattyn, A., Chambon,
P., Krumlauf, R. and Rijli, F. M. (1999). Hoxa2 and Hoxb2
control dorsoventral patterns of neuronal development in the rostral
hindbrain. Neuron 22,677
-691.[CrossRef][Medline]
Deschamps, J., van den Akker, E., Forlani, S., De Graaff, W.,
Oosterveen, T., Roelen, B. and Roelfsema, J. (1999).
Initiation, establishment and maintenance of Hox gene expression
patterns in the mouse. Int. J. Dev. Biol.
43,635
-650.[Medline]
Dibner, C., Elias, S., Ofir, R., Souopgui, J., Kolm, P. J.,
Sive, H., Pieler, T. and Frank, D. (2004). The Meis3 protein
and retinoid signaling interact to pattern the Xenopus hindbrain.
Dev. Biol. 271,75
-86.[CrossRef][Medline]
Dolle, P., Lufkin, T., Krumlauf, R., Mark, M., Duboule, D. and
Chambon, P. (1993). Local alterations of Krox-20 and Hox gene
expression in the hindbrain suggest lack of rhombomeres 4 and 5 in homozygote
null Hoxa-1 (Hox-1.6) mutant embryos. Proc. Natl. Acad. Sci.
USA 90,7666
-7670.
Duboule, D. and Dolle, P. (1989). The
structural and functional organization of the murine HOX gene family resembles
that of Drosophila homeotic genes. EMBO J.
8,1497
-1505.[Medline]
Frohman, M. A. and Martin, G. R. (1992).
Isolation and analysis of embryonic expression of Hox-4.9, a member of the
murine labial-like gene family. Mech. Dev.
38, 55-67.[CrossRef][Medline]
Frohman, M. A., Boyle, M. and Martin, G. R.
(1990). Isolation of the mouse Hox-2.9 gene; analysis of
embryonic expression suggests that positional information along the
anterior-posterior axis is specified by mesoderm.
Development 110,589
-607.
Gavalas, A., Studer, M., Lumsden, A., Rijli, F. M., Krumlauf, R.
and Chambon, P. (1998). Hoxa1 and Hoxb1 synergize in
patterning the hindbrain, cranial nerves and second pharyngeal arch.
Development 125,1123
-1136.[Abstract]
Gavalas, A., Trainor, P., Ariza-McNaughton, L. and Krumlauf,
R. (2001). Synergy between Hoxa1 and Hoxb1: the relationship
between arch patterning and the generation of cranial neural crest.
Development 128,3017
-3027.
Goddard, J. M., Rossel, M., Manley, N. R. and Capecchi, M.
R. (1996). Mice with targeted disruption of Hoxb-1 fail to
form the motor nucleus of the VIIth nerve. Development
122,3217
-3228.[Abstract]
Godsave, S. F., Dekker, E. J., Holling, T., Pannese, M.,
Boncinelli, E. and Durston, A. (1994). Expression patterns of
Hoxb genes in the Xenopus embryo suggest roles in anteroposterior
specification of the hindbrain and in dorsoventral patterning of the mesoderm.
Dev. Biol. 166,465
-476.[CrossRef][Medline]
Graham, A., Papalopulu, N. and Krumlauf, R.
(1989). The murine and Drosophila homeobox gene
complexes have common features of organization and expression.
Cell 57,367
-378.[CrossRef][Medline]
Harland, R. M. (1991). In situ hybridization:
an improved whole-mount method for Xenopus embryos. Meth.
Cell. Biol. 36,685
-695.[Medline]
Helmbacher, F., Pujades, C., Desmarquet, C., Frain, M., Rijli,
F. M., Chambon, P. and Charnay, P. (1998). Hoxa1 and Krox-20
synergize to control the development of rhombomere 3.
Development 125,4739
-4748.[Abstract]
Hemmati-Brivanlou, A., de la Torre, J., Holt, C. and Harland, R.
M. (1991). Cephalic expression and molecular characterization
of Xenopus En-2. Development
111,715
-724.[Abstract]
Hooiveld, M. H., Morgan, R., In der Rieden, P., Houtzager, E.,
Pannese, M., Damen, K., Boncinelli, E. and Durston, A. J.
(1999). Novel interactions between vertebrate Hox genes.
Int. J. Dev. Biol. 43,665
-674.[Medline]
Hopwood, N. D., Pluck, A. and Gurdon, J. B.
(1989). MyoD expression in the forming somites is an early
response to mesoderm induction in Xenopus embryos. EMBO
J. 8,3409
-1711.[Medline]
Hunter, M. P. and Prince, V. E. (2002).
Zebrafish hox paralogue group 2 genes function redundantly as selector genes
to pattern the second pharyngeal arch. Dev. Biol.
247,367
-389.[CrossRef][Medline]
Jones, E. A. and Woodland, H. R. (1989).
Spatial aspects of neural induction in Xenopus laevis.Development 107,785
-791.
Kolm, P. J. and Sive, H. L. (1995). Regulation
of the Xenopus labial homeodomain genes, HoxA1 and HoxD1: activation
by retinoids and peptide growth factors. Dev. Biol.
167, 34-49.[CrossRef][Medline]
Lennon, G., Auffray, C., Polymeropoulos, M. and Soares, M.
B. (1996). The I.M.A.G.E. Consortium: an integrated molecular
analysis of genomes and their expression. Genomics
33,151
-152.[CrossRef][Medline]
Linker, C., Bronner-Fraser, M. and Mayor, R.
(2000). Relationship between gene expression domains of Xsnail,
Xslug, and Xtwist and cell movement in the prospective neural crest of
Xenopus. Dev. Biol. 224,215
-225.[CrossRef][Medline]
Lufkin, T., Dierich, A., LeMeur, M., Mark, M. and Chambon,
P. (1991). Disruption of the Hox-1.6 homeobox gene results in
defects in a region corresponding to its rostral domain of expression.
Cell 66,1105
-1119.[CrossRef][Medline]
Maconochie, M., Nonchev, S., Morrison, A. and Krumlauf, R.
(1996). Paralogous Hox genes: function and regulation.
Annu. Rev. Genet. 30,529
-556.[CrossRef][Medline]
Maconochie, M. K., Nonchev, S., Studer, M., Chan, S. K.,
Popperl, H., Sham, M. H., Mann, R. S. and Krumlauf, R.
(1997). Cross-regulation in the mouse HoxB complex: the
expression of Hoxb2 in rhombomere 4 is regulated by Hoxb1. Genes
Dev. 11,1885
-1895.
Mark, M., Lufkin, T., Vonesch, J. L., Ruberte, E., Olivo, J. C.,
Dolle, P., Gorry, P., Lumsden, A. and Chambon, P. (1993). Two
rhombomeres are altered in Hoxa-1 mutant mice.
Development 119,319
-338.[Abstract]
Mayor, R., Essex, L. J., Bennett, M. F. and Sargent, M. G.
(1993). Distinct elements of the xsna promoter are required for
mesodermal and ectodermal expression. Development
119,661
-671.
Mayor, R., Morgan, R. and Sargent, M. G.
(1995). Induction of the prospective neural crest of Xenopus.Development 121,767
-777.[Abstract]
McClintock, J. M., Kheirbek, M. A. and Prince, V. E.
(2002). Knockdown of duplicated zebrafish hoxb1 genes reveals
distinct roles in hindbrain patterning and a novel mechanism of duplicate gene
retention. Development
129,2339
-2354.
McGinnis, W. and Krumlauf, R. (1992). Homeobox
genes and axial patterning. Cell
68,283
-302.[CrossRef][Medline]
Melton, K. R., Iulianella, A. and Trainor, P. A.
(2004). Gene expression and regulation of hindbrain and spinal
cord development. Front. Biosci.
9, 117-138.[Medline]
Murphy, P. and Hill, R. E. (1991). Expression
of the mouse labial-like homeobox-containing genes, Hox 2.9 and Hox 1.6,
during segmentation of the hindbrain. Development
111, 61-74.[Abstract]
Nieuwkoop, P. D. and Faber, J. (1956).Normal table of Xenopus laevis (Daudin)
.
Amsterdam: North-Holland Publishing Company.
Pannese, M., Polo, C., Andreazzoli, M., Vignali, R., Kablar, B.,
Barsacchi, G. and Boncinelli, E. (1995). The Xenopus
homologue of Otx2 is a maternal homeobox gene that demarcates and
specifies anterior body regions. Development
121,707
-720.[Abstract]
Papalopulu, N. and Kintner, C. (1993).
Xenopus Distal-less related homeobox genes are expressed in the
developing forebrain and are induced by planar signals.
Development 117,961
-975.[Abstract]
Pasqualetti, M., Ori, M., Nardi, I. and Rijli, F. M.
(2000). Ectopic Hoxa2 induction after neural crest migration
results in homeosis of jaw elements in Xenopus.Development 127,5367
-5378.[Abstract]
Prince, V. E. and Pickett, F. B. (2002).
Splitting pairs: the diverging fates of duplicated genes. Nat. Rev.
Genet. 3,827
-837.[CrossRef][Medline]
Richter, K., Good, P. J. and Dawid, I. B.
(1990). A developmentally regulated, nervous system-specific gene
in Xenopus encodes a putative RNA-binding protein. New
Biol. 2,556
-565.[Medline]
Rossel, M. and Capecchi, M. R. (1999). Mice
mutant for both Hoxa1 and Hoxb1 show extensive remodeling of the hindbrain and
defects in craniofacial development. Development
126,5027
-5040.[Abstract]
Roy, N. M. and Sagerstrom, C. G. (2004). An
early Fgf signal required for gene expression in the zebrafish hindbrain
primordium. Brain Res. Dev. Brain Res.
148, 27-42.[CrossRef][Medline]
Shih, L. J., Tsay, H. J., Lin, S. C. and Hwang, S. P.
(2001). Expression of zebrafish Hoxa1a in neuronal cells of the
midbrain and anterior hindbrain. Mech. Dev.
101,279
-281.[CrossRef][Medline]
Sive, H. L. and Cheng, P. F. (1991). Retinoic
acid perturbs the expression of Xhox.lab genes and alters mesodermal
determination in Xenopus laevis. Genes Dev.
5,1321
-1332.
Spitz, F., Gonzalez, F., Peichel, C., Vogt, T. F., Duboule, D.
and Zakany, J. (2001). Large scale transgenic and cluster
deletion analysis of the HoxD complex separate an ancestral regulatory module
from evolutionary innovations. Genes Dev.
15,2209
-2214.
Studer, M., Lumsden, A., Ariza-McNaughton, L., Bradley, A. and
Krumlauf, R. (1996). Altered segmental identity and abnormal
migration of motor neurons in mice lacking Hoxb-1.
Nature 384,630
-634.[CrossRef][Medline]
Studer, M., Gavalas, A., Marshall, H., Ariza-McNaughton, L.,
Rijli, F. M., Chambon, P. and Krumlauf, R. (1998). Genetic
interactions between Hoxa1 and Hoxb1 reveal new roles in regulation of early
hindbrain patterning. Development
125,1025
-1036.[Abstract]
Suemori, H. and Noguchi, S. (2000). Hox C
cluster genes are dispensable for overall body plan of mouse embryonic
development. Dev. Biol.
220,333
-342.[CrossRef][Medline]
Sundin, O. H., Busse, H. G., Rogers, M. B., Gudas, L. J. and
Eichele, G. (1990). Region-specific expression in early chick
and mouse embryos of Ghox-lab and Hox 1.6, vertebrate homeobox-containing
genes related to Drosophila labial.
Development 108,47
-58.[Abstract]
Trainor, P. A. and Krumlauf, R. (2001). Hox
genes, neural crest cells and branchial arch patterning. Curr.
Opin. Cell Biol. 13,698
-705.[CrossRef][Medline]
Turner, D. L. and Weintraub, H. (1994).
Expression of achaete-scute homolog 3 in Xenopus embryos converts
ectodermal cells to a neural fate. Genes Dev.
8,1434
-1447.
van den Akker, E., Fromental-Ramain, C., De Graaff, W., Le
Mouellic, H., Brulet, P., Chambon, P. and Deschamps, J.
(2001). Axial skeletal patterning in mice lacking all paralogous
group 8 Hox genes. Development
128,1911
-1921.[Abstract]
von Bubnoff, A., Schmidt, J. E. and Kimelman, D.
(1996). The Xenopus laevis homeobox gene Xgbx-2 is an
early marker of anteroposterior patterning in the ectoderm. Mech.
Dev. 54,149
-160.[CrossRef][Medline]
Wacker, S. A., Jansen, H. J., McNulty, C. L., Houtzager, E. and
Durston, A. J. (2004a). Timed interactions between the Hox
expressing non-organiser mesoderm and the Spemann organiser generate
positional information during vertebrate gastrulation. Dev.
Biol. 268,207
-219.[CrossRef][Medline]
Wacker, S. A., McNulty, C. L. and Durston, A. J.
(2004b). The initiation of Hox gene expression in Xenopus
laevis is controlled by Brachyury and BMP-4. Dev.
Biol. 266,123
-137.[CrossRef][Medline]
Walshe, J., Maroon, H., McGonnell, I. M., Dickson, C. and Mason,
I. (2002). Establishment of hindbrain segmental identity
requires signaling by FGF3 and FGF8. Curr. Biol
12,1117
-1123.[CrossRef][Medline]
Waskiewicz, A. J., Rikhof, H. A. and Moens, C. B.
(2002). Eliminating zebrafish pbx proteins reveals a hindbrain
ground state. Dev. Cell
3, 723-733.[CrossRef][Medline]
Wilkinson, D. G., Bhatt, S., Cook, M., Boncinelli, E. and
Krumlauf, R. (1989). Segmental expression of Hox-2
homoeobox-containing genes in the developing mouse hindbrain.
Nature 341,405
-409.[CrossRef][Medline]
Winklbauer, R. (1990). Mesodermal cell
migration during Xenopus gastrulation. Dev.
Biol. 142,155
-168.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
A. Desmazieres, P. Charnay, and P. Gilardi-Hebenstreit Krox20 Controls the Transcription of Its Various Targets in the Developing Hindbrain According to Multiple Modes J. Biol. Chem., April 17, 2009; 284(16): 10831 - 10840. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Wassef, D. Chomette, M. Pouilhe, A. Stedman, E. Havis, C. Desmarquet-Trin Dinh, S. Schneider-Maunoury, P. Gilardi-Hebenstreit, P. Charnay, and J. Ghislain Rostral hindbrain patterning involves the direct activation of a Krox20 transcriptional enhancer by Hox/Pbx and Meis factors Development, October 15, 2008; 135(20): 3369 - 3378. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Heasman Patterning the early Xenopus embryo. Development, April 1, 2006; 133(7): 1205 - 1217. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Chomette, M. Frain, S. Cereghini, P. Charnay, and J. Ghislain Krox20 hindbrain cis-regulatory landscape: interplay between multiple long-range initiation and autoregulatory elements Development, April 1, 2006; 133(7): 1253 - 1262. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||