|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 1 June 2005
doi: 10.1242/dev.01864
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(PKB
/Akt3) in postnatal brain development but not in glucose homeostasis
1 Friedrich Miescher Institute for Biomedical Research, Maulbeerstrasse 66,
CH-4058 Basel, Switzerland
2 Novartis Pharma AG, Lichtstrasse 35, CH-4056, Basel, Switzerland
3 Biomedizinische NMR Forschungs GmbH am Max-Planck-Institut für
biophysikalische Chemie, 37070 Göttingen, Germany
* Author for correspondence (e-mail: brian.hemmings{at}fmi.ch)
Accepted 14 April 2005
| SUMMARY |
|---|
|
|
|---|
and Pkbß-deficient mice,
Pkb
-/- mice are viable, show no growth retardation
and display normal glucose metabolism. However, in adult Pkb
mutant mice, brain size and weight are dramatically reduced by about 25%. In
vivo magnetic resonance imaging confirmed the reduction of
Pkb
-/- brain volumes with a proportionally smaller
ventricular system. Examination of the major brain structures revealed no
anatomical malformations except for a pronounced thinning of white matter
fibre connections in the corpus callosum. The reduction in brain
weight of Pkb
-/- mice is caused, at least
partially, by a significant reduction in both cell size and cell number. Our
results provide novel insights into the physiological role of PKB
and
suggest a crucial role in postnatal brain development.
Key words: Pkb
/Akt3 knockout, Brain development, Apoptosis
| Introduction |
|---|
|
|
|---|
/Akt1, PKBß/Akt2 and PKB
/Akt3
(Brodbeck et al., 1999
PKB is activated by numerous stimuli, including growth factors, hormones
and cytokines (Brazil and Hemmings,
2001
; Chan et al.,
1999
; Datta et al.,
1999
). Activation of PKB occurs in response to signalling via
phosphoinositide 3 kinase (PI3K) and requires the membrane-bound second
messenger phosphatidylinositol-3,4,5-triphosphate
[PtdIns(3,4,5)P3 or PIP3]
(Burgering and Coffer, 1995
;
Cross et al., 1995
;
Franke et al., 1995
). The
current model for PKB regulation proposes that
PtdIns(3,4,5)P3, generated following PI3K activation,
interacts with the PH domain of PKB, recruiting the inactive kinase from the
cytoplasm to the plasma membrane and promoting a conformational change that
allows phosphorylation on two regulatory sites by upstream kinases at the
plasma membrane. One of these critical phosphorylation sites resides in the
activation loop of the kinase domain (Thr308 in PKB
) and the other is
located in the C-terminal regulatory domain (Ser-473 in PKB
), termed
the hydrophobic motif (Alessi et al.,
1996
; Brodbeck et al.,
1999
; Meier et al.,
1997
). The upstream kinase that phosphorylates Thr308 in the
activation loop of the kinase domain of PKB
in a PIP3-dependent-manner
has been identified and termed 3-phosphoinositide-dependent kinase 1 (PDK1)
(Alessi et al., 1997
;
Stokoe et al., 1997
). Thr308
phosphorylation is necessary and sufficient for PKB activation; however,
maximal activation requires additional phosphorylation at Ser473
(Alessi et al., 1996
;
Yang et al., 2002a
;
Yang et al., 2002b
). Several
different protein kinases and mechanisms have been proposed for the
phosphorylation of the hydrophobic motif
(Brazil and Hemmings, 2001
;
Yang et al., 2002b
).
Mice with targeted disruption of Pkb
and/or
Pkbß have been obtained recently with Pkb
mutant
mice displaying an increased neonatal lethality and a reduction in body weight
of
30% (Chen et al.,
2001
; Cho et al.,
2001b
; Yang et al.,
2003
). Moreover, loss of Pkb
leads to placental
hypotrophy with impaired vascularisation
(Yang et al., 2003
). By
contrast, Pkbß-deficient mice are born with the expected
Mendelian ratio and exhibit a diabetes-like syndrome with elevated fasting
plasma glucose, hepatic glucose output, peripheral insulin resistance and an
compensatory increase of islet mass (Cho
et al., 2001a
). Compared with Pkb
mutant mice,
Pkbß-deficient mice are only mildly growth retarded
(Cho et al., 2001a
;
Garofalo et al., 2003
).
However, mice lacking both isoforms die after birth, probably owing to
respiratory failure (Peng et al.,
2003
). Pkb
ß double mutant newborns display a
severe reduction in body weight (
50%), prominent atrophy of the skin and
skeletal muscle, as well as impaired adipogenesis and delayed
ossification.
Here, we report the generation and characterisation of mice with targeted
disruption of the Pkb
gene. Compared with
Pkb
-/- and
Pkbß-/- mice, Pkb
mutant
mice display a distinct phenotype without increased perinatal mortality,
growth retardation or altered glucose metabolism. However, loss of PKB
profoundly affects postnatal brain growth. Brains from adult
Pkb
mutant mice show a dramatic reduction in size and weight.
Taken together, our results reveal a novel and important physiological role
for PKB
in postnatal brain development.
| Materials and methods |
|---|
|
|
|---|
gene by homologous recombination
11-kb HindIII fragment was subcloned containing exons 4
and 5 of Pkb
. A NcoI site was generated in exon 4 for
insertion of a
5-kb IRES-lacZ-Neo cassette. The targeting vector
was linearised with SalI and electroporated into 129/Ola ES cells. An
external probe was used for ES cell screening following XbaI
digestion. An internal probe and a lacZ-Neo probe were used to
characterize ES clones positive for homologous recombination (data not shown).
Correctly targeted ES cells were used to generate chimeras. Male chimeras were
mated with wild-type C57BL/6 females to obtain Pkb
+/- mice. Pkb
+/- mice
have been backcrossed twice with pure C57BL/6 mice and the progeny of
Pkb
+/- intercrosses have
75% C57BL/6
genetic background. Progeny were genotyped by multiplex PCR with the following
three primers: (1) P35, GGTTCTGTGGGAGGTAGTTCTC; (2) Neo-2,
GCAATCCATCTTGTTCAATGGCCG; and (3) E4
, CCATCGGTCGGCTACGGCTTGG.
Quantitative real time PCR
The levels of PKB isoforms in wild-type and mutant mice were determined by
quantitative Q-RT-PCR. The experiment was performed as described previously
(Yang et al., 2003
). Briefly,
total RNA was purified using Trizol Reagent (Invitrogen). For the Q-PCR
reaction, 50 ng total RNA was mixed with 5' and 3' primers, Taqman
probe, MuLV reverse transcriptase, RNase inhibitor and the components of the
TaqMan PCR reagent kit (Eurogentec) in a total volume of 25 µl following
the TaqMan PCR reagent kit protocol.
Western blot analysis
For Western blot analysis, protein lysates were processed as previously
described (Yang et al., 2003
).
PKB isoform-specific antibodies were obtained by immunizing rabbits with
isoform-specific peptides as previously described
(Yang et al., 2003
).
Antibodies against phospho-PKB (Ser473), phospho-GSK3
/ß (Ser21/9),
phospho-TSC2 (Thr1462) and phospho-p70S6K were purchased from Cell Signalling
Technologies. Antibodies against p27 and ERK were purchased from Santa Cruz
Biotechnology. The antibody against phospho-ERK (Thr202/Tyr204) was purchased
from Promega and the Pan-Actin antibody was obtained from NeoMarkers. Western
blots were scanned using a GS-800 BioRad densitometer with a resolution of
63.5 µm x 63.5 µm and bands were quantified using Proteomweaver
3.0.0.6 (Definiens).
Histological examination
For histological analysis, animals were perfused with phosphate-buffered
saline and 4% paraformaldehyde in phosphate-buffered saline. Organs were
dissected and kept in the same fixation solution overnight at 4°C. Samples
were embedded in paraffin following dehydration in ethanol. Tissues were cut
into 6 µm sections and stored for staining. For Haematoxylin-Eosin and
Cresyl-Violet (Sigma) staining, sections were freed of paraffin and
stained.
Cell number determination
To determine the number of cells in a whole brain, the DNA content was
determined as described by Labarca and Paigen
(Labarca and Paigen, 1980
).
This method is based on the enhancement of fluorescence after binding of
bisbenzimid (Riedel-de Haen) to DNA. A linear standard curve (1-10 µg/ml)
was prepared to calculate the DNA concentration. The relative cell size in
posterior cortex was measured on plane-matched, parasagittal brain sections
stained with DAPI (Biotium). Image-Pro® Plus (Media Cybernetics) was used
to count the cell number and to calculate the mean area occupied by one cell.
The relative cell size is expressed as percent of wild type.
In vivo magnetic resonance imaging (MRI)
MRI studies of 4-month-old female Pkb
wild-type
(n=5) and mutant mice (n=5) were performed at 2.35 T using a
MRBR 4.7/400 mm magnet (Magnex Scientific, Abingdon, England) equipped with
BGA20 gradients (100 mT m-1) and a DBX system (Bruker Biospin,
Ettlingen, Germany). For in vivo examinations, animals were anaesthetized
(1.0-1.5% halothane in 70:30 N2O:O2) and treated as
previously described (Natt et al.,
2002
). Briefly, radiofrequency (rf) excitation and signal
reception were accomplished with use of a Helmholtz coil (
100 mm) and
a surface coil (
20 x12 mm), respectively. Three-dimensional
T1-weighted (rf-spoiled 3D FLASH, repetition time TR=17 mseconds,
echo time TE=7.6 mseconds, flip angle 25°, measuring time 84 minutes) and
T2-weighted MRI data sets (3D fast spin-echo, TR/TE=3000/98
mseconds, measuring time 58 minutes) were acquired with an isotropic
resolution of 117 µm. Volumetric assessments were obtained by analysing
T1-weighted images using software provided by the manufacturer
(Paravision, Bruker Biospin, Ettlingen, Germany). After manually outlining the
whole brain and the ventricular spaces in individual sections, respective
areas were calculated (in mm2), summed and multiplied by the
section thickness.
Neuronal cell culture
E16.5 murine hippocampal neurons were isolated from timed matings. Cells
were kept in culture for 7 days on polylysine coverslips coated with
B27/Neurobasal (GIBCO Life Technologies). At day 7, cultures were treated with
glutamate (15 mM/24 hours), staurosporine (50 nM/12 hours) or were left
untreated. For the detection of apoptotic cells, five fixed cultures per
genotype were stained using a TUNEL-assay (Roche) according to the
manufacturer's instructions and counterstained with DAPI (Biotium). At least
200 cells per culture were counted and the percentage of apoptotic cells was
calculated.
Glucose and insulin tolerance test
Mice were housed according to the Swiss Animal Protection Laws in groups
with 12 hours dark/light cycles and with free access to food and water. All
procedures were conducted with the approval of the appropriate
authorities.
Random-fed and fasting blood glucose levels were determined in 5- to 6-month-old mice. Blood samples were collected from tail veins and glucose levels were determined using Glucometer Elite (Bayer). Mice (aged 5-6 months) were fasted overnight before the start of the glucose and insulin tolerance tests. Glucose (2 g/kg) was given orally to conscious mice. Insulin (1 U/kg) was administered by intraperitoneal injection to conscious mice. Blood samples were collected at indicated times from tail veins and glucose levels were determined using Glucometer Elite (Bayer). Blood glucose levels were expressed as percentage of initial value. Blood insulin levels were measured with a Mouse ultra-sensitive insulin ELISA (Immunodiagnostic Systems).
Microarray analysis
Microarray analysis was performed using murine MOE430A GeneChipsTM
(Affymetrix). Total RNA (10 µg) was reverse transcribed using the
SuperScript Choice system for cDNA synthesis (Life Technologies) and
biotin-labelled cRNA generated using the Enzo BioArray High Yield RNA
transcript labelling kit (Enzo Diagnostics) following the manufacturer's
protocol. cRNA fragmentation and hybridisation were performed as recommended
by Affymetrix. Expression data were calculated using the RMA algorithm from
BioConductor (Irizarry et al.,
2003
). A gene was considered to be significantly altered in its
expression if it had an Affymetrix change P-value of less than 0.003
for either increase or decrease in at least two-thirds of replicate
comparisons and it had a minimum expression value of 100 in at least one
condition. A fold-change threshold of 1.5 was then applied and the resulting
genes were subjected to a one-way ANOVA with a P-value cut-off of
0.05. A Benjamini and Hochberg multiple testing correction and a Tukey
post-hoc test were applied.
Statistical analysis
To compare body weight, brain weight and volume, brain/body weight ratio,
DNA content, cell number and percentage of apoptotic cells between
Pkb
+/+ and Pkb
-/-, an unpaired Students t-test was performed.
P values under 0.05 were considered as significant and values below
0.01 as highly significant.
| Results |
|---|
|
|
|---|
-/- mice were generated by targeted
disruption of exon 4 as shown in (Fig.
1A). The ablation of Pkb
was confirmed by PCR,
Q-RT-PCR and Western blot analysis using brain tissue samples from
Pkb
wild-type (Pkb
+/+),
heterozygous (Pkb
+/-) and mutant
(Pkb
-/-) mice
(Fig. 1B). Quantitative RT-PCR
displayed complete ablation of the PKB
mRNA in brain samples of
Pkb
mutant mice (n=3, data not shown). To confirm the
absence of PKB
at the protein level, Western blot analysis was
performed with an isoform-specific anti-PKB
antibody. In contrast to
Pkb
+/+ brain tissue samples, PKB
was not
detectable in samples derived from mutant mice
(Fig. 1C). In addition, Western
blot analysis with antibodies specific for PKB
and PKBß,
respectively, showed no compensatory upregulation of PKB
and/or
PKBß, respectively, in the brain of Pkb
-/-
mice (Fig. 1D).
Distribution of PKB
in wild-type tissues
It has been reported that the PKB
and ß isoform are widely
expressed in all organs, but with some isoform-specific features
(Altomare et al., 1998
;
Yang et al., 2003
). Less is
known about the tissue distribution of the PKB
isoform. Previous
reports suggest that PKB
has a more restricted distribution with high
levels in the adult brain and foetal heart and low levels in liver and
skeletal muscle (Brodbeck et al.,
1999
; Masure et al.,
1999
; Yang et al.,
2003
). We assessed the distribution of PKB
mRNA in 15 major
tissues of adult mice by quantitative RT-PCR and normalised to the level of
PKB
in the brain (Fig.
2A). PKB
mRNA was found at the highest level in brain and
testis, and at lower levels in lung, mammary gland, fat and spleen.
To investigate whether PKB
ablation leads to compensatory increase
in PKB
and/or PKBß, total RNA isolated from brain, testis, lung,
mammary gland, fat and spleen of three Pkb
wild-type and three
mutant mice was subjected to quantitative RT-PCR. The levels of PKB
and
ß were normalised to the level of PKB
in wild-type brain and set
as 100%. Overall, no marked upregulation of PKB
and/or PKBß was
observed, including the brain (Fig.
2B,C). These results are consistent with Western blot analysis of
protein extracts of brains from Pkb
wild-type and mutant mice
(Fig. 1D). To investigate the
distribution and levels of individual PKB isoforms within the brain, protein
lysates were prepared from ten anatomically and functionally different
regions. In general, all three isoforms were expressed in all examined regions
but with certain isoform-specific features
(Fig. 2D). PKB
is
expressed in all regions at similar levels, whereas PKBß is expressed at
moderate levels in cortex, cerebellum, hippocampus and olfactory bulb, and at
lower levels in the hypothalamus, midbrain, brain stem and spinal cord.
PKB
is expressed in all examined regions but at higher levels in the
cortex and in the cerebellum.
|
mutant mice
+/+ and
Pkb
-/- mice was analysed using an antibody specific
for the phosphorylation site (anti-phospho-Ser-473) in the hydrophobic motif
of the regulatory domain of all three isoforms
(Fig. 3A). As expected, levels
of activated PKB (quantification was done using actin as loading control) in
Pkb
-/- mice was significantly lower than in
Pkb
+/+ littermate controls (100% versus 38%), but
was not completely abolished (Fig.
3B). The phosphorylation levels of glycogen synthase kinase 3
(GSK3), tuberous sclerosis complex 2 (TSC2), p70S6K, ERK and p27 in
Pkb
-/- mice were not significantly changed when
compared with wild-type littermate controls (levels of phosphorylated protein
were normalised with the level of unphosphorylated protein). We repeated this
experiment using brain samples of 14 days old mice and obtained comparable
results with significantly reduced levels of total phosphorylated PKB and
unchanged levels of phosphorylated substrates (data not shown).
|
|
+/+ and
Pkb
-/- mice (n=5 per genotype, data not
shown).
|
is not required for postnatal survival, fertility, body weight and glucose metabolism
-/- mice after birth in an analysis of more than
400 pups (aged 3-4 weeks) [Pkb
+/+:
Pkb
+/-: Pkb
-/-=104 (25.6%): 206 (50.7%): 96 (23.6%)]. As PKB
is highly expressed in the testis, fertility of mutant mice was tested using
male Pkb
-/- x female
Pkb
+/+ and female Pkb
-/-
x male Pkb
+/+ matings. Both male and female
mutant mice matings gave normal pregnancies and births, indicating that
fertility is not impaired in either male or female Pkb
mutant
mice (data not shown).
As PKB has been implicated in the regulation of cell and organ growth, body
weight was measured in male Pkb
mutant mice and wild-type
littermate controls (n=5-8 per group) at different time points
(Chen et al., 2001
;
Cho et al., 2001b
;
Peng et al., 2003
;
Yang et al., 2003
). Body
weight did not differ significantly between male Pkb
mutant
mice and wild-type controls at any time point
(Fig. 4A). A similar result was
obtained with female Pkb
-/- mice and
Pkb
+/+ controls (n=5-8 per group, data not
shown), indicating that PKB
does not play a significant role in the
overall growth of mice.
To investigate a potential role of PKB
in the regulation of glucose
metabolism, blood glucose levels were measured in adult (5-6 months)
Pkb
mutant mice under random-fed and fasting condition, and
compared with age- and gender-matched wild-type controls. Interestingly, both
random-fed and fasting blood glucose levels, were not significantly different
between wild-type and mutant mice (Fig.
4B). Additionally, blood insulin levels in random-fed condition
did not differ significantly between Pkb
+/+ and
Pkb
-/- mice (1.32±0.08 µg/l
versus 1.30±0.13 µg/l; n=6). To further investigate glucose
metabolism, overnight fasted mice were challenged with insulin (insulin
tolerance test) or glucose (glucose tolerance test). To test the insulin
responsiveness, insulin (1 U/kg) was applied by intraperitoneal injection und
blood glucose levels were measured at indicated time points using blood from
tail veins. No obvious differences of blood glucose levels in the insulin
tolerance test were found between the groups with mutant and control mice
(Fig. 4C). Additionally, mice
were challenged with orally applied glucose (2 g/kg) and blood glucose levels
were measured at indicated time. Compared with wild-type mice,
Pkb
-/- mice displayed a very similar response
to the glucose load (Fig. 4D).
Taken together, these results suggest that PKB
does not play a
significant role in the maintenance of glucose homeostasis.
Essential role of PKB
in postnatal brain development
Next, adult Pkb
+/+ and
Pkb
-/- mice were dissected and all major organs
were investigated macroscopically. Compared with
Pkb
+/+ littermate controls, the overall size of
brains from adult Pkb
-/- mice was strikingly
reduced. A representative example is shown in
Fig. 5B-D. Furthermore, the
weights of freshly dissected brains of Pkb
wild-type and
Pkb
mutant mice were measured at different ages
(Fig. 5A). Compared with age-
and gender-matched wild-type littermate controls, brains from adult
Pkb
-/- mice (3-12 months old) exhibited a highly
significant reduction in weight of about 25% (range 22%-29%), affecting both
males and females (data for females not shown, n=5-8). Interestingly,
at birth, brain weight did not differ significantly between
Pkb
+/+ and Pkb
-/- mice.
The reduction in brain size and weight was first observed at the age of 1
month, but was less pronounced compared with adult mice (
18%). In contrast
to Pkb
, Pkbß and IgfI-null mutant mice
(Beck et al., 1995
;
Cheng et al., 1998
;
Garofalo et al., 2003
;
Powell-Braxton et al., 1993
),
the brain/body weight ratio of Pkb
mutant mice was also
significantly reduced to a similar extent.
|
-/- mice
mutant
brain anatomy, five adult female mutant and five age and gender matched
wild-type littermate controls (with the same genetic background) from
Pkb
+/- matings were examined using high-resolution
3D MRI as previously described (Natt et
al., 2002
+/+ and Pkb
-/- brains
in a sagittal, horizontal, and coronal section orientation. Complementary in
vivo volumetry based on T1-weighted 3D MRI confirmed the much
smaller brain size of all five Pkb
mutant mice. Compared with
wild-type littermates, whole brain volume in Pkb
-/-
mice was significantly reduced by about 24% (513±14 mm3
versus 391±16 mm3, P<0.01; n=5).
Although several brain regions were affected, including olfactory bulb, cortex
and hippocampal formation, no alteration in the structural organization of the
brain was observed, confirming the macro-pathological findings. Moreover,
because the volume of the ventricular spaces in
Pkb
-/- mice was reduced (7.85±2.2
mm3 versus 5.55±2.8 mm3) in proportion to that of
the whole brain and MRI revealed no enlargement of the subarachnoid space, the
occurrence of an internal or external hydrocephalus is excluded as a cause of
reduced brain size. Interestingly, in contrast to any wild-type littermate
controls, all five Pkb
-/- mice presented with a
marked thinning of the corpus callosum (downward arrowheads in
Fig. 5E,F). White matter fibres
connections are depicted as hypointense structures in T2-weighted
images. Although unequivocally identifiable in
Pkb
+/+ mice
(Fig. 5E,G,I), the corpus
callosum is partly indistinguishable from surrounding grey matter in
Pkb
-/- mice
(Fig. 5F,H,J). Anterior and
posterior commissures as well as the hippocampal fimbria are less prominently
affected.
|
-/- mouse brains
-/- brain was
performed to investigate changes at the microscopic level. Various brain
regions, including cerebellum, hippocampus and corpus callosum, were examined
following Haematoxylin/Eosin staining (Fig.
6A-F). With the exception of the reduced size of all regions, no
abnormalities in the overall structure of the different brain regions were
observed. In line with the in vivo MRI findings, the thickness of the corpus
callosum in Pkb
mutant mice was markedly reduced (downward
arrowheads in Fig. 6G,J).
Additionally, myelin staining with luxol Fast Blue revealed not only a
reduction in thickness of the corpus callosum but also less intense staining
of the structure (Fig.
6H,K).
Cell number in the brains of Pkb
-/- mice
Next, we indirectly assessed the cell number by measuring the amount of DNA
in whole brains derived from Pkb
+/+ and
Pkb
-/- mice. The amount of DNA is considered as an
indicator of cell number, whereas the amount of DNA per gram of tissue is an
indicator of cell density which is reciprocal to cell volume
(Zamenhof, 1976
). The DNA
contents of brains from newborns and 1-month-old mice were determined using
the method described by Labarca and Paigen
(Labarca and Paigen, 1980
).
Briefly, this method is based on the enhancement of fluorescence after binding
of bisbenzimid to DNA. Compared with wild-type control samples, whole brain
DNA content of Pkb
-/- newborns did not differ
significantly, indicating that cell number was not changed. Similarly, the DNA
content per gram of brain tissue was comparable between Pkb
wild-type and mutant mice, indicating a comparable cell size. In contrast to
newborns, the DNA content in brains of 1-month-old Pkb
mutant
mice was slightly, but significantly, reduced compared with the
Pkb
+/+ controls
(Table 1). However, the DNA
content per gram of tissue was, significantly increased in samples from
Pkb
-/- compared with wild-type littermate controls,
indicative of increased cell density (and reduced cell size).
|
1000
per field), and the area occupied by one cell was subsequently calculated. In
line with the results of the DNA content experiment, the relative cell size
was significantly and consistently reduced in Pkb
mutant mice
(100±10% versus 80±7%; n=5 per genotype;
P<0.05). Taken together, the results show that both cell size and
cell number contribute to the reduction in brain size observed in mutant mice,
but the relative contribution of cell size reduction plays a more important
part.
Susceptibility to glutamate and staurosporine induced cell death
It is established that the PI3K/PKB pathway plays a crucial role in cell
survival in the central nervous system
(Datta et al., 1999
;
Dudek et al., 1997
;
Kim et al., 2002
). To
investigate the potential role of PKB
in apoptosis, primary cell
cultures were established from Pkb
+/+ and
Pkb
-/- hippocampal neurons. Immunocytochemistry at
day 28 using antibodies against tau (for axons) and Map2C (for dendrites) did
not reveal any obvious defects in the differentiation of
Pkb
-/- hippocampal neurons
(Fig. 7A-D). Consistent with
the analysis of the expression pattern of PKB isoforms in various brain
regions (Fig. 2D), we found
that PKB
, PKBß and PKB
, respectively, were expressed in
cultured wild-type primary hippocampal neurons. In accordance with the result
of Fig. 1D, we did not find a
compensatory upregulation of PKB
and PKBß in
Pkb
-deficient cells (Fig.
7E). To test the potential role of PKB
in the survival of
hippocampal neurons, cell cultures were challenged with glutamate (15 mM/24
hours) or staurosporine (50 nM/12 hours) after 7 days in culture. Apoptotic
cells were detected using the TUNEL assay. In untreated cells cultures, no
significant difference in the percentage of apoptotic cells between
Pkb
+/+ and Pkb
-/-
hippocampal neurons was observed (Fig.
7F). After treatment with glutamate or staurosporine, the
percentage of apoptotic cells was significantly increased (51% and 24%,
respectively, P<0.01) in cultures from
Pkb
-/- hippocampal neurons
(Fig. 7F). Additionally, we
analysed the number of apoptotic cells from adult brains (n=5 per
genotype) using TUNEL staining on parasagittal sections. Similar to the
results of untreated cultures, we did not find any difference between
Pkb
+/+ and Pkb
-/- mice
(data not shown).
|
-/- brains
in these events, we analyzed gene expression patterns in
brains of Pkb
+/+ and
Pkb
-/- mice at different time points during
postnatal brain development, i.e. day 1, day 7 and day 30. RNA was extracted
from whole mice brains and microarray analysis was performed on three
individual brains per genotype and time point using murine Affymetrix
GeneChipsTM. Changes below 1.5-fold increase were considered
insignificant, and differentially regulated genes were subjected to a one-way
ANOVA analysis (Table 2). As
the brain consists of various heterogeneous cell populations, any change of
expression occurring in a specific cell type will be quenched in the pool of
whole brain RNA. It is therefore likely that the real expression changes in
specific tissues are higher than apparent in this experiment. Among the 17,000
expressed genes, we found 37 genes to be differentially expressed in
Pkb
-/- brains versus
Pkb
+/+ brains. Of these, 16 genes were upregulated
and 21 genes downregulated. Among the genes with changed expression are
several transcription factors and genes implicated in cell cycle and
proliferation. Significantly, one of the most interesting findings is that at
P30, several genes involved in synaptic transmission (pre- and postsynaptic),
including ionotropic glutamate receptor (NMDAR1), potassium-chloride
co-transporter 2 (KCC2), chapsyin 110 [channel-associated protein of synapses,
110 kDa (DLG2)] and synaptotagmin 2 (SYT2), have significantly reduced
expression levels in Pkb
mutant brains. Additionally,
Ca2+/calmodulin-dependent protein kinase II
(CaMKII), an
enzyme that is essential in synaptic plasticity and memory formation, was
found at reduced expression levels (Ninan
and Arancio, 2004
|
| Discussion |
|---|
|
|
|---|
gene. Mice with targeted disruption of all single PKB
isoform were generated and all demonstrated a distinct phenotype. Mice
deficient in Pkb
are smaller with a 30% reduction in body size
and partial neonatal lethality, which might be caused by placental
insufficiency (Chen et al.,
2001
ß double mutant mice with severe intrauterine growth
retardation that die shortly after birth with multiple defects in skin, bone
and fat tissue (Peng et al.,
2003
-deficient mice display a distinct phenotype without
increased mortality, growth retardation and altered glucose homeostasis.
Inactivation of the Pkb
gene leads to a considerable reduction
in total phosphorylated/activated PKB in the mutant brain without any
compensatory increase of the
and ß isoforms (assessed at the mRNA
and protein levels), suggesting a failure to fully compensate for the loss of
PKB
. This result is consistent with findings in Pkb
and
Pkbß mutant mice, where no compensatory upregulation of 2
remaining isoforms was found (Cho et al.,
2001b
and Pkbß mutant mice are due to specific and
distinct functions of the different PKB isoforms. By contrast, Peng and
colleagues proposed that the individual phenotypes are due to loss of the
dominant isoform in a specific tissue, which leads to significant reduction of
total activated PKB below a crucial level
(Peng et al., 2003
ß double knockout mice
(Peng et al., 2003
double mutant mice (Z.-Z.Y.
and B.A.H., unpublished). Ablation of a single copy of Pkb
in
Pkb
-deficient mice (Pkb
-/-
Pkb
+/- led to a higher perinatal mortality
compared with Pkb
single mutant mice and the ablation of both
Pkb
alleles in Pkb
-/- mice led to
more pronounced dwarfism and intra-uterine death of all
Pkb
-/-Pkb
-/- double
mutant animals. However, it cannot be confirmed yet whether the observed
phenotypes are due to a combination of reduced level of activated PKB and the
loss of isoform-specific functions.
The IGF1/PI3K/PKB pathway plays a crucial role in mammalian brain
development and function (D'Ercole et al.,
2002
; Rodgers and Theibert,
2002
). Besides the severe growth retardation, adult mice with IGF1
deficiency exhibit a significant (38%) brain weight reduction
(Beck et al., 1995
). Similar to
the Pkb
mutant mice, all brain parts of the
Igf1-/- mice were affected but the general anatomical
organisation was normal. Furthermore, ablation of IGF1 resulted in a cell
type-dependent loss of neurons, as well as a reduced total number of
oligodendrocytes and hypomyelination (Beck
et al., 1995
; Ye et al.,
2002
). In addition, targeted deletion of IRS2 in mice also
produced a pronounced brain growth deficiency, but in contrast to
Pkb
mutants, the reduction was already apparent during
embryonic (E15.5) development (Schubert et
al., 2003
). By contrast, an increased brain mass was observed in
mice overexpressing IGF1 (Mathews et al.,
1988
; Ye et al.,
1995
). Moreover, mice with brain-specific deletion of PTEN, a
negative regulator of the PI3K/PKB pathway, exhibited an enlarged brain with
seizures and ataxia resembling Lhermitte-Duclos disease
(Backman et al., 2001
;
Kwon et al., 2001
). Less is
known about the consequences of Pkb
and Pkbß
inactivation for mouse brain development. Compared with
Pkb
-/- mice, adult Pkb
and
Pkbß mutant mice showed only a slight decrease in brain weight
(Garofalo et al., 2003
;
Yang et al., 2004
). In both
Pkb
and Pkbß mutant mice, no changes in the
gross brain morphology were reported.
However, inactivation of the Pkb
gene resulted in a
significant reduction of brain weight and size. Interestingly,
Pkb
deficiency did not affect the general anatomical
organization of the brain. In vivo 3D MRI and histological analysis excluded
the absence of a specific brain region as the main cause of the weight
reduction, consistent with the result of the broad expression profile among
brain regions. More specifically, the proportionally reduced ventricular
system rules out major disturbances in production, circulation and absorption
of cerebrospinal fluid as a cause of reduced cell size/number in
Pkb
-/- mice. The biological relevance of the MRI
signal alterations in white matter such as the corpus callosum requires
further investigation. Nevertheless, it should be noted that the in vivo MRI
results are consistent with a pronounced, but not complete, deficit in myelin
deposition (Boretius, 2003
),
which is also strongly supported by the histological findings for myelin
staining. In agreement with our results, mice deficient in IGF1, a potent
activator of PKB
, the myelin-rich white matter regions, including
corpus callosum and anterior commissure, were overproportionally reduced by
about 70% (Beck et al., 1995
).
By contrast, mice overexpressing IGF1 display an increased brain weight and
the corpus callosum of the Igf1 transgenic mice was increased in
excess of proportionality (Carson et al.,
1993
).
The PI3-K/PKB signalling pathway plays a crucial role in the determination
of cell size (Scanga et al.,
2000
; Shioi et al.,
2002
; Tuttle et al.,
2001
; Verdu et al.,
1999
). Results from transgenic mice overexpressing PKB show larger
cardiac myocytes and thymocytes, or hypertrophy and hyperplasia in the
pancreas (Kovacic et al.,
2003
; Mangi et al.,
2003
). An increase in neuronal soma size was observed in mice with
brain-specific deletion of PTEN (Backman et
al., 2001
; Kwon et al.,
2001
). By contrast, the size of skeletal muscle cells in
Pkb
ß double mutant mice was dramatically reduced
(Peng et al., 2003
). Our
results show that both cell number and cell size are affected, but that
reduced cell size contributes more than the reduced cell number. Additionally,
it has been shown that the mTOR signalling pathway is also involved in the
determination of cell size (Montagne et
al., 1999
; Oldham et al.,
2000
; Zhang et al.,
2000
). PKB modulates mTOR activity by phosphorylating TSC2, with a
subsequent disruption of the TSC1-TSC2 interaction
(Inoki et al., 2002
;
Potter et al., 2003
).
Recent publications have linked PI3-K/PKB with synaptic plasticity and
memory (Dash et al., 2004
;
Kelly and Lynch, 2000
;
Lin et al., 2001
;
Robles et al., 2003
;
Sanna et al., 2002
). Wang and
colleagues demonstrated that the A-type
-aminobutyric acid receptors
(GABAAR), which mediate fast inhibitory synaptic transmission, is
phosphorylated by PKB (Wang et al.,
2003
). Phosphorylation of GABAAR leads to an increased
number of receptor on the cell membrane and an increased synaptic
transmission. Additionally, Lin et al. established a role of the PI3-K/PKB
pathway in fear conditioning in the amygdala
(Lin et al., 2001
). As we
found several genes involved in neuronal circuit activity in our microarray
experiment, future behavioural and electrophysiological studies of
Pkb
mutant brains will elucidate the specific role of
PKB
in synaptic transmission, learning and memory.
In summary, we have demonstrated that Pkb
-deficient mice
display a phenotype distinct from Pkb
and Pkbß
mutant mice. Our results provide novel insights into the physiological
function of PKB
and suggest a crucial role in postnatal brain
development of mammals. Identification of PKB
specific substrates
involved in postnatal brain development is now of critical importance.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Alessi, D. R., Andjelkovic, M., Caudwell, B., Cron, P., Morrice,
N., Cohen, P. and Hemmings, B. A. (1996). Mechanism of
activation of protein kinase B by insulin and IGF-1. EMBO
J. 15,6541
-6551.[Medline]
Alessi, D. R., Deak, M., Casamayor, A., Caudwell, F. B.,
Morrice, N., Norman, D. G., Gaffney, P., Reese, C. B., MacDougall, C. N.,
Harbison, D. et al. (1997). 3-Phosphoinositide-dependent
protein kinase-1 (PDK1): structural and functional homology with the
Drosophila DSTPK61 kinase. Curr. Biol.
7, 776-789.[CrossRef][Medline]
Altomare, D. A., Lyons, G. E., Mitsuuchi, Y., Cheng, J. Q. and
Testa, J. R. (1998). Akt2 mRNA is highly expressed in
embryonic brown fat and the AKT2 kinase is activated by insulin.
Oncogene 16,2407
-2411.[CrossRef][Medline]
Backman, S. A., Stambolic, V., Suzuki, A., Haight, J., Elia, A.,
Pretorius, J., Tsao, M. S., Shannon, P., Bolon, B., Ivy, G. O. et al.
(2001). Deletion of Pten in mouse brain causes seizures, ataxia
and defects in soma size resembling Lhermitte-Duclos disease. Nat.
Genet. 29,396
-403.[CrossRef][Medline]
Beck, K. D., Powell-Braxton, L., Widmer, H. R., Valverde, J. and
Hefti, F. (1995). Igf1 gene disruption results in reduced
brain size, CNS hypomyelination, and loss of hippocampal granule and striatal
parvalbumin-containing neurons. Neuron
14,717
-730.[CrossRef][Medline]
Boretius, S., Merkler, D., Awn, N., Stadelmann, C., Natt, O.,
Watanabe, T., Michaelis, T., Frahms, J. and Brück, W.
(2003). How do T1-, T2- and MT-weighted images reflect de- and
remyelination? In vivo MRI of mice treated with the demyelinating neurotoxic
agent cuprizone. Proc. Intl. Soc. Magn. Reson. Med.
12, 280.
Brazil, D. P. and Hemmings, B. A. (2001). Ten
years of protein kinase B signalling: a hard Akt to follow. Trends
Biochem. Sci. 26,657
-664.[CrossRef][Medline]
Brodbeck, D., Cron, P. and Hemmings, B. A.
(1999). A human protein kinase Bgamma with regulatory
phosphorylation sites in the activation loop and in the C-terminal hydrophobic
domain. J. Biol. Chem.
274,9133
-9136.
Burgering, B. M. and Coffer, P. J. (1995).
Protein kinase B (c-Akt) in phosphatidylinositol-3-OH kinase signal
transduction. Nature
376,599
-602.[CrossRef][Medline]
Carson, M. J., Behringer, R. R., Brinster, R. L. and McMorris,
F. A. (1993). Insulin-like growth factor I increases brain
growth and central nervous system myelination in transgenic mice.
Neuron 10,729
-740.[CrossRef][Medline]
Chan, T. O., Rittenhouse, S. E. and Tsichlis, P. N.
(1999). AKT/PKB and other D3 phosphoinositide-regulated kinases:
kinase activation by phosphoinositide-dependent phosphorylation.
Annu. Rev. Biochem. 68,965
-1014.[CrossRef][Medline]
Chen, W. S., Xu, P. Z., Gottlob, K., Chen, M. L., Sokol, K.,
Shiyanova, T., Roninson, I., Weng, W., Suzuki, R., Tobe, K. et al.
(2001). Growth retardation and increased apoptosis in mice with
homozygous disruption of the Akt1 gene. Genes Dev.
15,2203
-2208.
Cheng, C. M., Joncas, G., Reinhardt, R. R., Farrer, R., Quarles,
R., Janssen, J., McDonald, M. P., Crawley, J. N., Powell-Braxton, L. and
Bondy, C. A. (1998). Biochemical and morphometric analyses
show that myelination in the insulin-like growth factor 1 null brain is
proportionate to its neuronal composition. J.
Neurosci. 18,5673
-5681.
Cheng, J. Q., Godwin, A. K., Bellacosa, A., Taguchi, T., Franke,
T. F., Hamilton, T. C., Tsichlis, P. N. and Testa, J. R.
(1992). AKT2, a putative oncogene encoding a member of a
subfamily of protein-serine/threonine kinases, is amplified in human ovarian
carcinomas. Proc. Natl. Acad. Sci. USA
89,9267
-9271.
Cho, H., Mu, J., Kim, J. K., Thorvaldsen, J. L., Chu, Q.,
Crenshaw, E. B., 3rd, Kaestner, K. H., Bartolomei, M. S., Shulman, G. I. and
Birnbaum, M. J. (2001a). Insulin resistance and a diabetes
mellitus-like syndrome in mice lacking the protein kinase Akt2 (PKB beta).
Science 292,1728
-1731.
Cho, H., Thorvaldsen, J. L., Chu, Q., Feng, F. and Birnbaum, M.
J. (2001b). Akt1/PKBalpha is required for normal growth but
dispensable for maintenance of glucose homeostasis in mice. J.
Biol. Chem. 276,38349
-38352.
Cross, D. A., Alessi, D. R., Cohen, P., Andjelkovich, M. and
Hemmings, B. A. (1995). Inhibition of glycogen synthase
kinase-3 by insulin mediated by protein kinase B.
Nature 378,785
-789.[CrossRef][Medline]
Dash, P. K., Mach, S. A., Moody, M. R. and Moore, A. N.
(2004). Performance in long-term memory tasks is augmented by a
phosphorylated growth factor receptor fragment. J. Neurosci.
Res. 77,205
-216.[CrossRef][Medline]
Datta, S. R., Brunet, A. and Greenberg, M. E.
(1999). Cellular survival: a play in three Akts. Genes
Dev. 13,2905
-2927.
D'Ercole, A. J., Ye, P. and O'Kusky, J. R.
(2002). Mutant mouse models of insulin-like growth factor actions
in the central nervous system. Neuropeptides
36,209
-220.[CrossRef][Medline]
Dudek, H., Datta, S. R., Franke, T. F., Birnbaum, M. J., Yao,
R., Cooper, G. M., Segal, R. A., Kaplan, D. R. and Greenberg, M. E.
(1997). Regulation of neuronal survival by the serine-threonine
protein kinase Akt. Science
275,661
-665.
Franke, T. F., Yang, S. I., Chan, T. O., Datta, K., Kazlauskas,
A., Morrison, D. K., Kaplan, D. R. and Tsichlis, P. N.
(1995). The protein kinase encoded by the Akt proto-oncogene is a
target of the PDGF-activated phosphatidylinositol 3-kinase.
Cell 81,727
-736.[CrossRef][Medline]
Garofalo, R. S., Orena, S. J., Rafidi, K., Torchia, A. J.,
Stock, J. L., Hildebrandt, A. L., Coskran, T., Black, S. C., Brees, D. J.,
Wicks, J. R. et al. (2003). Severe diabetes, age-dependent
loss of adipose tissue, and mild growth deficiency in mice lacking Akt2/PKB
beta. J. Clin. Invest.
112,197
-208.[CrossRef][Medline]
Hanada, M., Feng, J. and Hemmings, B. A.
(2004). Structure, regulation and function of PKB/AKT - a major
therapeutic target. Biochim. Biophys. Acta.
1697, 3-16.[Medline]
Inoki, K., Li, Y., Zhu, T., Wu, J. and Guan, K. L.
(2002). TSC2 is phosphorylated and inhibited by Akt and
suppresses mTOR signalling. Nat. Cell Biol.
4, 648-657.[CrossRef][Medline]
Irizarry, R. A., Bolstad, B. M., Collin, F., Cope, L. M., Hobbs,
B. and Speed, T. P. (2003). Summaries of Affymetrix GeneChip
probe level data. Nucleic Acids Res.
31, e15.
Jones, P. F., Jakubowicz, T. and Hemmings, B. A.
(1991a). Molecular cloning of a second form of rac protein
kinase. Cell Regul. 2,1001
-1009.[Medline]
Jones, P. F., Jakubowicz, T., Pitossi, F. J., Maurer, F. and
Hemmings, B. A. (1991b). Molecular cloning and identification
of a serine/threonine protein kinase of the second-messenger subfamily.
Proc. Natl. Acad. Sci. USA
88,4171
-4175.
Kandel, E. S. and Hay, N. (1999). The
regulation and activities of the multifunctional serine/threonine kinase
Akt/PKB. Exp. Cell Res.
253,210
-229.[CrossRef][Medline]
Kelly, A. and Lynch, M. A. (2000). Long-term
potentiation in dentate gyrus of the rat is inhibited by the phosphoinositide
3-kinase inhibitor, wortmannin. Neuropharmacology
39,643
-651.[CrossRef][Medline]
Kim, A. H., Yano, H., Cho, H., Meyer, D., Monks, B., Margolis,
B., Birnbaum, M. J. and Chao, M. V. (2002). Akt1 regulates a
JNK scaffold during excitotoxic apoptosis. Neuron
35,697
-709.[CrossRef][Medline]
Kooy, R. F., Verhoye, M., Lemmon, V. and Van Der Linden, A.
(2001). Brain studies of mouse models for neurogenetic disorders
using in vivo magnetic resonance imaging (MRI). Eur. J. Hum.
Genet. 9,153
-159.[CrossRef][Medline]
Kovacic, S., Soltys, C. L., Barr, A. J., Shiojima, I., Walsh, K.
and Dyck, J. R. (2003). Akt activity negatively regulates
phosphorylation of AMP-activated protein kinase in the heart. J.
Biol. Chem. 278,39422
-39427.
Kwon, C. H., Zhu, X., Zhang, J., Knoop, L. L., Tharp, R.,
Smeyne, R. J., Eberhart, C. G., Burger, P. C. and Baker, S. J.
(2001). Pten regulates neuronal soma size: a mouse model of
Lhermitte-Duclos disease. Nat. Genet.
29,404
-411.[CrossRef][Medline]
Labarca, C. and Paigen, K. (1980). A simple,
rapid, and sensitive DNA assay procedure. Anal.
Biochem. 102,344
-352.[CrossRef][Medline]
Lin, C. H., Yeh, S. H., Lu, K. T., Leu, T. H., Chang, W. C. and
Gean, P. W. (2001). A role for the PI-3 kinase signaling
pathway in fear conditioning and synaptic plasticity in the amygdala.
Neuron 31,841
-851.[CrossRef][Medline]
Mangi, A. A., Noiseux, N., Kong, D., He, H., Rezvani, M.,
Ingwall, J. S. and Dzau, V. J. (2003). Mesenchymal stem cells
modified with Akt prevent remodeling and restore performance of infarcted
hearts. Nat. Med. 9,1195
-1201.[CrossRef][Medline]
Masure, S., Haefner, B., Wesselink, J. J., Hoefnagel, E.,
Mortier, E., Verhasselt, P., Tuytelaars, A., Gordon, R. and Richardson, A.
(1999). Molecular cloning, expression and characterization of the
human serine/threonine kinase Akt-3. Eur. J. Biochem.
265,353
-360.[Medline]
Mathews, L. S., Hammer, R. E., Behringer, R. R., D'Ercole, A.
J., Bell, G. I., Brinster, R. L. and Palmiter, R. D. (1988).
Growth enhancement of transgenic mice expressing human insulin-like growth
factor I. Endocrinology
123,2827
-2833.
Meier, R., Alessi, D. R., Cron, P., Andjelkovic, M. and
Hemmings, B. A. (1997). Mitogenic activation,
phosphorylation, and nuclear translocation of protein kinase Bbeta.
J. Biol. Chem. 272,30491
-30497.
Montagne, J., Stewart, M. J., Stocker, H., Hafen, E., Kozma, S.
C. and Thomas, G. (1999). Drosophila S6 kinase: a regulator
of cell size. Science
285,2126
-2129.
Nakatani, K., Sakaue, H., Thompson, D. A., Weigel, R. J. and
Roth, R. A. (1999). Identification of a human Akt3 (protein
kinase B gamma) which contains the regulatory serine phosphorylation site.
Biochem. Biophys. Res. Commun.
257,906
-910.[CrossRef][Medline]
Natt, O., Watanabe, T., Boretius, S., Radulovic, J., Frahm, J.
and Michaelis, T. (2002). High-resolution 3D MRI of mouse
brain reveals small cerebral structures in vivo. J. Neurosci.
Methods 120,203
-209.[CrossRef][Medline]
Nicholson, K. M. and Anderson, N. G. (2002).
The protein kinase B/Akt signalling pathway in human malignancy.
Cell Signal 14,381
-395.[CrossRef][Medline]
Ninan, I. and Arancio, O. (2004). Presynaptic
CaMKII is necessary for synaptic plasticity in cultured hippocampal neurons.
Neuron 42,129
-141.[CrossRef][Medline]
Oldham, S., Montagne, J., Radimerski, T., Thomas, G. and Hafen,
E. (2000). Genetic and biochemical characterization of dTOR,
the Drosophila homolog of the target of rapamycin. Genes
Dev. 14,2689
-2694.
Peng, X. D., Xu, P. Z., Chen, M. L., Hahn-Windgassen, A., Skeen,
J., Jacobs, J., Sundararajan, D., Chen, W. S., Crawford, S. E., Coleman, K. G.
et al. (2003). Dwarfism, impaired skin development, skeletal
muscle atrophy, delayed bone development, and impeded adipogenesis in mice
lacking Akt1 and Akt2. Genes Dev.
17,1352
-1365.
Potter, C. J., Pedraza, L. G., Huang, H. and Xu, T.
(2003). The tuberous sclerosis complex (TSC) pathway and
mechanism of size control. Biochem. Soc. Trans.
31,584
-586.[CrossRef][Medline]
Powell-Braxton, L., Hollingshead, P., Warburton, C., Dowd, M.,
Pitts- Meek, S., Dalton, D., Gillett, N. and Stewart, T. A.
(1993). IGF-I is required for normal embryonic growth in mice.
Genes Dev. 7,2609
-2617.
Robles, Y., Vivas-Mejia, P. E., Ortiz-Zuazaga, H. G., Felix, J.,
Ramos, X. and Pena de Ortiz, S. (2003). Hippocampal gene
expression profiling in spatial discrimination learning. Neurobiol.
Learn Mem. 80,80
-95.[CrossRef][Medline]
Rodgers, E. E. and Theibert, A. B. (2002).
Functions of PI 3-kinase in development of the nervous system. Int.
J. Dev. Neurosci. 20,187
-197.[CrossRef][Medline]
Sanna, P. P., Cammalleri, M., Berton, F., Simpson, C., Lutjens,
R., Bloom, F. E. and Francesconi, W. (2002).
Phosphatidylinositol 3-kinase is required for the expression but not for the
induction or the maintenance of long-term potentiation in the hippocampal CA1
region. J. Neurosci. 22,3359
-3365.
Scanga, S. E., Ruel, L., Binari, R. C., Snow, B., Stambolic, V.,
Bouchard, D., Peters, M., Calvieri, B., Mak, T. W., Woodgett, J. R. et al.
(2000). The conserved PI3'K/PTEN/Akt signaling pathway
regulates both cell size and survival in Drosophila.
Oncogene 19,3971
-3977.[CrossRef][Medline]
Scheid, M. P. and Woodgett, J. R. (2001).
PKB/AKT: functional insights from genetic models. Nat. Rev. Mol.
Cell Biol. 2,760
-768.[CrossRef][Medline]
Schubert, M., Brazil, D. P., Burks, D. J., Kushner, J. A., Ye,
J., Flint, C. L., Farhang-Fallah, J., Dikkes, P., Warot, X. M., Rio, C. et
al. (2003). Insulin receptor substrate-2 deficiency impairs
brain growth and promotes tau phosphorylation. J.
Neurosci. 23,7084
-7092.
Shioi, T., McMullen, J. R., Kang, P. M., Douglas, P. S., Obata,
T., Franke, T. F., Cantley, L. C. and Izumo, S. (2002).
Akt/protein kinase B promotes organ growth in transgenic mice. Mol.
Cell Biol. 22,2799
-2809.
Stokoe, D., Stephens, L. R., Copeland, T., Gaffney, P. R.,
Reese, C. B., Painter, G. F., Holmes, A. B., McCormick, F. and Hawkins, P.
T. (1997). Dual role of
phosphatidylinositol-3,4,5-trisphosphate in the activation of protein kinase
B. Science 277,567
-570.
Tuttle, R. L., Gill, N. S., Pugh, W., Lee, J. P., Koeberlein,
B., Furth, E. E., Polonsky, K. S., Naji, A. and Birnbaum, M. J.
(2001). Regulation of pancreatic beta-cell growth and survival by
the serine/threonine protein kinase Akt1/PKBalpha. Nat.
Med. 7,1133
-1137.[CrossRef][Medline]
Verdu, J., Buratovich, M. A., Wilder, E. L. and Birnbaum, M.
J. (1999). Cell-autonomous regulation of cell and organ
growth in Drosophila by Akt/PKB. Nat. Cell Biol.
1, 500-506.[CrossRef][Medline]
Wang, Q., Liu, L., Pei, L., Ju, W., Ahmadian, G., Lu, J., Wang,
Y., Liu, F. and Wang, Y. T. (2003). Control of synaptic
strength, a novel function of Akt. Neuron
38,915
-928.[CrossRef][Medline]
Yang, J., Cron, P., Good, V. M., Thompson, V., Hemmings, B. A.
and Barford, D. (2002a). Crystal structure of an activated
Akt/Protein Kinase B ternary complex with GSK3-peptide and AMP-PNP.
Nat. Struct. Biol. 9,940
-944.[CrossRef][Medline]
Yang, J., Cron, P., Thompson, V., Good, V. M., Hess, D.,
Hemmings, B. A. and Barford, D. (2002b). Molecular mechanism
for the regulation of protein kinase B/Akt by hydrophobic motif
phosphorylation. Mol. Cell
9,1227
-1240.[CrossRef][Medline]
Yang, Z. Z., Tschopp, O., Hemmings-Mieszczak, M., Feng, J.,
Brodbeck, D., Perentes, E. and Hemmings, B. A. (2003).
Protein kinase B alpha/Akt1 regulates placental development and fetal growth.
J. Biol. Chem. 278,32124
-32131.
Yang, Z. Z., Tschopp, O., Baudry, A., Dummler, B., Hynx, D. and
Hemmings, B. A. (2004). Physiological functions of protein
kinase B/Akt. Biochem. Soc. Trans.
32,350
-354.[CrossRef][Medline]
Ye, P., Carson, J. and D'Ercole, A. J. (1995).
In vivo actions of insulin-like growth factor-I (IGF-I) on brain myelination:
studies of IGF-I and IGF binding protein-1 (IGFBP-1) transgenic mice.
J. Neurosci. 15,7344
-7356.[Abstract]
Ye, P., Li, L., Richards, R. G., DiAugustine, R. P. and
D'Ercole, A. J. (2002). Myelination is altered in
insulin-like growth factor-I null mutant mice. J.
Neurosci. 22,6041
-6051.
Zamenhof, S. and van Marthens, E. (1976).
Neonatal and adult brain parameters in mice selected for adult brain weight.
Dev. Psychobiol. 9,587
-593.[CrossRef][Medline]
Zhang, H., Stallock, J. P., Ng, J. C., Reinhard, C. and Neufeld,
T. P. (2000). Regulation of cellular growth by the Drosophila
target of rapamycin dTOR. Genes Dev.
14,2712
-2724.
This article has been cited by other articles:
![]() |
R. W. Matheny Jr. and M. L. Adamo Current Perspectives on Akt Akt-ivation and Akt-ions Experimental Biology and Medicine, November 1, 2009; 234(11): 1264 - 1270. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Mauro, J. A. McCormick, J. Wang, K. M. Boini, L. Ray, B. Monks, M. J. Birnbaum, F. Lang, and D. Pearce Akt2 and SGK3 are both determinants of postnatal hair follicle development FASEB J, September 1, 2009; 23(9): 3193 - 3202. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Di Lorenzo, C. Fernandez-Hernando, G. Cirino, and W. C. Sessa Akt1 is critical for acute inflammation and histamine-mediated vascular leakage PNAS, August 25, 2009; 106(34): 14552 - 14557. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Oishi, K. Watatani, Y. Itoh, H. Okano, F. Guillemot, K. Nakajima, and Y. Gotoh Selective induction of neocortical GABAergic neurons by the PDK1-Akt pathway through activation of Mash1 PNAS, August 4, 2009; 106(31): 13064 - 13069. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. S. Chen, X.-D. Peng, Y. Wang, P.-Z. Xu, M.-L. Chen, Y. Luo, S.-M. Jeon, K. Coleman, W. M. Haschek, J. Bass, et al. Leptin Deficiency and Beta-Cell Dysfunction Underlie Type 2 Diabetes in Compound Akt Knockout Mice Mol. Cell. Biol., June 1, 2009; 29(11): 3151 - 3162. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Mairet-Coello, A. Tury, and E. DiCicco-Bloom Insulin-Like Growth Factor-1 Promotes G1/S Cell Cycle Progression through Bidirectional Regulation of Cyclins and Cyclin-Dependent Kinase Inhibitors via the Phosphatidylinositol 3-Kinase/Akt Pathway in Developing Rat Cerebral Cortex J. Neurosci., January 21, 2009; 29(3): 775 - 788. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Surucu, L. Bozulic, D. Hynx, A. Parcellier, and B. A. Hemmings In Vivo Analysis of Protein Kinase B (PKB)/Akt Regulation in DNA-PKcs-null Mice Reveals a Role for PKB/Akt in DNA Damage Response and Tumorigenesis J. Biol. Chem., October 31, 2008; 283(44): 30025 - 30033. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Degtyarev, A. De Maziere, C. Orr, J. Lin, B. B. Lee, J. Y. Tien, W. W. Prior, S. van Dijk, H. Wu, D. C. Gray, et al. Akt inhibition promotes autophagy and sensitizes PTEN-null tumors to lysosomotropic agents J. Cell Biol., October 6, 2008; 183(1): 101 - 116. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. C. Matthews, M. J. Taggart, and M. Westwood Modulation of Caveolin-1 Expression Can Affect Signalling through the Phosphatidylinositol 3-Kinase/Akt Pathway and Cellular Proliferation in Response to Insulin-Like Growth Factor I Endocrinology, October 1, 2008; 149(10): 5199 - 5208. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. L. Wright, I. G. Maroulakou, J. Eldridge, T. L. Liby, V. Sridharan, P. N. Tsichlis, and R. C. Muise-Helmericks VEGF stimulation of mitochondrial biogenesis: requirement of AKT3 kinase FASEB J, September 1, 2008; 22(9): 3264 - 3275. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Litherland, C. Dixon, R. L. Lakey, T. Robson, D. Jones, D. A. Young, T. E. Cawston, and A. D. Rowan Synergistic Collagenase Expression and Cartilage Collagenolysis Are Phosphatidylinositol 3-Kinase/Akt Signaling-dependent J. Biol. Chem., May 23, 2008; 283(21): 14221 - 14229. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Meikle, K. Pollizzi, A. Egnor, I. Kramvis, H. Lane, M. Sahin, and D. J. Kwiatkowski Response of a Neuronal Model of Tuberous Sclerosis to Mammalian Target of Rapamycin (mTOR) Inhibitors: Effects on mTORC1 and Akt Signaling Lead to Improved Survival and Function J. Neurosci., May 21, 2008; 28(21): 5422 - 5432. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Bayascas, S. Wullschleger, K. Sakamoto, J. M. Garcia-Martinez, C. Clacher, D. Komander, D. M. F. van Aalten, K. M. Boini, F. Lang, C. Lipina, et al. Mutation of the PDK1 PH Domain Inhibits Protein Kinase B/Akt, Leading to Small Size and Insulin Resistance Mol. Cell. Biol., May 15, 2008; 28(10): 3258 - 3272. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Matsumoto, R. E. Straub, S. Marenco, K. K. Nicodemus, S.-i. Matsumoto, A. Fujikawa, S. Miyoshi, M. Shobo, S. Takahashi, J. Yarimizu, et al. The evolutionarily conserved G protein-coupled receptor SREB2/GPR85 influences brain size, behavior, and vulnerability to schizophrenia PNAS, April 22, 2008; 105(16): 6133 - 6138. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Rhodes, D. A. Heerding, D. R. Duckett, D. J. Eberwein, V. B. Knick, T. J. Lansing, R. T. McConnell, T. M. Gilmer, S.-Y. Zhang, K. Robell, et al. Characterization of an Akt Kinase Inhibitor with Potent Pharmacodynamic and Antitumor Activity Cancer Res., April 1, 2008; 68(7): 2366 - 2374. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. F. Franke Akt-interacting proteins: attractive opposites. Focus on "Carboxy-terminal modulator protein induces Akt phosphorylation and activation, thereby enhancing antiapoptotic, glycogen synthetic, and glucose uptake pathways" Am J Physiol Cell Physiol, December 1, 2007; 293(6): C1768 - C1770. [Full Text] [PDF] |
||||
![]() |
L. Logie, A. J. Ruiz-Alcaraz, M. Keane, Y. L. Woods, J. Bain, R. Marquez, D. R. Alessi, and C. Sutherland Characterization of a Protein Kinase B Inhibitor In Vitro and in Insulin-Treated Liver Cells Diabetes, September 1, 2007; 56(9): 2218 - 2227. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Hirsch, C. Costa, and E. Ciraolo Phosphoinositide 3-kinases as a common platform for multi-hormone signaling J. Endocrinol., August 1, 2007; 194(2): 243 - 256. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. F. L. O'Shaughnessy, J. C. Welti, J. C. Cooke, A. A. Avilion, B. Monks, M. J. Birnbaum, and C. Byrne AKT-dependent HspB1 (Hsp27) Activity in Epidermal Differentiation J. Biol. Chem., June 8, 2007; 282(23): 17297 - 17305. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Li, R. E. Anderson, H. Tomita, R. Adler, X. Liu, D. J. Zack, and R. V. S. Rajala Nonredundant Role of Akt2 for Neuroprotection of Rod Photoreceptor Cells from Light-Induced Cell Death J. Neurosci., January 3, 2007; 27(1): 203 - 211. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. G. Maroulakou, W. Oemler, S. P. Naber, and P. N. Tsichlis Akt1 Ablation Inhibits, whereas Akt2 Ablation Accelerates, the Development of Mammary Adenocarcinomas in Mouse Mammary Tumor Virus (MMTV)-ErbB2/Neu and MMTV-Polyoma Middle T Transgenic Mice Cancer Res., January 1, 2007; 67(1): 167 - 177. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. E. Cristiano, J. C. Chan, K. M. Hannan, N. A. Lundie, N. J. Marmy-Conus, I. G. Campbell, W. A. Phillips, M. Robbie, R. D. Hannan, and R. B. Pearson A Specific Role for AKT3 in the Genesis of Ovarian Cancer through Modulation of G2-M Phase Transition Cancer Res., December 15, 2006; 66(24): 11718 - 11725. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Shiojima and K. Walsh Regulation of cardiac growth and coronary angiogenesis by the Akt/PKB signaling pathway Genes & Dev., December 15, 2006; 20(24): 3347 - 3365. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Heron-Milhavet, C. Franckhauser, V. Rana, C. Berthenet, D. Fisher, B. A. Hemmings, A. Fernandez, and N. J. C. Lamb Only Akt1 Is Required for Proliferation, while Akt2 Promotes Cell Cycle Exit through p21 Binding Mol. Cell. Biol., November 15, 2006; 26(22): 8267 - 8280. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. G.M. van Gorp, K. M. Pomeranz, K. U. Birkenkamp, R. C-Y. Hui, E. W-F. Lam, and P. J. Coffer Chronic Protein Kinase B (PKB/c-akt) Activation Leads to Apoptosis Induced by Oxidative Stress-Mediated Foxo3a Transcriptional Up-regulation. Cancer Res., November 15, 2006; 66(22): 10760 - 10769. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Dummler, O. Tschopp, D. Hynx, Z.-Z. Yang, S. Dirnhofer, and B. A. Hemmings Life with a Single Isoform of Akt: Mice Lacking Akt2 and Akt3 Are Viable but Display Impaired Glucose Homeostasis and Growth Deficiencies Mol. Cell. Biol., November 1, 2006; 26(21): 8042 - 8051. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Otaegi, M. J. Yusta-Boyo, E. Vergano-Vera, H. R. Mendez-Gomez, A. C. Carrera, J. L. Abad, M. Gonzalez, E. J. de la Rosa, C. Vicario-Abejon, and F. de Pablo Modulation of the PI 3-kinase-Akt signalling pathway by IGF-I and PTEN regulates the differentiation of neural stem/precursor cells J. Cell Sci., July 1, 2006; 119(13): 2739 - 2748. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Baudry, Z.-Z. Yang, and B. A. Hemmings PKB{alpha} is required for adipose differentiation of mouse embryonic fibroblasts J. Cell Sci., March 1, 2006; 119(5): 889 - 897. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Granville, R. M. Memmott, J. J. Gills, and P. A. Dennis Handicapping the Race to Develop Inhibitors of the Phosphoinositide 3-Kinase/Akt/Mammalian Target of Rapamycin Pathway Clin. Cancer Res., February 1, 2006; 12(3): 679 - 689. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Fayard, L. A. Tintignac, A. Baudry, and B. A. Hemmings Protein kinase B/Akt at a glance J. Cell Sci., December 15, 2005; 118(24): 5675 - 5678. [Full Text] [PDF] |
||||
![]() |
Z.-Z. Yang, O. Tschopp, N. Di-Poi, E. Bruder, A. Baudry, B. Dummler, W. Wahli, and B. A. Hemmings Dosage-Dependent Effects of Akt1/Protein Kinase B{alpha} (PKB{alpha}) and Akt3/PKB{gamma} on Thymus, Skin, and Cardiovascular and Nervous System Development in Mice Mol. Cell. Biol., December 1, 2005; 25(23): 10407 - 10418. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||