|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 1 June 2005
doi: 10.1242/dev.01878
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1 Molecular Neurobiology Laboratory, The Salk Institute for Biological Studies,
10010 North Torrey Pines Road, La Jolla, CA 92037, USA
2 Department of Cell and Developmental Biology, Children's Medical Research
Foundation, 3333 Burnet Avenue, Cincinnati, OH 45229, USA
Author for correspondence (e-mail:
goulding{at}salk.edu)
Accepted 25 April 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Spinal cord, Gsh2, Gsh1, Mash1, Ngn1, Interneurons
| Introduction |
|---|
|
|
|---|
Much less is known about the patterning and specification of neuronal cell
types that emerge from the dorsal neural tube. Inductive signals from the
ectoderm and dorsal midline play crucial roles in generating three dorsal
interneuron cell types (Liem et al.,
1995
; Liem et al.,
1997
; Lee and Jessell,
1999
), which are denoted Class A neurons
(Gross et al., 2002
;
Muller et al., 2002
). Both
TGFß-dependent and Wnt-dependent signaling pathways are necessary for
generating Class A cell types (Lee and
Jessell, 1999
; Muller et al.,
2002
; Muroyama et al.,
2002
), whereas dI4-dI6 Class B neurons develop in a
TGFß-independent manner. To date, efforts to understand how progenitors
in the alar plate are specified have focused primarily on the roles of the
atonal-like and achaete scute-like bHLH proteins, which are expressed in
restricted populations of dorsal progenitors
(Bermingham et al., 2001
;
Gowan et al., 2001
;
Caspary and Anderson, 2003
).
Math1, for instance, is expressed in dI1 progenitors, where it functions as an
obligate determinant of dI1 identity
(Bermingham et al., 2001
).
Math1 additionally represses the expression of Ngn1 and
Ngn2, which function as proneural factors for the dI2 neuron
differentiation program (Gowan et al.,
2001
).
Although the above studies demonstrate that the Math1 and
Ngn1/Ngn2 bHLH proneural genes function as determinants of neuronal
identity, it is unlikely that these proneural bHLH proteins function as the
initial transcriptional determinants of dorsal patterning, as they are
expressed later than dorsal patterning genes such as Pax3/Pax7, Msx1,
Gsh1/Gsh2 and Dbx2 (Bang et
al., 1997
; Houzelstein et al.,
1997
) (M.G., unpublished). More importantly, the proneural bHLH
proteins are typically expressed in a mosaic expression pattern in
differentiating progenitors (Guillemot et
al., 1993
; Ma et al.,
1996
; Fode et al.,
1998
; Ma et al.,
1998
), which is more consistent with their functioning as neural
determination factors than as early DV patterning factors. It is not known,
for instance, what roles homeodomain factors such as Pax3/Pax7, Msx1/Msx2/Msx3
and Gsh1/Gsh2 play in restricting the expression, and thus activity, of these
proneural bHLH genes.
In this study, we examined the function of the Gsh genes in patterning dorsal alar plate progenitors. We show that the Gsh1 and Gsh2 homeodomain transcription factors are differentially expressed in the progenitors for dI3, dI4 and dI5 neurons. Furthermore, we provide evidence that Gsh2 and the proneural bHLH gene Mash1 function sequentially to determine dI3 identity, and that Gsh2 activates the Mash1-dependent differentiation of dI3 neurons by suppressing the expression of Ngn1 and Ngn2. We propose that Gsh2, acting in combination with other dorsal determinants downstream of TGFß signaling, subdivides the Class A progenitor domain to generate a population of Mash1+ dorsal progenitors that give rise to dI3 interneurons.
| Materials and methods |
|---|
|
|
|---|
Gsh1 WT, GCACCGCAAGGCTGCAAGTGCTCTT and ATACCATGTGAGACAGTTCTCTCTGCTAGG;
Gsh1 KO, AGCGTCGTGATTAGCGATGATGAACCA and TCCAGTTTCACTAATGACACAAACGT;
Gsh2 WT, CAAGGGTTGTCAAGTAGAGTGG and CTTCACGCGACGGTTCTGAAAC;
Neo, CAAGATGGATTGCACGCAGG and CGATGTTTCGCTTGGTGGTC; and
Mash1 WT, CTCCGGGAGCATGTCCCCAA and CCAGGACTCAATACGCAGGG.
Immunohistochemistry
Immunohistochemistry was performed as previously described
(Gross et al., 2002
;
Moran-Rivard et al., 2001
).
The following antibodies were used in this study: anti-Gsh1/2 (rabbit
polyclonal, S. Kriks), anti-Gsh2 (rabbit polyclonal, K. Campbell), anti-Mash1
(mouse monoclonal, D. Anderson), anti-Mash1 (rabbit polyclonal, Babco),
anti-Isl1/2 (mouse monoclonal 40.2.D6, DHSB), anti-Brn3a (guinea pig
polyclonal, E. Turner), anti-Foxd3 (rabbit polyclonal)
(Dottori et al., 2001
),
anti-Lhx1/5 (mouse monoclonal 4F2-10, DHSB), anti-NeuN (mouse monoclonal,
Chemicon), anti-Lbx1 (rabbit polyclonal)
(Gross et al., 2002
),
anti-Ngn1 (rabbit polyclonal, J. Johnson), Pax7 (mouse monoclonal, DSHB), and
Pax2 (rabbit polyclonal, Babco). For BrdU-labeling experiments, E10.5 mouse
embryos were pulsed for 1.5 hours in utero with bromodeoxyuridine [5 mg/ml,
0.1 ml/10 g body weight, injected intraperitoneally (i.p.)]. Previous to
incubation with anti-BrdU (rat, ImmunologicalsDirect), sections were treated
with 2N HCl for 20 minutes, and 0.1 M borate buffer (pH 8.5) for 20 minutes.
Species-specific secondary antibodies conjugated to Cy2, Cy3 and Cy5 were used
to detect primary antibodies (Jackson ImmunoResearch).
Generation of antibodies to Gsh1/2
Antibodies that specifically recognize Gsh1 and Gsh2 together were
generated by immunizing rabbits with a fusion protein containing the
C-terminal fragment of the Gsh1 protein, which included the homeodomain of the
mouse Gsh1 protein fused to glutathione-S-transferase pGEX (Pharmacia).
In ovo electroporation
Full-length cDNA for mouse Gsh2 and mouse Ngn1 was
amplified from total cDNA generated from E11.5 neural tube total RNA.
Full-length sequences were cloned into a pIRES-EGFP expression vector
(Invitrogen, modified by M. Dottori) that contains the chick beta-actin
promotor and a CMV enhancer. A full-length mouse Mash1 cDNA was
cloned into the pCAGGS expression vector.
White Leghorn eggs were incubated in a force-draft, humidified incubator at
38°C and electroporations were performed at E3. Stage HH11-13 chick
embryos were electroporated with the constructs mentioned above at a
concentration of 2.5 µg/µl, as previously described
(Muramatsu et al., 1997
).
Briefly, the DNA was injected into the lumen of the spinal cord using a
picospritzer, and then electroporated into one side of the neural tube using a
square wave BTX electroporator (six 50-msecond pulses at 25 mV). Embryos were
incubated for a further 24 or 48 hours, before being processed for
immunohistochemistry or in situ hybridization. GFP expression was used to
assess electroporation efficiency. For both the Gsh2-EGFP and
Ngn1-EGFP constructs, expression was confirmed using polyclonal
antibodies that recognize Gsh1/2 (this study) and Ngn1 (obtained from J.
Johnson), respectively.
In situ hybridization
In situ hybridization was performed as previously described
(Goulding et al., 1993
;
Dottori et al., 2001
). The in
situ probes used were mouse Gsh1
(Li et al., 1996
), mouse
Ngn1 and Ngn2 (Fode et
al., 1998
; Ma et al.,
1998
), mouse Dbx2
(Shoji et al., 1996
), mouse
Otp (Simeone et al.,
1994
), mouse Msx1
(Robert et al., 1989
), mouse
Olig3 and mouse Msx3 (G.M.L., this study).
Imaging
Fluorescence labeling in spinal cord sections was visualized using a Zeiss
LSM 510 confocal microscope. Brightfield in situ images were captured by
digital photography on a Zeiss Axioplan2 microscope with an Axiocam digital
camera. All figures were assembled for publication as Photoshop/Canvas
images.
| Results |
|---|
|
|
|---|
|
To confirm that Gsh2 is expressed in dI3, dI4 and dI5 progenitors, the spatial relationship of the Gsh2+ progenitor domain was mapped with respect to postmitotic dorsal interneuron subtypes. A comparison of Gsh2 with Lhx1/Lhx5 (dI2, dI4 and dI6 neurons), Lbx1 (dI4, dI5, dI6 neurons), Brn3a, which is expressed in dI1-3/dI5 neurons and Isl1, a marker for differentiating dI3 neurons, demonstrated that Gsh2 is selectively expressed in the progenitors for dI3, dI4 and dI5 interneurons (Fig. 1P-S). Gsh1, however, is expressed only in dI4/dI5 progenitors (data not shown). Interestingly, Gsh2 expression levels are higher in cells that lie medial to the generation zone for Isl1+ dI3 neurons (Fig. 1S), indicating an elevated expression in dI3 progenitors.
Altered dorsal interneuron development in Gsh2 mutant mice
Previous studies in Drosophila have suggested that Ind,
the fly homolog of Gsh1 and Gsh2, functions as an essential
determinant of intermediate neuroblast identity in the ventral neuroectoderm
(Weiss et al., 1998
). This
finding, together with our observation that Gsh2 expression
demarcates a domain that gives rise to three dorsal interneuron cell types,
led us to wonder whether Gsh2 might also play an essential role in
controlling the identity of dorsal interneuron subtypes. To investigate this,
we assessed the development of the early interneuron subtypes that emerge from
the dorsal neural tube of Gsh2 mutant mice
(Szucsik et al., 1997
). No
changes were seen in the expression of NeuN (Neuna60 - Mouse Genome
Informatics) or other pan-neural postmitotic markers (data not shown),
indicating that Gsh2 is not required for progenitors to exit the cell
cycle and initiate a generic program of neuronal differentiation.
|
In contrast to the normal generation of dI4 and dI5 neurons,
Isl1-expressing dI3 neurons, which also arise from Gsh2+
progenitors, were all but absent from the E10.5 Gsh2 mutant spinal
cord (Fig. 2C,I). In
particular, we observed a >90% reduction in the number of Isl1+
dI3 neurons at both E10.5 and E11.5 (Fig.
2F,L). Examination of Tlx3 expression in the E10.5 mutant spinal
cord also revealed a selective reduction in the most dorsal population of
Tlx3+ neurons (Fig.
2E, arrow) that are dI3 neurons
(Qian et al., 2002
). Further
evidence of the specific loss of postmitotic dI3 neurons comes from the near
absence of the dorsal Otp expression domain in the Gsh2
mutant spinal cord (Fig. 2K,
arrow).
In adjacent sections, a concomitant increase in the number of Foxd3+ dI2 neurons (Fig. 2B,H) was observed, demonstrating that putative dI3 neurons differentiate as dI2 neurons in the Gsh2 mutant cord. Interestingly, the increase in Foxd3+ cell numbers did not completely offset the loss of Isl1+ dI3 neurons (Fig. 2F,L), suggesting that some dI3 neurons may adopt a dI4 cell fate. Further evidence for the respecification of dI3 neurons comes from the observation that the gap that normally separates the Lhx1+/Lhx5+ dI2 neuronal domain from the Lhx1+/Lhx5+ dI4 neuronal domain was no longer present in Gsh2 mutants (Fig. 2G, see arrow). This expansion in the dorsal Lhx1/Lhx5 expression domain is consistent with the ectopic generation of dI2 neurons and, to a lesser extent, dI4 neurons, from putative dI3 progenitors.
Gsh2 is required for the proper formation of the dI3 progenitor domain
The loss of dI3 neurons in the Gsh2 mutant spinal cord led us to
question whether the patterning of neuronal precursors in the dorsal spinal
cord is altered in these mice. In particular, we were interested in
ascertaining why dI3 neurons are selectively lost, whereas dI4 and dI5 neurons
that also arise from Gsh2+ progenitors persist. Using an antibody
that recognizes both Gsh1 and Gsh2, we observed that Gsh1 continues to be
expressed in the dorsal ventricular zone of Gsh2 mutant mice
(Fig. 3B). However, the
expression domain of Gsh1 was more restricted than that of Gsh2
(Fig. 3A), encompassing only
the dI4 and dI5 progenitor populations. This more restricted pattern of
Gsh1 expression was confirmed by in situ analyses using a probe that
was specific for Gsh1 (Fig.
3C,D). Although we did observe a slight shift in the dorsal
boundary of Gsh1 expression in E10.5 Gsh2 mutants
(Fig. 3D, arrow), this shift
encompassed only part of the presumptive dI3 progenitor domain. This slight
dorsal shift in Gsh1 expression may account for the small increase in
Pax2+ dI4 neurons in the Gsh2 mutants.
The observed expansion of dI2 neurons in the Gsh2 mutant spinal cord (Fig. 2F,L) suggested that the progenitor program that specifies dI2 progenitor identity might expand ventrally as far as the Gsh1 expression domain. Consistent with this hypothesis, we observed a pronounced ventral expansion of the dorsal Ngn1 expression domain (Fig. 3E,F, brackets), together with a less marked expansion of the dorsal Ngn2 expression domain (Fig. 3K,L, brackets). An associated reduction of Mash1 expression in putative dI3 progenitors was also observed (Fig. 3G,H), further suggesting a switch from dI3 to dI2 progenitor identity. No changes, however, were observed in the expression domains of Msx1 and Olig3 (data not shown), or in the Dbx2 expression domain (Fig. 3I,J), suggesting that Gsh1 alone may maintain the integrity of the dI5/dI6 boundary. In summary, there is an expansion of the Ngn1+ dI2 progenitor domain in the Gsh2 mutant spinal cord, such that it directly abuts Gsh1/Mash1-expressing dI4 progenitors.
Gsh1 single mutants show no phenotype in the dorsal spinal cord
The relocation of the Ngn1 boundary to the dI3/dI4 boundary in the
Gsh2 mutant spinal cord, coupled with the lack of any change in the
dI5/dI6 border, indicated that Gsh1 and Gsh2 could have
overlapping and partially redundant functions in the dorsal neural tube. To
test this, we assessed the differentiation of dorsal interneuron cell types in
Gsh1 and Gsh1/Gsh2 mutants. In Gsh1 single mutants,
we observed a normal compliment of dI2, dI3, dI4 and dI5 neurons, as evidenced
by the unchanged expression of Isl1, Pax2, Lhx1/Lhx5 and Lmx1b
(Fig. 4A-D). Not surprisingly,
Gsh2 expression was maintained in the Gsh1 mutant spinal cord, which
probably accounts for the lack of change in Mash1 expression
(Fig. 4E,F). Our findings
support the idea that Gsh1 and Gsh2 are regulated
independently of each other in dorsal progenitors, and that Gsh2
function alone is sufficient for the correct specification of dI3, dI4 and dI5
progenitors.
|
|
|
The induction of Gsh2 in dorsal progenitors, including in some cells that are dorsal to the normal dI3 progenitor domain (Fig. 6M,N, arrowhead), suggested that Mash1 and Gsh2 might function by repressing the proneural program of dI2 neurons. We reasoned that Ngn1 might also be repressed by Mash1. Consistent with this hypothesis, we observed a marked reduction in Ngn1 expression following Mash1 overexpression (Fig. 6O,P). These effects were typically seen at early times after electroporation, when Mash1+ cells were still in the ventricular zone. Thus, it appears that Mash1 can repress Ngn1 in dI2 progenitors as they begin to differentiate.
It was unclear, however, whether the repression of Ngn1 was directly due to Mash1 activity or whether it represented an indirect pathway that is mediated by Gsh2. To help distinguish between these possibilities, we investigated whether Gsh2 represses Ngn1 and promotes the differentiation of dI3 neurons in the chick neural tube. Gsh2 did strongly repress Ngn1 and Ngn2 in the dorsal dI2 progenitor domain (Fig. 7G-I, arrowheads), as well as ventrally. Interestingly, Gsh2 expression also produced sporadic induction of Isl1 on the electroporated side of the neural tube (Fig. 7A-C). However, the induction of Isl1 by Gsh2 was qualitatively different than that by Mash1, in that it was far less robust (cf. Fig. 6I,J). Whereas Mash1 induced Isl1 in a cell autonomous fashion (Fig. 6I), in the Gsh2-electroporated neural tubes, many of the ectopic Isl1+ cells did not express GFP, which marks cells carrying the Gsh2 expression vector. This finding is consistent with the lack of induction of Mash1 by Gsh2 (Fig. 7D-F), and it suggests that Gsh2 is unlikely to be a direct activator of Mash1 expression.
|
|
| Discussion |
|---|
|
|
|---|
Our results provide evidence that early patterning genes, such as
Gsh2, function by restricting the expression domains of neuronal
determination genes, such as Mash1, Math1 and Ngn1/Ngn2, to
distinct subsets of dorsal progenitors. This finding raises the interesting
possibility that the proneural determination genes function as the primary
determinants of cell identity in the dorsal neural tube, and that they do so
by initiating specific differentiation programs in subsets of progenitors as
they emerge from the ventricular zone. Further support for this model comes
from previous analyses of Math1 and Ngn1/Ngn2 mutant mice
(Bermingham et al., 2001
;
Gowan et al., 2001
), and from
our analysis of the Mash1 mutant phenotype (this study). In all three
instances, the loss of proneural gene activity results in clear alterations to
cell fate. In Ngn1/Ngn2 mutant embryos, extra dI1 neurons are
produced at the expense of dI2 neurons, and the ectopic generation of dI1
neurons is accompanied by a ventral expansion of Math1
(Gowan et al., 2001
).
Conversely, in Math1 mutant embryos, there is switch from dI1 to dI2
identity, along with a dorsal expansion of Ngn1 and Ngn2
expression. In this study, we show that there are fewer dI3 neurons and an
increased number of dI2 neurons in Mash1 mutant embryos
(Fig. 6). This increase in the
generation of dI2 neurons is due to the ectopic expression of
Ngn1/Ngn2 in presumptive dI3 progenitors. Thus, alterations to
proneural bHLH expression in progenitors cause a switch in cell fate in all
three Class A neuronal cell types. Further support for the above model comes
from misexpression analyses in the chick, where overexpression of Math1,
Ngn1/Ngn2 or Mash1 redirects the differentiation program of
dorsal progenitors (Gowan et al.,
2001
; Nakada et al.,
2004
) (this study). Taken together, these findings provide support
for a model in which the Math1, Ngn1/Ngn2 and Mash1 bHLH factors function as
primary determinants of Class A identity.
|
In the chick and mouse spinal cord, the three early born Class A-type
neurons that arise from the dorsal alar plate depend on roof plate-derived
signals for their development (Liem et
al., 1997
; Muller et al.,
2002
). Genetic ablation of the roof plate or abrogation of
BMP-signaling leads to the loss of all three cell types
(Lee et al., 2000
;
Lee and Jessell, 1999
;
Wine-Lee et al., 2004
). The
progenitors for Class A neurons express Msx1, probably in response to
BMP/TGFß signaling from the dorsal midline. Interestingly, at E10.5, the
Gsh2 expression domain overlaps with Msx1 in dI3
progenitors. This indicates that Gsh2, rather than acting to repress
Msx1, acts as a modifier of the BMP-dependent Class A progenitor
program. Olig3 expression is unchanged in both the Gsh2 and
Gsh1/Gsh2 mutant spinal cord, which is again consistent with Gsh2
acting as a transcriptional modifier to suppress the dI2 program in
Msx1+/Olig3+ Class A progenitors
(Fig. 9).
|
The Mash1 and Ngn1/Ngn2 proneural genes show parallel
patterns of expression in the developing telencephalon and spinal cord.
Differentiating neurons in the Gsh2+ LGE express
Mash1, whereas those in the dorsal telencephalon express
Ngn1 and Ngn2. Moreover, the loss of Gsh2 leads to
a reduction of Mash1 expression in both the spinal cord and LGE, and
this is accompanied by a ventral expansion of the Ngn1/Ngn2
expression domain. Similarities in the expression profiles for Gsh1
and Gsh2 are also seen between the developing spinal cord and the
telencephalon, with Gsh1 showing a more restricted domain of
expression in both structures (Toresson
and Campbell, 2001
) (this study). In the developing telencephalon,
Gsh2 is highly expressed in both the medial ganglionic eminence (MGE)
and LGE, whereas Gsh1 is present at high levels in the MGE and at
diminished levels in the LGE. Consequently, the loss of striatal cell types
and the associated expansion of cortical progenitors is more pronounced in the
Gsh1/Gsh2 double mutants (Torreson and Campbell, 2001;
Yun et al., 2003
).
Gsh1 and Gsh2 therefore have overlapping and parallel
functions in both the telencephalon and the spinal cord where they specify
different dorsoventral progenitor domains.
DV patterning in vertebrates and invertebrates
In the embryonic Drosophila central nervous system, CNS neurons
and glia arise from three dorsoventral columns of progenitors in the
neuroectoderm that express the Msh (dorsal column), Ind
(intermediate column) and Vnd (ventral column) homeodomain
transcription factors. Transcriptional cross-repressive interactions between
these three transcription factors play a primary role in establishing the
columnar identity of these neural progenitors
(McDonald et al., 1998
;
Weiss et al., 1998
;
von Ohlen and Doe, 2000
).
Although the spatial expression of the Vnd, Ind and Msh
transcription factors in the Drosophila embryonic nervous system
mirrors the expression of their vertebrate homologs in the embryonic spinal
cord, there appear to be key differences in the mechanisms used to establish
these expression domains. Whereas Msh and Ind
transcriptionally repress each other, thereby establishing two non-overlapping
domains of Msh and Ind expression in the neuroectoderm, the
expression domains of Msx1 and Msx3 in the neural tube
clearly overlap with those of Gsh2 and Gsh1 at E10.5,
respectively (Fig. 5; S.K.,
unpublished). Moreover, Msx1 and Msx3 (data not shown)
expression is largely unchanged in the Gsh2 and in the
Gsh1/Gsh2 mutant spinal cord (Fig.
5, data not shown), suggesting that Gsh1 and Gsh2 do not regulate
the transcription of either gene. Olig3, which functions as a
determinant of dI1-dI3 identity and is expressed in dI1-3 progenitors at E10.5
like Msx1 (Muller et al.,
2005
), also exhibits an unchanged expression pattern in the
Gsh1/Gsh2 mutant spinal cord (Fig.
5). Indeed, we have been unable to identify any dorsal
determinant, with the exception of the proneural determination genes Ngn1,
Ngn2 and Mash1, whose expression changes in embryos lacking
either Gsh2, Gsh1, or Gsh1 and Gsh2 together.
Parallels have been drawn between the dorsoventral specification of neural
progenitors in the Drosophila ventral neuroectoderm and in the
ventricular zone of the vertebrate spinal cord. While the invertebrate and
vertebrate homologs of Vnd/Nkx, Ind/Gsh and Msh/Msx are expressed in a similar
array of dorsoventral stripes, an additional fourth progenitor domain that
expresses the Dbx class of homeodomain transcription factors is present in
vertebrates (Fjose et al.,
1994
; Pierani et al.,
2001
). These progenitors occupy an intermediate position between
the Gsh1+/Gsh2+ domain and ventral progenitors
that express Nkx2.2, Nkx2.9 and Nkx6.1 genes. Thus it
appears that the early vertebrate neural tube broadly comprises four DV
progenitor territories, which are subsequently subdivided into 11 distinct
progenitor domains. Although a Dbx gene homolog is present in
Drosophila (J. Skeath and H. Broihier, personal communication), its
expression in the developing ventral cord appears to be restricted to distinct
subsets of neuroblasts and postmitotic neurons. In the vertebrate neural tube,
Dbx2 functions as a Class 1 gene and its ventral border of expression
is regulated by Nkx6.1-dependent repressor activity
(Vallstedt et al., 2001
).
Gsh1/Gsh2 and Dbx2 form a boundary between dI5 and dI6
progenitors. However, this boundary of expression remains unaltered in the
Gsh1/Gsh2 double mutants (Fig.
5), indicating that there is no cross-repression between
Gsh1/Gsh2 and Dbx2 that plays a role in establishing the
dI5/dI6 progenitor border. Thus, although some of the DV patterning activities
of these homeodomain transcription factors have been conserved in
invertebrates and vertebrates, their expression patterns have diverged, as
have the regulatory interactions that determine their expression in CNS
progenitors.
Conclusions
In this study, we provide evidence that the Gsh class of homeodomain
transcription factors are key components of the genetic program that specifies
dI3 interneuron identity in the dorsal spinal cord
(Fig. 9). Our findings also
raise the intriguing possibility that the genetic interactions governing Class
A neuron cell fate differ from those previously described in the ventral
neuroectoderm of Drosophila and the ventral neural tube. A number of
outstanding issues remain. Do the Gsh proteins function as transcriptional
repressors and, if so, what are their transcriptional targets? Do the genetic
interactions between Gsh2 and Ngn1 represent direct
interactions or is there an intermediate factor that mediates repression of
Ngn1 by Gsh2? What is the developmental status of dI4 neuronal progenitors, as
dI4 neurons are still generated in Gsh1/Gsh2 mutants (data not
shown)? It has been noted that dI4 neurons also develop in the absence of
dorsal Wnt/BMP signaling (Muller et al.,
2002
) and Shh signaling (M.G., unpublished), suggesting that dI4
progenitors may represent a developmental ground state for the caudal neural
tube. Consistent with this hypothesis, we have observed an expansion of the
dI4 progenitor domain in older embryos that parallels a reduction in TGFß
signals in the dorsal neural tube (Gross
et al., 2002
). Finally, Gsh1/Gsh2 and Mash1 are expressed in late
born dorsal progenitors, and it would therefore be interesting to know whether
genetic interactions involving Gsh1/Gsh2 and Mash1 regulate
the development of late-born neurons that populate the substantia
gelatinosa.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Bang, A. G., Papalopulu, N., Kintner, C. and Goulding, M. D. (1997). Expression of Pax-3 is initiated in the early neural plate by posteriorizing signals produced by the organizer and by posterior non-axial mesoderm. Development 124,2075 -2085.[Abstract]
Bermingham, N. A., Hassan, B. A., Wang, V. Y., Fernandez, M., Banfi, S., Bellen, H. J., Fritzsch, B. and Zoghbi, H. Y. (2001). Proprioceptor pathway development is dependent on Math1. Neuron 30,411 -422.[CrossRef][Medline]
Briscoe, J., Sussel, L., Serup, P., Hartigan-O'Connor, D., Jessell, T. M., Rubenstein, J. L. and Ericson, J. (1999). Homeobox gene Nkx2.2 and specification of neuronal identity by graded Sonic hedgehog signalling. Nature 398,622 -627.[CrossRef][Medline]
Briscoe, J., Pierani, A., Jessell, T. M. and Ericson, J. (2000). A homeodomain protein code specifies progenitor cell identity and neuronal fate in the ventral neural tube. Cell 101,435 -445.[CrossRef][Medline]
Burrill, J., Moran, L., Saueressig, H. and Goulding, M. (1997). Pax2 is expressed in multiple spinal cord interneurons, including a population of En1+ interneurons that require Pax6 for their development. Development 124,4493 -4503.[Abstract]
Caspary, T. and Anderson, K. V. (2003). Patterning cell types in the dorsal spinal cord: what the mouse mutants say. Nat. Rev. Neurosci. 4,289 -297.[CrossRef][Medline]
Dottori, M., Gross, M. K., Labosky, P. and Goulding, M.
(2001). The winged-helix transcription factor Foxd3 suppresses
interneuron differentiation and promotes neural crest cell fate.
Development 128,4127
-4138.
Ericson, J., Rashbass, P., Schedl, A., Brenner-Morton, S., Kawakami, A., van Heyningen, V., Jessell, T. M. and Briscoe, J. (1997). Pax6 controls progenitor cell identity and neuronal fate in response to graded Shh signaling. Cell 90,169 -180.[CrossRef][Medline]
Fjose, A., Izpisua-Belmonte, J. C., Fromental-Ramain, C. and Duboule, D. (1994). Expression of the zebrafish gene hlx-1 in the prechordal plate and during CNS development. Development 120,71 -81.[Abstract]
Fode, C., Gradwohl, G., Morin, X., Dierich, A., LeMeur, M., Goridis, C. and Guillemot, F. (1998). The bHLH protein NEUROGENIN 2 is a determination factor for epibranchial placode-derived sensory neurons. Neuron 20,483 -494.[CrossRef][Medline]
Goulding, M. and Lamar, E. (2000). Neuronal patterning: Making stripes in the spinal cord. Curr. Biol. 10,R565 -R568.[CrossRef][Medline]
Goulding, M. D., Lumsden, A. and Gruss, P. (1993). Signals from the notochord regulate the region specific expression of two Pax genes in the developing spinal cord. Development 117,1001 -1017.[Abstract]
Gowan, K., Helms, A. W., Hunsaker, T. L., Collisson, T., Ebert, P. J., Odom, R. and Johnson, J. E. (2001). Crossinhibitory activities of Ngn1 and Math1 allow specification of distinct dorsal interneurons. Neuron 31,219 -232.[CrossRef][Medline]
Gross, M. K., Dottori, M. and Goulding, M. (2002). Lbx1 specifies somatosensory association interneurons in the dorsal spinal cord. Neuron 34,535 -549.[CrossRef][Medline]
Guillemot, F., Lo, L. C., Johnson, J. E., Auerbach, A., Anderson, D. J. and Joyner, A. L. (1993). Mammalian achaete-scute homolog 1 is required for the early development of olfactory and autonomic neurons. Cell 75,463 -476.[CrossRef][Medline]
Houzelstein, D., Cohen, A., Buckingham, M. E. and Robert, B. (1997). Insertional mutation of the mouse Msx1 homeobox gene by an nlacZ reporter gene. Mech. Dev. 65,123 -133.[CrossRef][Medline]
Jessell, T. M. (2000). Neuronal specification in the spinal cord: inductive signals and transcriptional codes. Nat. Rev. Genet. 1,20 -29.[CrossRef][Medline]
Lee, K. J. and Jessell, T. M. (1999). The specification of dorsal cell fates in the vertebrate central nervous system. Ann. Rev. Neurosci. 22,261 -294.[CrossRef][Medline]
Lee, K., Dietrich, P. and Jessell, T. M. (2000). Genetic ablation reveals that the roof plate is essential for dorsal interneuron specification. Nature 403,734 -740.[CrossRef][Medline]
Li, H., Zeitler, P. S., Valerius, M. T., Small, K. and Potter, S. S. (1996). Gsh-1, an orphan Hox gene, is required for normal pituitary development. EMBO J. 15,714 -724.[Medline]
Liem, K. F., Tremml, G., Roelink, H. and Jessell, T. M. (1995). Dorsal differentiation of neural plate cells induced by BMP-mediated signals from epidermal ectoderm. Cell 82,969 -979.[CrossRef][Medline]
Liem, K. F., Tremml, G. and Jessell, T. M. (1997). A role for the roof plate and its resident TGF beta-related proteins in neuronal patterning in the dorsal spinal cord. Cell 91,127 -138.[CrossRef][Medline]
Ma, Q., Kintner, C. and Anderson, D. J. (1996). Identification of neurogenin, a vertebrate neuronal determination gene. Cell 87,43 -52.[CrossRef][Medline]
Ma, Q., Chen, Z. F., Barrantes, I. B., de la Pompa, J. L. and Anderson, D. J. (1998). Neurogenin 1 is essential for the determination of neuronal precursors for proximal cranial sensory ganglia. Neuron 20,469 -482.[CrossRef][Medline]
McDonald, J. A., Holbrook, S., Isshiki, T., Weiss, J., Doe, C.
Q. and Mellerick, D. M. (1998). Dorsoventral patterning in
the Drosophila central nervous system: the vnd homeobox gene specifies ventral
column identity. Genes Dev.
12,3603
-3612.
Moran-Rivard, L., Kagawa, T., Saueressig, H., Gross, M. K., Burrill, J. and Goulding, M. (2001). Evx1 is a postmitotic determinant of V0 interneuron identity in the spinal cord. Neuron 29,385 -399.[CrossRef][Medline]
Muhr, J., Andersson, E., Persson, M., Jessell, T. M. and Ericson, J. (2001). Groucho-mediated transcriptional repression establishes progenitor cell pattern and neuronal fate in the ventral neural tube. Cell 104,861 -873.[CrossRef][Medline]
Muller, T., Brohmann, H., Pierani, A., Heppenstall, P. A., Lewin, G. R., Jessell, T. M. and Birchmeier, C. (2002). The homeodomain factor Lbx1 distinguishes two major programs of neuronal differentiation in the dorsal spinal cord. Neuron 34,551 -562.[CrossRef][Medline]
Muller, T., Anlag, K., Wildner, H., Britsch, S., Treier, M. and
Birchmeier, C. (2005). The bHLH factor Olig3 coordinates the
specification of dorsal neurons in the spinal cord. Genes
Dev. 19,733
-743.
Muramatsu, T., Mizutani, Y., Ohmori, Y. and Okumura, J. (1997). Comparison of three nonviral transfection methods for foreign gene expression in early chicken embryos in ovo. Biochem. Biophys. Res. Commun. 230,376 -380.[CrossRef][Medline]
Muroyama, Y., Fujihara, M., Ikeya, M., Kondoh, H. and Takada,
S. (2002). Wnt signaling plays an essential role in neuronal
specification of the dorsal spinal cord. Genes Dev.
16,548
-553.
Nakada, Y., Hunsaker, T. L., Henke, R. M. and Johnson, J. E.
(2004). Distinct domains within Mash1 and Math1 are required for
function in neuronal differentiation versus neuronal cell type specification.
Development 131,1319
-1330.
Novitch, B. G., Chen, A. I. and Jessell, T. M. (2001). Coordinate regulation of motor neuron subtype identity and pan-neuronal properties by the bHLH repressor Olig2. Neuron 31,773 -789.[CrossRef][Medline]
Pierani, A., Moran-Rivard, L., Sunshine, M. J., Littman, D. R., Goulding, M. and Jessell, T. M. (2001). Control of interneuron fate in the developing spinal cord by the progenitor homeodomain protein Dbx1. Neuron 29,367 -384.[CrossRef][Medline]
Qian, Y., Shirasawa, S., Chen, C. L., Cheng, L. and Ma, Q.
(2002). Proper development of relay somatic sensory neurons and
D2/D4 interneurons requires homeobox genes Rnx/Tlx-3 and Tlx-1.
Genes Dev. 16,1220
-1233.
Robert, B., Sassoon, D., Jacq, B., Gehring, W. and Buckingham, M. (1989). Hox-7, a mouse homeobox gene with a novel pattern of expression during embryogenesis. EMBO J. 8, 91-100.[Medline]
Sander, M., Paydar, S., Ericson, J., Briscoe, J., Berber, E.,
German, M., Jessell, T. M. and Rubenstein, J. L. (2000).
Ventral neural patterning by Nkx homeobox genes: Nkx6.1 controls somatic motor
neuron and ventral interneuron fates. Genes Dev.
14,2134
-2139.
Simeone, A., D'Apice, M. R., Nigro, V., Casanova, J., Graziani, F., Acampora, D. and Avantaggiato, V. (1994). Orthopedia, a novel homeobox-containing gene expressed in the developing CNS of both mouse and Drosophila. Neuron 13, 83-101.[CrossRef][Medline]
Shirasaki, R. and Pfaff, S. L. (2002). Transcriptional codes and the control of neuronal identity. Ann. Rev. Neurosci. 25,251 -281.[CrossRef][Medline]
Shoji, H., Ito, T., Wakamatsu, Y., Hayasaka, N., Ohsaki, K., Oyanagi, M., Kominami, R., Kondoh, H. and Takahashi, N. (1996). Regionalized expression of the Dbx family homeobox genes in the embryonic CNS of the mouse. Mech. Dev. 56, 25-39.[CrossRef][Medline]
Szucsik, J. C., Witte, D. P., Li, H., Pixley, S. K., Small, K. M. and Potter, S. S. (1997). Altered forebrain and hindbrain development in mice mutant for the Gsh-2 homeobox gene. Dev. Biol. 191,230 -242.[CrossRef][Medline]
Toresson, H. and Campbell, K. (2001). A role
for Gsh1 in the developing striatum and olfactory bulb of Gsh2 mutant
mice. Development 128,4769
-4780.
Toresson, H., Potter, S. S. and Campbell, K. (2000). Genetic control of dorsal-ventral identity in the telencephalon: opposing roles for Pax6 and Gsh2. Development 127,4361 -4371.[Abstract]
Vallstedt, A., Muhr, J., Pattyn, A., Pierani, A., Mendelsohn, M., Sander, M., Jessell, T. M. and Ericson, J. (2001). Different levels of repressor activity assign redundant and specific roles to Nkx6 genes in motor neuron and interneuron specification. Neuron 31,743 -755.[CrossRef][Medline]
von Ohlen, T. and Doe, C. Q. (2000). Convergence of dorsal, dpp, and egfr signaling p