|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online June 8, 2005
doi: 10.1242/10.1242/dev.01881
1 Masai Initiative Research Unit, RIKEN (The Institute of Physical and Chemical
Research), 2-1 Hirosawa, Wako-shi, Saitama 351-0198, Japan
2 Laboratory for Developmental Gene Regulation, RIKEN Brain Science Institute
and CREST, JST, 2-1 Hirosawa, Wako-shi, Saitama 351-0198, Japan
* Author for correspondence (e-mail: imasai{at}postman.riken.jp)
Accepted 27 April 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Cell cycle, Danio rerio, Histone deacetylase, Neurogenesis, Notch, Retina, Wnt, Zebrafish
| Introduction |
|---|
|
|
|---|
In various cell types, the progression of the cell cycle is regulated by
different combinations of cyclins and cyclin-dependent kinases (Cdks)
(Galderisi et al., 2003
).
However, three major types of Cdk inhibitor, Cip/Waf, Kip and Ink4 family
proteins, are important for the exit from the cell cycle
(Galderisi et al., 2003
). In
the vertebrate retina, cyclin D1 promotes the entry into the S phase
(Fantl et al., 1995
;
Sicinski et al., 1995
), while
the Kip family Cdk inhibitor, p27, plays a central role in the exit from the
cell cycle by suppressing cyclin D1 functions
(Nakayama et al., 1996
;
Geng et al., 2001
). Several
cell-extrinsic and -intrinsic factors regulating the cell cycle have been
identified (Ohnuma and Harris,
2003
; Levine and Green,
2004
; Yang, 2004
).
Wnt and Notch are the cell-extrinsic factors of the cell cycle, which
functions upstream of cyclin D1 and p27
(Kubo et al., 2003
;
Ohnuma et al., 2002
). In the
chick retina, a Wnt family protein, Wnt2b, is expressed in mitotic progenitor
cells and promotes cell proliferation
(Kubo et al., 2003
). It has
been reported that cyclin D1 is a target of ß-catenin/Lef-1, a component
of canonical Wnt signaling (Shtutman et
al., 1999
; Tetsu and
McCormick, 1999
). Notch signaling promotes the exit of retinal
progenitor cells from the cell cycle in Xenopus
(Ohnuma et al., 2002
),
although Notch plays a role in the maintenance of neural stem cells in the
brain (Ross et al., 2003
).
In zebrafish, postmitotic cells are initially generated in the ventronasal
retina adjacent to the optic stalk, and neuronal production progresses to the
entire neural retina (Hu and Easter,
1999
). Our previous study suggested that neuronal production is
initiated by the interaction between the optic stalk and the neural retina,
and that its progression to the entire neural retina is regulated by the relay
of short-range signaling (Masai et al.,
2000
). Several studies suggested that a candidate of this
short-range signaling is Hedgehog (Hh)
(Neumann and Nuesslein-Volhard,
2000
; Stenkamp and Frey,
2003
). Recently, we reported that the activation of cAMP-dependent
protein kinase (PKA) effectively inhibits the cell-cycle exit of retinoblasts
in zebrafish, and that continuous proliferation induced by the activation of
PKA depends on canonical Wnt signaling
(Masai et al, 2005
). As PKA is
an inhibitor of Hh signaling (reviewed by
Ingham and McMahon, 2001
) and
the blockade of the Hh signaling pathway shows severe defects in cell-cycle
exit of retinoblasts in zebrafish
(Stenkamp and Frey, 2003
;
Masai et al., 2005
), these
data support that Hh acts as a short-range signal to induce cell-cycle exit of
retinoblasts in the zebrafish retina. However, mechanisms underlying the
cell-cycle exit and subsequent neurogenesis after the reception of Hh signals
are largely unknown.
The acetylation and deacetylation of core histones of chromatin are among
the most important histone modifications and are essential for many biological
processes, including proliferation, differentiation and gene silencing
(reviewed by Roth et al.,
2001
; Kurdistani and
Grunstein, 2003
; Ahringer,
2000
). Histone deacetylases (Hdacs) are enzymes that remove acetyl
groups from histone lysine tails, resulting in the compaction of the chromatin
structure (de Ruijter et al.,
2003
; Marks et al.,
2003
). Hdacs are recruited to the multiprotein complex of
transcription repressors and co-repressors, and facilitate the inhibition of
target gene transcription by altering the acetylation states of chromatin
(Jepsen and Rosenfeld, 2002
;
Yang and Seto, 2003
). The Hdac
family proteins are classified into three major classes: class I (Hdac1, 2, 3,
8), class II (Hdac4, 5, 6, 7, 9, 10) and class III (Sir2-like NAD-dependent
Hdac), each of which plays different roles in cellular and developmental
processes (de Ruijter et al.,
2003
; Marks et al.,
2003
). However, the division of labor among Hdacs for various
biological processes is largely unknown.
It is generally accepted that co-repressor complexes containing N-CoR,
Bmi-1 and NRSF/REST are important for the maintenance of neural stem cells
(Hermanson et al., 2002
;
Molofsky et al., 2003
;
Kuwabara et al., 2004
).
However, there are some reports that the deacetylation and subsequent
methylation of histones promote the differentiation of neural stem cells into
neurons and glial cells. It has been reported that Hdac activity is necessary
for oligodendrocyte differentiation from rat cortical progenitor cells
(Marin-Husstege et al., 2002
).
In rat cortical progenitor cells, the methylation states of Lys4 and Lys9 of
histone H3 bound to the astrocyte-specific gene promoter is essential for
ciliary neurotrophic factor-induced astrocyte differentiation
(Song and Ghosh, 2004
). These
observations suggest that the chromatin state of regulatory genes is
dynamically regulated during development and modulates the behavior of neural
progenitors.
To clarify the mechanism that underlies the switch from proliferation to differentiation in the developing retina, we identified zebrafish mutants showing defects in neuronal differentiation. Here, we describe a zebrafish mutant, ascending and descending (add), in which retinal progenitor cells fail to exit from the cell cycle but instead continue to proliferate. The identification of the add mutational locus indicates that the add gene encodes Hdac1. The ratio of the number of differentiating cells to the total number of cells increases in proportion to Hdac activity, suggesting that Hdac is an essential component of the switch from proliferation to differentiation of retinal cells in zebrafish. Canonical Wnt signaling promotes proliferation and Notch signaling inhibits neurogenesis in zebrafish retina. We found that both the Wnt and Notch signaling pathways are activated in the add mutant retina. The cell-cycle progression and the expression of the neurogenic inhibitor in the add mutant retina are suppressed by the blockade of Wnt and Notch signaling pathways. These data suggest that Hdac1 antagonizes these signaling pathways to promote retinal neurogenesis in zebrafish. Taken together, these data suggest that Hdac1 functions as a dual switch molecule that suppresses the cell-cycle progression and the inhibition of neurogenesis in the zebrafish retina.
| Materials and methods |
|---|
|
|
|---|
Histological analysis, immunohistochemistry and whole-mount in situ hybridization
Histological analysis, immunohistochemistry and whole-mount in situ
hybridization were performed as previously described
(Masai et al., 2000
). The
antibodies used in this study were zpr1 (Oregon Monoclonal Bank, 1:500), zn5
(Oregon Monoclonal Bank, 1:50), anti-glutamine synthetase (Chemicon, 1:250),
anti-5-bromo-2'-deoxyuridine (BrdU) (Roche, 1:100), anti-Myc (Medical
& Biological Laboratories, 1:100), anti-GFP (Santa Cruz Biotechnology,
1:100) and anti-phosphorylated histone H3 (Upstate, 1:500) antibodies. Sytox
Green Nucleic Acid Stain (Molecular probes) was used at 1:50,000.
BrdU incorporation
Dechorionated embryos were soaked for 30 minutes in Ringer's solution
containing 10 mM BrdU (Sigma) and 15% dimethylsulfoxide (DMSO) at 6°C.
Alternatively, Ringer's solution with 10 mM BrdU was injected into the yolk of
embryos. After BrdU treatment, the embryos were washed, incubated for at least
1 hour in water at 28.5°C and fixed with 4% paraformaldehyde (PFA).
The ratio of the number of dividing cells to total number of retinal cells
Embryos were labeled with anti-phosphorylated histone H3 antibody and Sytox
Green Nucleic Acid Stain. These double-labeled embryos were scanned under a
LSM510 laser-scanning microscope (Carl Zeiss) to acquire images of a 1.7 µm
thick plane corresponding to the central retina. The numbers of dividing cells
and total cells were counted using one image per eye.
Cell transplantation, mutagenesis, mapping and cloning
Cell transplantation at the late blastula stage, mutagenesis and mutant
locus mapping were carried out as described previously
(Masai et al., 2003
).
Morpholino oligo injection
Morpholino oligos (Gene Tools) targeted against hdac1
(TTGTTCCTTGAGAACTCAGCGCCAT) and a five-base mismatch containing control
morpholino (TTcTTgCTTGAcAACTCAGgGCgAT) were injected at the one-cell stage at
a concentration of 0.25 mg/ml.
DNA construction and expression from constructs
To induce ectopic expression of zebrafish hdac1, its coding region
was inserted into the pCS2-MT expression vector, resulting in the addition of
the Myc-tag to N terminus of the coding region of Hdac1. The plasmid was
modified to generate the expression construct, pCS2[hsp:myc-hdac1], by
replacing the CMV promoter with zebrafish heat-shock promoter (hsp)
(Halloran et al., 2000
). The
coding regions of Xenopus p27,
N-Tcf3 and
47-ß-catenin was fused to myc-tag (Xenopus p27,
N-Tcf3) or GFP (
47-ß-catenin) and inserted into a modified
CS2 expression vector, in which the CMV promoter is replaced by hsp, to
generate pCS2[hsp:myc-p27], pCS2[hsp:myc-
N-Tcf3] and
pCS2[hsp:
47-ß-catenin-GFP], respectively. The detailed procedures
for generating these constructs have been described previously
(Masai et al., 2005
). These
constructs were injected into zebrafish fertilized eggs, and embryos were
incubated in water at 39°C for 1 hour repeatedly at 18, 26 and 42
hours-post-fertilization (hpf). After the heat-shock treatment, embryos were
reared at 28.5°C and fixed at 33 hpf (Hdac1, p27,
N-Tcf3) or 48 hpf
(
47-ß-catenin). To introduce the co-expression of Hdac1 and
47-ß-catenin, a mixture of pCS2[hsp:myc-hdac1] (30 µg/ml) and
pCS2[hsp:
47-ß-catenin-GFP] (30 µg/ml) was co-injected into
embryos. To introduce ectopic expression of NICD, transgenic embryos carrying
hsp:GAL4; UAS:NICD were incubated in water at 39°C for 1 hour repeatedly
at 18, 26 and 42 hpf, and fixed at 48 hpf.
Quantification of the ratio of BrdU incorporation
By injecting DNA constructs pCS2[hsp:myc-hdac1], pCS2[hsp:myc-p27],
pCS2[hsp:myc-
N-Tcf3] and pCS2[hsp:
47-ß-catenin-GFP],
ectopic expression was usually introduced in a mosaic manner and retinal cells
expressing these genes produced their progeny forming a columnar cluster. To
elucidate whether these genes promote the cell-cycle exit of retinal cells, we
counted the number of cell clusters that contain BrdU-positive cells, and
calculated the ratio of the number of BrdU-positive clusters to the total
number of clusters.
To examine the ratio of the number of BrdU-labeled cells to total number of cells in wild-type and add mutant retinas, two adjacent serial sections corresponding to the central retina were prepared using a cryostat. One of sections was labeled with anti-BrdU antibody and used for counting the number of BrdU-labeled cells. As HCl treatment in BrdU labeling makes nucleic acid staining with Sytox Green inefficient, the other adjacent section was stained with Sytox Green and used for counting the number of nuclei. The percentage of BrdU-positive cells to total cells in the retina was approximated as the percentage of the number of BrdU-labeled cells in one section to the number of total cells in the other adjacent section.
In the experiment of Trichostatin A (TSA) treatment, BrdU signals scanned
by a laser-scanning microscope were converted using NIH Image to a binary
scale with two digits, 0 (negative) and 1 (positive), by which the BrdU
positive area is adjusted to the outline of BrdU-positive cells. This
procedure approximated the ratio of BrdU-positive area to total area to the
ratio of the number of BrdU-positive cells to total number of cells. The ratio
of BrdU-positive area to total area was calculated as the ratio of the number
of pixels corresponding to 1 to total number of pixels corresponding to 0 and
1. The detailed procedures have been described previously
(Masai et al., 2005
).
Western blot analysis
Yolk-extirpated embryos (24 hpf) were homogenized using an extraction
buffer (50 mM Tris-HCl, pH 6.8; 2% SDS; 10% glycerol; 12% 2-mercaptoethanol)
to extract proteins. The extracted proteins were subjected to SDS-PAGE and
blotted onto a PVDF membrane (BioRad). After blocking with 5% skim milk and
0.1% Triton X in TBS, membrane filters were incubated with an anti-acetylated
histone H4 antibody or an anti-histone H4 antibody (Upstate) at 1:1,000.
Immunosignals were visualized with an alkali-phosphatase (AP)-conjugated
anti-rabbit IgG antibody (Promega) at 1:5,000.
The treatment with a Hdac inhibitor, Trichostatin A (TSA)
TSA stock solution (Sigma, 1 mg/ml in DMSO) was diluted to appropriate
concentrations for use. Embryos were soaked in a TSA-containing solution until
an appropriate stage.
Labeling for apoptosis
Embryos were fixed with 4% PFA and sectioned on a microtome cryostat.
Apoptotic cells were detected by terminal deoxynucleotidyl
transferase-mediated dUTP nick end labeling (TUNEL) using an in situ cell
death detection kit (Roche).
| Results |
|---|
|
|
|---|
tubulin antibody
(Masai et al., 2003
Our previous study showed that a zebrafish homolog of Drosophila
atonal, ath5, is expressed transiently in retinoblasts undergoing the
final mitosis and also in their postmitotic daughter cells
(Masai et al., 2000
). In wild
type, GFP expression under the control of the ath5 retinal enhancer
(ath5:GFP) (Masai et al.,
2005
) spread in the large region of the neural retina at 34 hpf
(Fig. 1D). However, ath5:GFP
expression was not observed in the add mutant retina, except in the
ventronasal region, from which retinal neurogenesis is initiated in zebrafish
(Hu and Easter, 1999
)
(Fig. 1E). The labeling of 2
dpf wild-type and add mutant retinas with zn5 antibody revealed that
the number of retinal ganglion cells markedly decreases in the add
mutant retina (Fig. 1G). At 3
dpf, double-cone type of photoreceptors differentiated to form the outer
photoreceptor layer in wild type (Fig.
1H), but the differentiation of photoreceptors was not observed in
the add mutant (Fig.
1I). At 5 dpf, Müller glial cells differentiated in wild type
(Fig. 1J), but did not
differentiate in add mutant embryos
(Fig. 1K). In addition to
severe blockade of neuronal and glial differentiation, apoptosis gradually
increased in the add mutant retinas after 3 dpf, and most retinal
cells were TUNEL positive at 5 dpf (data not shown). These data suggest that
most of retinal cells in the add mutant fail to differentiate into
neurons and glial cells, and eventually undergo apoptosis at the later stages.
As apoptosis was rarely observed in add mutant retinas at 2 dpf, we
focus on retinal phenotypes before 3 dpf in this study.
|
It has been reported that the rate of proliferation in the zebrafish retina
is regulated in a stage-dependent manner probably through the modulation of
the cell-cycle length (Li et al.,
2000
). The length of the cell cycle is estimated between 32 and 49
hours within 16-24 hpf, but abruptly shortened to about 10 hours after 24 hpf
in the developing zebrafish retina. We examined whether the rate of
proliferation is altered in the add mutant retinas. The rate of
proliferation correlates with the ratio of the number of BrdU-labeled cells or
mitotic cells to total number of cells for a given period. When BrdU was
incorporated within 90 minutes at 24 hpf, the ratio of the number of
BrdU-labeled cells to total number of cells in the add mutant retinas
was not significantly different from that in wild-type retinas
(Fig. 1R), suggesting that the
percentage of cells undergoing the S phase within 90 minutes is not
significantly altered in add mutant retinas. We also observed that
some of BrdU-positive cells undergo mitosis in wild-type and add
mutant retinas (data not shown), suggesting that the length of the G2 phase is
less than 90 minutes in both cases. The labeling of retinas with
anti-phosphorylated histone H3 antibody revealed that the ratio of the number
of dividing cells to total number of cells in the add mutant retina
is not significantly different from that in wild-type retina at 24 hpf (data
not shown) and 27 hpf (Fig.
1S), suggesting that the percentage of cells undergoing the M
phase is not altered in the add mutant retinas. These data suggest
that the rate of proliferation is similar between wild-type and add
mutant retinas. As the rate of proliferation is governed by the number of
proliferative cells and the length of the cell cycle, it seems unlikely that
the cell-cycle length is significantly altered at 24 hpf in the add
mutant retina. These data are consistent with the observation that the
morphology of the neural retina in the add mutant seems normal at 24
hpf, when neuronal differentiation begins in wild-type retinas (data not
shown). Although it is still possible that the activity of maternal Add
compensates for the defect in the cell-cycle length in the add mutant
retinas, these data suggest that the blockade of cell-cycle exit primarily
causes the overgrowth of the neural retina in add mutant embryos.
Add is required for the cell-cycle exit of retinal progenitor cells in a cell-autonomous manner
To elucidate whether the add mutation behaves in a cell-autonomous
manner, we examined the behavior of add mutant cells transplanted
into wild-type retinas and vice versa. When add mutant cells were
transplanted into wild-type retinas, add mutant cells failed to exit
from the cell cycle and continued to divide even in the wild-type environment
(Fig. 2B). In the reserve case,
when wild-type cells were transplanted into add mutant retina,
wild-type cells exited from the cell cycle and some of them differentiated
into photoreceptors in add mutant retinas
(Fig. 2D). These data suggest
that Add is required for the cell-cycle exit of retinal progenitor cells in a
cell-autonomous manner.
|
|
To elucidate the relationship between cell-cycle exit and Hdac activity, we applied TSA at different concentrations. Following the treatment of wild-type embryos with low concentrations of TSA, such as 400 nM, retinal cells differentiated and formed normal lamination at 3 dpf (Fig. 5C), and this phenotype was much milder than that in add mutant embryos. BrdU labeling of 2 dpf retinas treated with TSA at different concentrations revealed that the ratio of the number of proliferating cells to the total number of cells was proportional to the concentration of TSA (Fig. 5I). For example, almost all retinal cells were mitotic at 2 dpf in the treatment with 1200 nM TSA (Fig. 5D). A small number of postmitotic cells were generated in the presumptive retinal ganglion cell layer in the treatment with 800 nM TSA (Fig. 5E). The large population of retinal ganglion cells exited from the cell cycle in the treatment with 400 nM TSA (Fig. 5F). Almost all cells in the retinal ganglion cell and inner layers were postmitotic in the absence of TSA treatment (Fig. 5G). These observations suggest that the percentage of BrdU-positive cells correlates with the dose of TSA. Furthermore, the level of histone acetylation in these series of TSA-treated wild-type embryos correlated with the concentration of TSA applied (Fig 5H,I). Taken together, these data suggest that the ratio of the number of differentiating cells to that of proliferating cells correlates with Hdac activity.
|
|
|
N-Tcf3, which
lacks the ß-catenin-binding site, functions as a dominant suppressor of
canonical Wnt signaling (Kim et al.,
2000
N-Tcf3 significantly suppressed
BrdU incorporation in add mutant embryos
(Fig. 4;
Fig. 7C-D), suggesting that the
activation of Wnt signaling is required for continuous progression of the cell
cycle in add mutant embryos.
To elucidate whether the activation of Wnt signaling alone is sufficient to
induce hyperproliferation in the zebrafish retina, we examined the phenotypes
of retinas expressing
47-ß-catenin, which lacks N-terminal
phosphorylation sites and functions as an activated form of ß-catenin
(Chenn and Walsh, 2002
). We
injected the expression construct pCS2[hsp:
47-ß-catenin-GFP] into
wild-type embryos at one-cell stage. As GFP was fused to the C terminus of the
coding region of
47-ß-catenin, we monitored ectopic expression of
47-ß-catenin by GFP fluorescence. After heat-shock treatment, we
selected 2 dpf embryos that expressed GFP in a large region of the neural
retina (inset in Fig. 7F). In
this case, the neural retina was folded like that of add mutants
(Fig. 7E) and retinal cells
expressing
47-ß-catenin incorporated BrdU
(Fig. 7F). These data suggest
that the activation of Wnt signaling inhibits the cell-cycle exit and instead
promotes proliferation in the zebrafish retina.
To elucidate whether the introduction of Hdac1 inhibits the cell-cycle
progression induced by
47-ß-catenin, we examined the phenotypes of
retinas co-expressing
47-ß-catenin and Hdac1. A mixture of two DNA
constructs, pCS2[hsp:
47-ß-catenin-GFP] and pCS2[hsp:myc-hdac1],
was injected into fertilized eggs. Double labeling with anti-Myc and anti-GFP
antibodies confirmed that heat-shock treatment induced ectopic co-expression
of
47-ß-catenin and Hdac1 in the neural retina (data not shown).
For a statistical analysis, we selected embryos in which GFP expression was
introduced sparsely in the neural retina, and examined whether BrdU
incorporation occurs in each of GFP-positive cells/cell clusters. As a
control, retinal cells co-expressing
47-ß-catenin and EGFP
frequently incorporated BrdU even in the wild-type post-mitotic environment
(Fig. 7G-H). However, BrdU
incorporation was significantly suppressed in retinal cells co-expressing
47-ß-catenin and Hdac1, compared with that of co-expression of
47-ß-catenin and EGFP (Fig.
4; Fig. 7I-J).
These data suggest that Hdac1 antagonizes Wnt signaling to suppress the
proliferation of retinal cells in zebrafish.
|
N-Tcf3 inhibited BrdU incorporation in
add mutant retinas (Fig.
4), but did not effectively induce ath5 expression in the
add mutant retinas (Fig.
8B), suggesting that the blockade of Wnt signaling does not fully
rescue neuronal differentiation in the add mutant retina. Notch
inhibits the expression of proneural bHLH genes through the activation of the
neurogenic inhibitors Hairy/Enhancer-of-split-related (Hes)
(Artavanis-Tsakonas et al.,
1999
The Notch signaling pathway is severely inhibited in the mib
mutant (Jiang et al., 1996
)
and the mib gene encodes a RING-domain containing E3-type ubiquitin
ligase, which is required for Notch activation through its interaction with
Delta (Itoh et al., 2003
).
her4 expression was absent in the mib mutant retinas
(Fig. 8G), suggesting that
her4 expression in the zebrafish retina is regulated by Notch
signaling. Furthermore, the upregulation of her4 expression in the
add mutant retina is inhibited by the introduction of mib
mutation (Fig. 8H). These data
suggest that a high level of her4 expression in the add
mutant retina depends on the activation of Notch signaling. Taken together,
these data suggest that Hdac1 antagonizes Notch signaling to inhibit
her4 expression in the zebrafish retina. To examine whether the
activation of Wnt signaling induces her4 expression, the expression
construct pCS2[hsp:
47-ß-catenin-GFP] was injected into fertilized
wild-type eggs. After heat-shock treatment, we selected 2 dpf embryos showing
GFP expression in a large region of the neural retina. In the neural retina
expressing
47-ß-catenin, her4 expression was observed in
the central part of CMZ and the presumptive outer layer, the latter of which
is undulated along the outline of folded retinas
(Fig. 8J). It is unlikely that
canonical Wnt signaling directly activates Notch-mediated her4
expression.
|
In the 2 dpf add; mib double mutant, BrdU incorporation still
occurred in the CMZ (Fig. 9D),
where Wnt signaling is highly activated
(Fig. 7A). This observation
raises the possibility that high activation of the Wnt signaling pathway
promotes Notch-independent cell proliferation in the retina. To elucidate this
possibility, we examined BrdU incorporation in mib mutant retinas
with a highly activated Wnt signaling. We injected the expression construct
pCS2[hsp:
47-ß-catenin-GFP] into mib mutant eggs. After
heat-shock treatment, we selected 2 dpf embryos that express GFP in a large
region of neural retina (Fig.
9J, inset). We observed that cells expressing
47-ß-catenin incorporate BrdU even in the central region of
mib mutant retina (Fig.
9J), while cells expressing control EGFP were BrdU negative in the
central retina of mib mutants
(Fig. 9I). These data suggest
that Notch signaling is dispensable for the maintenance of cell proliferation
when Wnt signaling is highly activated. TSA treatment at high concentrations
or for a longer period induced more severe hyperproliferation than the
add mutation (Fig. 5B;
Fig. 9K). We examined whether
Notch signaling is required for cell proliferation induced by the treatment of
TSA in a high dose. As in the case of the mib mutant injected with
47-ß-catenin (Fig.
9J), BrdU incorporation was not inhibited in the central retina of
mib mutants treated with TSA (Fig.
9L), suggesting that Notch signaling is also dispensable for the
proliferation induced by the severe blockade of Hdac activity. These data
suggest that retinal proliferation is maintained independent of the activity
of Notch signaling, when Wnt signaling is highly activated or Hdac activity is
severely inhibited.
|
|
| Discussion |
|---|
|
|
|---|
Hdac1 antagonizes Wnt signaling to promote the cell-cycle exit of retinoblasts
Members of the Wnt growth factor family are involved in the regulation of
multiple processes during development in flies and vertebrate animals
(Wodarz and Nusse, 1998
).
Recent studies suggested that the canonical Wnt signaling promotes the
proliferation of various types of stem cell population
(Morin, 1999
;
van de Wetering et al., 2002
;
Reya et al., 2003
), including
neural progenitor cells (Chenn and Walsh,
2002
; Megason and McMahon,
2002
). In contrast to the role of Wnt signaling in the maintenance
of progenitor cells, it also promotes neuronal differentiation from neural
progenitor cells (Hirabayashi et al.,
2004
; Israsena et al.,
2004
), suggesting that Wnt signaling modulates the behavior of
stem cells in a stage-dependent manner. In the developing vertebrate retina,
Wnt signaling regulates both proliferation and neuronal differentiation. A
recent study has suggested that Wnt2b promotes the cell-cycle progression in
the chick retina (Kubo et al.,
2003
). It has been reported that a Wnt signaling molecule,
glycogen synthase kinase 3ß, modifies the activity of Xenopus
neuroD in a post-translational manner, and controls the timing of neuroD
functions (Moore et al.,
2002
).
In this study, we show that the introduction of
47-ß-catenin
induces hyperproliferation in the zebrafish retina, suggesting that the
activation of Wnt signaling promotes proliferation of retinal cells in
zebrafish. The hyperproliferation phenotype induced by
47-ß-catenin is morphologically similar to that of add
mutant retinas, raising the possibility that Wnt signaling is activated in the
add mutant retinas. Indeed, the expression of targets of canonical
Wnt signaling, such as cyclin D1 and cmyc, is elevated in
the add mutant or TSA-treated retinas. Furthermore, the
hyperproliferation of retinal cells in add mutant retina is
suppressed by the introduction of
N-Tcf3, which functions as a dominant
suppressor of canonical Wnt signaling. These data support the possibility that
aberrant activation of Wnt signaling causes the hyperproliferation in the
add mutant retinas. We also show that the introduction of Hdac1
significantly suppresses the cell-cycle progression induced by
47-ß-catenin. These data suggest that Hdac1 antagonizes Wnt
signaling to promote the cell-cycle exit of retinal progenitor cells in
zebrafish.
TSA treatment of wild-type embryos in different concentrations revealed
that the ratio of differentiation to proliferation in the zebrafish retina
correlates with the level of Hdac activity, raising the possibility that a
balance between Wnt signaling and Hdac activity is important to determine
whether retinal cells exit from the cell cycle or re-enter it. In this study,
we examined retinal phenotypes in four different combinations of Hdac and Wnt
activities: the add mutant (Hdac1, low; Wnt, intact), the
add mutant injected with
N-Tcf3 (Hdac1 low; Wnt, low), the
wild type injected with
47-ß-catenin (Hdac1, intact; Wnt, high),
and the wild type co-injected with
47-ß-catenin and Hdac1 (Hdac1,
high; Wnt, high). The phenotypes in these four combinations clearly showed
that the balance between Hdac1 and ß-catenin correlates with retinal cell
exit from or re-entry into the cell-cycle, respectively
(Fig. 10A). This is
reminiscent of previous in vitro and genetic experiments demonstrating that
the expression of Tcf target genes is regulated by a balance between
ß-catenin and Hdac/co-repressors
(Cavallo et al., 1998
;
Roose et al., 1998
;
Billin et al., 2000
). Hdac
activity may increase a threshold level of ß-catenin, at which retinal
cells respond to Wnt signals. It is interesting that the manipulation of only
two factors, Hdac1 and ß-catenin, can regulate the ratio of the number of
differentiating cells to the number of proliferating cells. This may imply
that Hdac1-mediated suppression of Wnt signaling is an essential component of
the mechanism determining the rate of neurogenesis in the zebrafish
retina.
How does Hdac1 suppress the Wnt signaling pathway? As Hdac proteins are
recruited by transcription repressors and suppress the transcription of target
genes, it is possible that Hdac1 switches off the transcription of genes that
are activated by Wnt signaling and important for cell proliferation. One of
the candidates is cyclin D1. It has been reported that cyclin
D1 is a target of canonical Wnt signaling
(Shtutman et al., 1999
;
Tetsu and McCormick, 1999
),
and that the competition between ß-catenin and Hdac proteins regulates
the transition of Tcf/Lef from a transcription repressor to an activator
(Billin et al., 2000
). We
showed that the cyclin D1 expression is not downregulated in the
add mutant retinas. Furthermore, the introduction of p27 inhibits the
cell-cycle progression in the add mutant retinas, suggesting that
Hdac1 functions upstream of the interaction between cyclin D1 and p27. These
data suggest that Hdac1 antagonizes Wnt signaling to suppress the
transcription of cyclin D1 in the zebrafish retina. If this is the
case, Hdac1 or a Hdac1-associated co-repressor directly competes with
ß-catenin to interact with the bipotential transcription factor Tcf/Lef.
Such a direct competition model between Hdac1/co-repressor and ß-catenin
seems to agree with the observation that a balance between Hdac1 and
ß-catenin correlates with the ratio of differentiating cells to
proliferating cells in the zebrafish retina.
Recent study revealed that various types of Wnt ligands are expressed in
the murine neural retina and that there is a dynamic pattern of Wnt receptor
(Frizzled) and Wnt antagonist (Secreted-frizzled-related protein, Sfrp) gene
expression in the murine neural retina
(Liu et al., 2003
), raising
the possibility that retinal cells may receive a variety of Wnt signals that
are secreted from different sources and modulated in different ways. The most
recent study using Xenopus retinas showed that Frizzled 5-mediated
canonical Wnt signaling is involved in the maintenance of the potential of
progenitor cells to generate neurons as well as their proliferation rate
(Van Raay et al., 2005
). The
blockade of Frizzled 5 in the Xenopus retina does not influence the
expression of progenitor markers such as Rx and Chx10, but biases progenitor
cells toward a non-neural fate through the inactivation of Sox2.
Hdac1-mediated inhibition of Wnt signaling may influence not only the entry of
the cell cycle but also different aspects of retinal progenitor cells, such as
the potential to generate neurons in the zebrafish retina.
Hdac1 antagonizes Notch-mediated activation of HES in the zebrafish retina
N-Tcf3 suppresses the cell-cycle progression in add mutant
retinas. However, add mutant cells expressing
N-Tcf3 fail to
express neurogenic markers such as ath5. This observation indicates
that the inhibition of Wnt signaling does not fully restore neuronal
differentiation in the add mutant retina. These data suggest that
Hdac1 also regulates Wnt-independent targets during retinal neurogenesis.
Candidates are neurogenic inhibitors such as Hes
(Hatakeyama and Kageyama,
2004
). In the Hes1 knockout mouse, retinal neurons differentiate
precociously (Tomita et al.,
1996
). In the absence of Notch signaling, a transcription factor
of the Cbf1/Su(H)/Lag1 (CSL) family associates with Hdac proteins and actively
keeps the transcription of Hes genes switched off
(Kao et al., 1998
). In this
study, we show that the expression of a zebrafish ortholog of murine Hes5,
her4, is upregulated in the add mutant retina, suggesting
that Hdac1 negatively regulates the transcription of neurogenic inhibitors
such as Hes. We found that this upregulation of her4 expression in
the add mutant retina is inhibited by the introduction of the
mib mutation, suggesting that her4 expression in the
add mutant retinas requires the activation of Notch signaling. NICD,
an active form of Notch, which is produced by ligand-dependent proteolytic
cleavages, disrupts the association of CSL with co-repressors, resulting in
the conversion of CSL from a transcription repressor to an activator
(Lai, 2004
). The decrease in
Hdac activity may facilitate the interaction between CSL and NICD to induce
her4 expression.
It has been reported that the expression of a zebrafish Hes1 ortholog,
her6, is upregulated in the hindbrain of the zebrafish hdac1
mutant (Cunliffe, 2004
), which
was isolated by the insertional mutagenesis
(Golling et al., 2002
). This
previous study, carried out by Cunliffe
(Cunliffe, 2004
), also showed
that her6 expression is not inhibited in mib mutants
injected with morpholino-antisense oligos of the hdac1 gene,
suggesting that the upregulation of her6 expression in the
hdac1 mutant hindbrain seems independent of the activation of Notch
signaling. This contrasts with our observation that the activation of Notch
signaling is required for the upregulation of her4 expression in the
add mutant retina. In mib mutants injected with
hdac1 morpholino oligos, both Notch signaling and Hdac1 activities
are attenuated, but the residual Notch signaling mediated by maternal Mib may
counter residual Hdac activity derived from other Hdac proteins to induce
her6 expression in the hindbrain. By contrast, it is possible that
maternal Hdac1 or other Hdac proteins counter Notch signaling mediated by
maternal Mib to inhibit her4 expression in the add; mib
mutant retina. However, her4 expression was not observed in the
mib mutant treated with TSA, by which almost all Hdac activity,
including maternal Hdac1 and other Hdac proteins, could be inhibited (M.Y. and
I.M., unpublished). This observation suggests that maternal Mib-mediated Notch
signaling in the retina may be too low to activate her4 expression
even in the severe blockade of Hdac activity. Previous studies have suggested
that the Notch signaling pathway is modulated by several Notch-modifying
proteins, such as Numb, Deltex and Mastermind-like (reviewed by
Hansson et al., 2004
). Such
modifications of the Notch signaling pathway may elevate the Notch signaling
activity in the hindbrain and contribute to her6 expression in
mib mutants injected with hdac1 morpholino oligos.
Notch signaling is involved in the maintenance of proliferation in the retina
Notch signaling participates in a wide variety of cellular processes,
including the maintenance of stem cells, specification of cell fate,
differentiation, proliferation and apoptosis (reviewed by
Artavanis-Tsakonas et al.,
1999
; Radtke and Raj,
2003
). Several recent reports have found that Notch signaling
promotes the maintenance of neural stem cells by enhancing the self-renewal of
neural stem cells or inhibiting their differentiation into neuronal and glial
progenitors (Nakamura et al.,
2000
; Chambers et al.,
2001
; Hitoshi et al.,
2002
; Chojnacki et al., 2003) (reviewed by
Gaiano and Fishell, 2002
;
Ross et al., 2003
). In
contrast to these studies, it has been reported that the activation of Notch
signaling promotes the cell-cycle exit of retinal progenitor cells in
Xenopus retina (Ohnuma et al.,
2002
). A previous study using the zebrafish retina showed that the
introduction of NICD using the Gal4/UAS system guides retinal cells into one
of two fates: that of Müller glia or of seemingly undifferentiated cells
(Scheer et al., 2001
).
Although Scheer et al. (Scheer et al.,
2001
) reported that the introduction of NICD reduces cell
proliferation in the zebrafish retina, a role for Notch in cell-cycle
regulation in the zebrafish retina is still not clarified.
In this study, we showed that the Notch signaling pathway fails to be
suppressed in the add mutant retinas, and that the introduction of
mib mutation inhibits continuous proliferation in the add
mutant retinas. These data suggest that Notch signaling is involved in the
maintenance of cell proliferation in the zebrafish retina. As p27 effectively
inhibits the proliferation in the add mutant retina, Notch signaling
functions upstream of the interaction between cyclin D1 and p27. It has been
reported that NICD activates the transcription of cyclin D1 probably through a
CSL-dependent pathway (Ronchini and
Capobianco, 2001
). However, we observed that NICD did not
effectively induce cyclin D1 expression in the retina (data not
shown). Alternatively, p27 may be a target of Notch signaling. It has been
reported that Hes1 promotes cell proliferation by suppressing the expression
of the Cdk inhibitor p21CIP
(Castella et al., 2000
;
Kabos et al., 2002
). The
upregulation of her4 expression in the add mutant retinas
may negatively regulate Cdk inhibitors such as p27. A recent study has
revealed that Notch signaling triggers the onset of proliferation during
Drosophila eye development (Baonza
and Freeman, 2005
). In the Drosophila eye, cells located
in the morphogenetic furrow are arrested in G1 phase of the cell cycle and
Notch signaling promotes the G1-S transition of these arrested cells by
multiple pathways including the activation of dE2F, a member of E2F
transcription factors, and cyclin A. It will be interesting to investigate
whether a similar mechanism is involved in Notch-mediated proliferation in the
zebrafish retina.
As both Wnt and Notch signaling pathways are involved in the maintenance of
cell proliferation in the zebrafish retina, it is important to elucidate the
relationship between Wnt and Notch signaling pathways. We showed that the
activation of Notch signaling does not maintain proliferation in the zebrafish
retina at 2 dpf. This contrasts with the observation that Wnt signaling is
sufficient to induce hyperproliferation in the zebrafish retina. One
possibility is that Notch signaling is one of downstream pathways activated by
Wnt signaling. However, the upregulation of her4 expression is not
observed in the retinas injected with
47-ß-catenin. Thus, it is
unlikely that Wnt signaling directly activates the Notch signaling pathway in
the zebrafish retina. In this study, we found that the activation of Notch
signaling is dispensable for retinal proliferation, when Wnt signaling is
highly activated. It is possible that a strong Wnt signal activates the
transcription of cell-cycle regulators such as cyclin D1, which may
overcome the impairment of Notch signaling. Recent study showed that the
integration of Notch and Wnt signaling is important for the maintenance of
hematopoietic stem cells (Duncan et al.,
2005
). In hematopoietic stem cells, Notch signaling is required
for the maintenance of an undifferentiated state but not for the cell-cycle
progression, both of which are mediated by Wnt signaling. It is possible that
Notch signaling is required for the maintenance of an undifferentiated state
of retinal progenitor cells, rather than for cell-cycle progression in
zebrafish. Although the activation of Wnt signaling upregulates the expression
of the Notch target Hes1 in hematopoietic stem cells
(Duncan et al., 2005
), it
would be interesting to examine whether a common mechanism underlies the
integration of Wnt and Notch signaling pathway in both zebrafish retinal
progenitor cells and mouse hematopoietic stem cells.
Does Hdac1 interact with the Hh/PKA pathway?
In this study, we show that TSA treatment decreases the number of
postmitotic differentiating cells in a dose-dependent manner. In the treatment
with TSA in a high dose, a small number of postmitotic cells are generated to
form small BrdU-negative area (Fig.
4E,F). Because the size of BrdU-negative area represents the
degree of the progression of neuronal production, these data suggest that Hdac
activity influences the progression of neuronal production in the zebrafish
retina. Our previous study suggested that the progression of neuronal
production in the zebrafish retina is regulated by Hh-PKA signaling pathway
(Masai et al., 2005
). PKA
effectively inhibits the cell-cycle exit of retinal progenitor cells, and
PKA-mediated proliferation depends on canonical Wnt signaling
(Masai et al., 2005
). These
data raise the possibility that Hdac1 antagonizes PKA signaling in retinal
neurogenesis. One of the major PKA substrates, cAMP response element-binding
protein (CREB), binds to the promoter of cell-cycle regulators such as cyclin
D1 (reviewed by Mayr and Montminy,
2001
; Lonze and Ginty,
2002
). PKA phosphorylates Ser133 of CREB and this phosphorylated
form of CREB recruits p300/CBP histone acetyltransferase (HAT) to activate the
transcription of target genes (reviewed by
Mayr and Montminy, 2001
;
Lonze and Ginty, 2002
),
including cyclin D1 (D'Amico et
al., 2000
; Pradeep et al.,
2004
). It has been reported that protein phosphatase 1 interacts
with Hdac1 to promote both the dephosphorylation of Ser133-CREB and the
deacetylation of histones bound to target genes, leading to the attenuated
transcription (Canettieri et al.,
2003
). Hdac1 may antagonize PKA-mediated CREB phosphorylation in
zebrafish retinal neurogenesis. However, our previous study demonstrated that,
unlike Hdac1, a dominant-negative form of PKA (dnPKA) does not significantly
inhibit
47-ß-catenin-induced hyperproliferation
(Masai et al., 2005
).
Furthermore, we observed that the introduction of dnPKA did not significantly
suppress the cell-cycle progression in add mutant retinas (M.Y. and
I.M., unpublished). Thus, it seems unlikely that the interaction between Hdac1
and the PKA-CREB pathway is a major pathway for suppression of the
transcription of cyclin D1 in the zebrafish retina.
Recently, it has been reported that Hdac1 is required for Hh-mediated
induction of brachiomotor neurons in the zebrafish hindbrain
(Cunliffe, 2004
). Although the
expression of sonic hedgehog (shh) and patched1 in
the ventral CNS are relatively normal, exogenous shh expression fails
to induce the differentiation of brachiomotor neurons in the zebrafish
hdac1 mutant, suggesting that hdac1-deficient cells lose the
competence to respond to Hh signals. Our previous study and others revealed
that retinal neurogenesis is delayed in a zebrafish smoothened
mutant, slow muscle omitted (smu)
(Stenkamp and Frey, 2003
;
Masai et al., 2005
). The
common defect in the cell-cycle exit of retinoblasts between the smu
and the add mutant raises the possibility that Hdac1 is involved in
the Hh signaling pathway. However, the delay of retinal neurogenesis in the
smu mutant was not enhanced in the presence of heterozygous
add mutation, and hyperproliferation in the add mutant
retina was not influenced by the introduction of heterozygous smu
mutation (M.Y. and I.M., unpublished), suggesting that there is no genetic
interaction between Smoothened and Hdac1 in retinal neurogenesis. Although
Hdac1 activity influences the progression of retinal neurogenesis, a
relationship between Hh/PKA signaling pathway and the Hdac1 pathway is
essentially unknown. In the future, it will be important to elucidate how
these two pathways are integrated to promote the cell-cycle exit and
subsequent neurogenesis in the zebrafish retina.
Other issues that should be addressed in the future
In this study, we showed that Hdac1 plays an essential role in the switch
from proliferation to differentiation in the zebrafish retina. This
anti-proliferative function of Hdac is unexpected, because it was generally
accepted that Hdac inhibitors efficiently suppress the proliferation of tumor
cells (Johnstone and Licht,
2003
). Furthermore, Hdac1-deficient mice show severe defects in
cell proliferation due to the aberrant activation of Cdk inhibitors
(Lagger et al., 2002
). The
roles of Hdacs may be diverse among species and cell types. As Hdac1-deficient
mice die before retinal neurogenesis begins, it is important to examine the
retinal phenotypes of conditional Hdac1-knockout mice, in order to elucidate
whether the role of Hdac1 in retinal neurogenesis is conserved throughout
vertebrate animals. Furthermore, we found that hyperproliferation occurs
exclusively in the neural retina but not in the brain in the add
mutants. As the treatment of embryos with TSA from 14 hpf induces
retina-specific hyperproliferation (Fig.
5E,F), it is unlikely that this retina-specific defect in the
cell-cycle exit is due to the redundancy of Hdac genes in the brain. At
present, the mechanism that underlies the retina-specific defect in the
cell-cycle exit is unknown. In the future, the identification of a molecule
that modulates a signaling network of Hdac1, Wnt, Notch and Hh-PKA pathways
will be definitely important to understand the mechanism underlying the
retina-specific hyperporliferation in the add mutant retinas.
| ACKNOWLEDGMENTS |
|---|
N-Tcf3, and Dr Randall T. Moon for TOPdGFP
transgenic fish. We thank Ms. Naoko Kume for technical support and all the
members of Masai and Okamoto's laboratories for helpful discussion. The
zebrafish lines carrying hsp: Gal4 and UAS: myc-NICD were purchased from
Zebrafish International Resource Center (Oregon). This work was supported by
grants from RIKEN BSI, and CREST, JST (H.O.), and RIKEN IRU (I.M.). | REFERENCES |
|---|
|
|
|---|
Ahringer, J. (2000). NuRD and SIN3: histone
deacetylase complexes in development. Trends Genet.
16,351
-356.[CrossRef][Medline]
Artavanis-Tsakonas, S., Rand, M. D. and Lake, R. J.
(1999). Notch signaling: cell fate control and signal integration
in development. Science
284,770
-776.
Baonza, A. and Freeman, M. (2005). Control of
cell proliferation in the Drosophila eye by Notch signaling. Dev.
Cell 8,529
-539.[CrossRef][Medline]
Billin, A. N., Thirlwell, H. and Ayer, D. E.
(2000). ß-catenin-histone deacetylase interactions regulate
the transition of LEF1 from a transcriptional repressor to an activator.
Mol. Cell. Biol. 20,6882
-6890.
Canettieri, G., Morantte, I., Guzmán, E., Asahara, H.,
Herzig, S., Anderson, S. D., Yates III, J. R. and Montminy, M.
(2003). Attenuation of a phosphorylation-dependent activator by
an HDAC-PP1 complex. Nat. Struct. Biol.
10,175
-181.[CrossRef][Medline]
Castella, P., Sawai, S., Nakao, K., Wagner, J. A. and Caudy,
M. (2000). HES-1 repression of differentiation and
proliferation in PC12 cells: role for the helix 3-helix 4 domain in
transcription repression. Mol. Cell. Biol.
20,6170
-6183.
Cavallo, R. A., Cox, R. T., Moline, M. M., Roose, J., Polevoy,
G. A., Clevers, H., Peifer, M. and Bejsovec, A. (1998).
Drosophila Tcf and Groucho interact to repress Wingless signalling
activity. Nature 395,604
-608.[CrossRef][Medline]
Chambers, C. B., Peng, Y., Nguyen, H., Gaiano, N., Fishell, G.
and Nye, J. S. (2001). Spatiotemporal selectivity of response
to Notch1 signals in mammalian forebrain precursors.
Development 128,689
-702.[Abstract]
Chenn, A. and Walsh, C. A. (2002). Regulation
of cerebral cortical size by control of cell cycle exit in neural precursors.
Science 297,365
-369.
Chojanacki, A., Shimazaki, T., Gregg, C., Weinmaster, G. and
Weiss, S. (2003). Glycoprotein 130 signaling regulates
Notch1 expression and activation in the self-renewal of mammalian
forebarin neural stem cells. J. Neurosci.
23,1730
-1741.
Chuang, J. C., Mathers, P. H. and Raymond, P. A.
(1999). Expression of three Rx homeobox genes in
embryonic and adult zebrafish. Mech. Dev.
84,195
-198.[CrossRef][Medline]
Cunliffe, V. T. (2004). Histone deacetylase 1
is required to repress Notch target gene expression during zebrafish
neurogenesis and to maintain the production of motoneurones in response to
hedgehog signalling. Development
131,2983
-2995.
D'Amico, M., Hulit, J., Amanatullah, D. F., Zafonte, B. T.,
Albanese, C., Bouzahzah, B., Fu, M., Augenlicht, L. H., Donehower, L. A.,
Takemaru, K. et al. (2000). The integrin-linked kinase
regulates the cyclin D1 gene through glycogen synthase kinase 3ß and
cAMP-responsive element-binding protein-dependent pathways. J.
Biol. Chem. 275,32649
-32657.
de Ruijter, A. J. M., van Gennip, A. H., Caron, H. N., Kemp, S.
and van Kuilenburg, A. B. P. (2003). Histone deacetylases
(HDACs): characterization of the classical HDAC family. Biochem.
J. 370,737
-749.[CrossRef][Medline]
Dorsky, R. I., Sheldahl, L. C. and Moon, R. T.
(2002). A transgenic Lef1/ß-catenin-dependent reporter is
expressed in spatially restricted domains throughout zebrafish development.
Dev. Biol. 241,229
-237.[CrossRef][Medline]
Dowling, J. (1987). The
Retina. Cambridge MA: Harvard University Press.
Duncan, A. W., Rattis, F. M., DiMascio, L. N., Congdon, K. L.,
Pazianos, G., Zhao, C., Yoon, K., Cook, J. M., Willert, K., Gaiano, N. et
al. (2005). Integration of Notch and Wnt signaling in
hematopoietic stem cells maintenance. Nat. Immunol.
6, 314-322.[CrossRef][Medline]
Fantl, V., Stamp, G., Andrews, A., Rosewell, I. and Dickson,
C. (1995). Mice lacking cyclin D1 are small and show defects
in eye and mammary gland development. Genes Dev.
9,2364
-2372.
Gaiano, N. and Fishell, G. (2002). The role of
Notch in promoting glial and neural stem cell fate. Annu.
Rev. Neurosci. 25,471
-490.[CrossRef][Medline]
Galderisi, U., Jori, F. P. and Giordano, A.
(2003). Cell cycle regulation and neural differentiation.
Oncogene 22,5208
-5219.[CrossRef][Medline]
Geng, Y., Yu, Q., Sicinska, E., Das, M., Bronson, R. T. and
Sicinski, P. (2001). Deletion of the
p27Kip1 gene restores normal development in cyclin
D1-deficient mice. Proc. Natl. Acad. Sci. USA
98,194
-199.
Golling, G., Amsterdam, A., Sun, Z., Antonelli, M., Maldonado,
E., Chen, W., Burgess, S., Haldi, M., Artzt, K., Farrington, S. et al.
(2002). Insertinal mutagenesis in zebrafish rapidly identifies
genes essential for early vertebrate development. Nat.
Genet. 31,135
-140.[CrossRef][Medline]
Halloran, M. C., Sato-Maeda, M., Warren, J. T., Su, F., Lele,
Z., Krone, P. H., Kuwada, J. Y. and Shoji, W. (2000).
Laser-induced gene expression in specific cells of transgenic zebrafish.
Development 127,1953
-1960.[Abstract]
Hansson, E. M., Lendahl, U. and Chapman, G.
(2004). Notch signaling in development and disease.
Semin. Cancer Biol. 14,320
-328.[CrossRef][Medline]
Hatakeyama, J. and Kageyama, R. (2004). Retinal
cell fate determination and bHLH factors. Semin. Cell Dev.
Biol. 15,83
-89.[CrossRef][Medline]
He, T. C., Sparks, A. B., Rago, C., Hermeking, H., Zawel, L., da
Costa, L. T., Morin, P. J., Vogelstein, B. and Kinzler, K. W.
(1998). Identification of c-MYC as a target of the APC
pathway. Science 281,1509
-1512.
Hermanson, O., Jepsen, K. and Rosenfeld, M. G.
(2002). N-CoR controls differentiation of neural stem cells into
astrocytes. Nature 419,934
-939.[CrossRef][Medline]
Hirabayashi, Y., Itoh, Y., Tabata, H., Nakajima, K., Akiyama,
T., Masuyama, N. and Gotoh, Y. (2004). The Wnt/ß-catenin
pathway directs neuronal differentiation of cortical neural precursor cells.
Development 131,2791
-2801.
Hitoshi, S., Alexson, T., Tropepe, V., Donoviel, D., Elia, A.
J., Nye, J. S., Conlon, R. A., Mak, T. W., Bernstein, A. and van der Koop,
D. (2002). Notch pathway molecules are essential for the
maintenance, but not the generation, of mammalian neural stem cells.
Genes Dev. 16,846
-858.
Hu, M. and Easter, S. S., Jr (1999). Retinal
neurogenesis: the formation of the initial central patch of postmitotic cells.
Dev Biol. 207,309
-321.[CrossRef][Medline]
Ingham, P. W. and McMahon, A. P. (2001).
Hedgehog signaling in animal development:paradigms and principles.
Genes Dev. 15,3059
-3087.
Israsena, N., Hu, M., Fu, W., Kan, L. and Kessler, J. A.
(2004). The presence of FGF2 signaling determines whether
ß-catenin exerts effects on proliferation or neuronal differentiation of
neural stem cells. Dev. Biol.
268,220
-231.[CrossRef][Medline]
Itoh, M., Kim, C.-H., Palardy, G., Oda, T., Jiang, Y.-J., Maust,
D., Yeo, S.-Y., Lorick, K., Wright, G. J., Ariza-McNaughton, L. et al.
(2003). Mind bomb is a ubiquitin ligase that is essential for
efficient activation of Notch signaling by Delta. Dev.
Cell 4,67
-82.[CrossRef][Medline]
Jepsen, K. and Rosenfeld, M. G. (2002).
Biological roles and mechanistic actions of co-repressor complexes.
J. Cell Sci. 115,689
-698.
Jiang, Y.-J., Brand, M., Heisenberg, C.-P., Beuchle, D.,
Furutani-Seiki, M., Kelsh, R. N., Warga, R. M., Granato, M., Haffter, P.,
Hammerschmidt, M. et al. (1996). Mutations affecting
neurogenesis and brain morphology in the zebrafish, Danio rerio.
Development 123,205
-216.[Abstract]
Johnstone, R. W. and Licht, J. D. (2003).
Histone deacetylase inhibitors in cancer therapy: Is transcription the primary
target? Cancer Cells 4,13
-18.[CrossRef][Medline]
Kabos, P., Kabosova, A. and Neuman, T. (2002).
Blocking HES1 expression initiates GABAergic differentiation and induces the
expression of p21CIP1/WAF1 in human neural stem cells.
J. Biol. Chem. 277,8763
-8766.
Kao, H.-Y., Ordentlich, P., Koyano-Nakagawa, N., Tang, Z.,
Downes, M., Kintner, C. R., Evans, R. M. and Kadesch, T.
(1998). A histone deacetylase corepressor complex regulates the
Notch signal transduction pathway. Genes Dev.
12,2269
-2277.
Kim, C.-H., Oda, T., Itoh, M., Jiang, D., Artinger, K. B.,
Chandrasekharappa, S. C., Driever, W. and Chitnis, A. B.
(2000). Repressor activity of Headless/Tcf3 is essential for
vertebrate head formation. Nature
407,913
-916.[CrossRef][Medline]
Kubo, F., Takeichi, M. and Nakagawa, S. (2003).
Wnt2b controls retinal cell differentiation at the ciliary marginal
zone. Development 130,587
-598.
Kurdistani, S. K. and Grunstein, M. (2003).
Histone acetylation and deacetylation in yeast. Nat. Rev. Mol.
Cell. Biol. 4,276
-284.[CrossRef][Medline]
Kuwabara, T., Hsieh, J., Nakashima, K., Taira, K. and Gage, F.
H. (2004). A small modulatory dsRNA specifies the fate of
adult neural stem cells. Cell
116,779
-793.[CrossRef][Medline]
Lagger, G., O'Carroll, D., Rembold, M., Khier, H., Tischler, J.,
Weitzer, G., Schuettengruber, B., Hauser, C., Brunmeir, R., Jenuwein, T. and
Seiser, C. (2002). Essential function of histone deacetylase
1 in proliferation control and CDK inhibitor repression. EMBO
J. 21,2672
-2681.[CrossRef][Medline]
Lai, E. C. (2004). Notch signaling: control of
cell communication and cell fate. Development
131,965
-973.
Levine, E. M. and Green, E. S. (2004).
Cell-intrinsic regulators of proliferation in vertebrate retinal progenitors.
Semin. Cell Dev. Biol.
15, 63-74.[CrossRef][Medline]
Li, Z., Hu, M., Ochocinsla, M. J., Joseph, N. M. and Easter, S.
S., Jr (2000). Modulation of cell proliferation in the
embryonic retina of zebrafish (Danio rerio). Dev.
Dyn. 219,391
-401.[CrossRef][Medline]
Liu, H., Mohamed, O., Dufort, D. and Wallace, V. A.
(2003). Characterization of Wnt signaling components and
activation of the Wnt canonical pathway in the murine retina.
Dev. Dyn. 227,323
-334.[CrossRef][Medline]
Livesey, F. J. and Cepko, C. L. (2001).
Vertebrate neural cell-fate determination: lessons from the retina.
Nat. Rev. Neurosci. 2,109
-118.[CrossRef][Medline]
Lonze, B. E. and Ginty, D. D. (2002). Function
and regulation of CREB family transcription factors in the nervous system.
Neuron 35,605
-623.[CrossRef][Medline]
Marin-Husstege, M., Muggironi, M., Liu, A. and
Casaccia-Bonnefil, P. (2002). Histone deacetylase activity is
necessary for oligodendrocyte lineage progression. J.
Neurosci. 22,10333
-10345.
Marks, P. A., Miller, T. and Richon, V. M.
(2003). Histone deacetylases. Curr. Opin.
Pharmacol. 3,344
-351.[CrossRef][Medline]
Masai, I., Stemple, D. L., Okamoto, H. and Wilson, S. W.
(2000). Midline signals regulate retinal neurogenesis in
zebrafish. Neuron 27,251
-263.[CrossRef][Medline]
Masai, I., Lele, Z., Yamaguchi, M., Komori, A., Nakata, A.,
Nishiwaki, Y., Wada, H., Tanaka, H., Nojima, Y., Hammerschmidt, M. et al.
(2003). N-cadherin mediates retinal lamination, maintenance of
forebrain compartments and patterning of retinal neurites.
Development 130,2479
-2494.
Masai, I., Yamaguchi, M., Tonou-Fujimori, N., Komori, A. and
Okamoto, H. (2005). Hedgehog-PKA pathway regulates two
distinct steps of the differentiation of retinal ganglion cells: the
cell-cycle exit of retinoblasts and their neuronal maturation.
Development 132,1539
-1553.
Mayr, B. and Montminy, M. (2001).
Transcriptional regulation by the phosphorylation-dependent factor CREB.
Nat. Rev. Mol. Cell. Biol.
2, 599-609.[CrossRef][Medline]
Megason, S. G. and McMahon, A. P. (2002). A
mitogen gradient of dorsal midline Wnts organizes growth in the CNS.
Development 129,2087
-2098.
Molofsky, A. V., Pardal, R., Iwashita, T., Park, I.-K., Clarke,
M. F. and Morrison, S. J. (2003). Bmi-1 dependence
distinguishes neural stem cell self-renewal from progenitor proliferation.
Nature 425,962
-967.[CrossRef][Medline]
Moore, K. B., Schneider, M. L. and Vetter, M. L.
(2002). Posttranslational mechanisms control the timing of bHLH
function and regulate retinal cell fate. Neuron
34,183
-195.[CrossRef][Medline]
Morin, P. J. (1999). ß-catenin signaling
and cancer. BioEssays
21,1021
-1030.[CrossRef][Medline]
Nakamura, Y., Sakakibara, S., Miyata, T., Ogawa, M., Shimazaki,
T., Weiss, S., Kageyama, R. and Okano, H. (2000). The bHLH
gene Hes1 as a repressor of the neuronal commitment of CNS stem
cells. J. Neurosci. 20,283
-293.
Nakayama, K., Ishida, N., Shirane, M., Inomata, A., Inoue, T.,
Shishido, N., Horii, I., Loh, D. Y. and Nakayama, K. (1996).
Mice lacking p27kip1 display increased body size, multiple
organ hyperplasia, retinal dysplasia, and pituitary tumors.
Cell 85,707
-720.[CrossRef][Medline]
Neumann, C. J. and Nuesslein-Volhard, C.
(2000). Patterning of the zebrafish retina by a wave of Sonic
Hedgehog activity. Science
289,2137
-2139.
Ohnuma, S. and Harris, W. A. (2003).
Neurogenesis and the cell cycle. Neuron
40,199
-208.[CrossRef][Medline]
Ohnuma, S., Philpott, A., Wang, K., Holt, C. E. and Harris, W.
A. (1999). p27Xic1, a cdk inhibitor, promotes the
determination of glial cells in Xenopus retina.
Cell 99,499
-510.[CrossRef][Medline]
Ohnuma, S., Hopper, S., Wang, K. C., Philpott, A. and Harris, W.
A. (2002). Co-ordinating retinal histogenesis: early cell
cycle exit enhances early cell fate determination in the Xenopus
retina. Development 129,2435
-2446.
Pasini, A., Jiang, Y.-J. and Wilkinson, D. G.
(2004). Two zebrafish Notch-dependent
hairy/Enhancer-of-split-related genes, her6 and
her4, are required to maintain the coordination of cyclic gene
expression in the presomitic mesoderm. Development
131,1529
-1541.
Pelengaris, S. and Khan, M. (2003). The many
faces of c-MYC. Arch. Biochem Biophys.
416,129
-136.[CrossRef][Medline]
Pradeep, A., Sharma, C., Sathyanarayana, P., Albanese, C.,
Fleming, J. V., Wang, T. C., Wolfe, M. M., Baker, K. M., Pestell, R. G. and
Rana, B. (2004). Gastrin-mediated activation of cyclin D1
transcription involves b-catenin and CREB pathways in gastric cancer cells.
Oncogene 23,3689
-3699.[CrossRef][Medline]
Radtke, F. and Raj, K. (2003). The role of
Notch in tumorigenesis: oncogene or tumour suppressors? Nat. Rev.
Cancer 3,756
-767.[CrossRef][Medline]
Reya, T., Duncan, A. W., Ailles, L., Domen, J., Scherer, D. C.,
Willert, K., Hintz, L., Nusse, R. and Weissman, I. L. (2003).
A role for Wnt signalling in self-renewal of haematopoietic stem cells.
Nature 423,409
-414.[CrossRef][Medline]
Ronchini, C. and Capobianco, A. J. (2001).
Induction of cyclin D1 treanscription and CDK2 activity by Notchic:
implication for cell cycle disruption in transformation by Notchic.
Mol. Cell. Biol. 21,5925
-5934.
Roose, J., Molenaar, M., Peterson, J., Hurenkamp, J., Brantjes,
H., Moerer, P., van de Wetering, M., Destree, O. and Clevers, H.
(1998). The Xenopus Wnt effector XTcf-3 interacts with
Groucho-related transcription repressor. Nature
395,608
-612.[CrossRef][Medline]
Ross, S. E., Greenberg, M. E. and Stiles, C. D.
(2003). Basic helix-loop-helix factors in cortical development.
Neuron 39,13
-25.[CrossRef][Medline]
Roth, S. Y., Denu, J. M. and Allis, C. D.
(2001). Histone acetyltransferases. Annu. Rev.
Biochem. 70,81
-120.[CrossRef][Medline]
Scheer, N., Groth, A., Hans, S. and Campos-Ortega, J. A.
(2001). An instructive function for Notch in promoting
gliogenesis in the zebrafish retina. Development
128,1099
-1107.[Abstract]
Schreiber-Agus, N., Horner, J., Torres, R., Chiu, F.-C. and
DePinho, R. A. (1993). Zebra fish myc family and
max genes: differential expression and oncogenic activity throughout
vertebrate evolution. Mol. Cell. Biol.
13,2765
-2775.
Shtutman, M., Zhurinsky, J., Simcha, I., Albanese, C., D'Amico,
M., Pestell, R. and Ben-Ze'ev, A. (1999). The cyclin D1 gene
is a target of the ß-catenin/LEF-1 pathway. Proc. Natl. Acad.
Sci. USA. 96,5522
-5527.
Sicinski, P., Donaher, J. L., Parker, S. B., Li, T., Fazeli, A.,
Gardner, H., Haslam, S. Z., Bronson, R. T., Elledge, S. J. and Weinberg, R.
A. (1995). Cyclin D1 provides a link between development and
oncogenesis in the retina and breast. Cell
82,621
-630.[CrossRef][Medline]
Song, M.-R. and Ghosh, A. (2004). FGF2-induced
chromatin remodeling regulates CNTF-mediated gene expression and astrocyte
differentiation. Nat. Neurosci.
7, 229-235.[CrossRef][Medline]
Stenkamp, D. L. and Frey, R. A. (2003).
Extraretinal and retinal hedgehog signaling sequentially regulate retinal
differentiation in zebrafish. Dev. Biol.
258,349
-363.[CrossRef][Medline]
Tetsu, O. and McCormick, F. (1999).
ß-Catenin regulates expression of cyclin D1 in colon carcinoma cells.
Nature 398,422
-426.[CrossRef][Medline]
Tomita, K., Ishibashi, M., Nakahara, K., Ang, S.-L., Nakanishi,
S., Guillemot, F. and Kageyama, R. (1996). Mammalian
hairy and Enhancer of Split homolog 1 regulates
differentiation of retinal neurons and is essential for eye morphogenesis.
Neuron 16,723
-734.[CrossRef][Medline]
van de Wetering, M., Sancho, E., Verweij, C., de Lau, W., Oving,
I., Hurlstone, A., van der Horn, K., Batlle, E., Coudreuse, D., Haramis, A.-P.
et al. (2002). The ß-catenin/TCF-4 complex imposes a
crypt progenitor phenotype on colorectal cancer cells.
Cell 111,241
-250.[CrossRef][Medline]
Van Raay, T. J., Moore, K. B., Iordanova, I, Steele, M.,
Jamrich, M., Harris, W. A. and Vetter, M. L. (2005). Frizzled
5 signaling governs the neural potential of progenitor in the developing
Xenopus retina. Neuron
46, 23-36.[CrossRef][Medline]
Wodarz, A. and Nusse, R. (1998). Mechanisms of
Wnt signaling in development. Annu. Rev. Cell Dev.
Biol. 14,59
-88.[CrossRef][Medline]
Yang, X.-J. (2004). Roles of cell-extrinsic
growth factors in vertebrate eye pattern formation and retinogenesis.
Semin. Cell Dev. Biol.
15, 91-103.[CrossRef][Medline]
Yang, X.-J. and Seto, E. (2003). Collaborative
spirit of histone deacetylases in regulating chromatin structure and gene
expression. Curr. Opin. Genet. Dev.
13,143
-153.[CrossRef][Medline]
Yarden, A., Salomon, D. and Geiger, B. (1995).
Zebrafish cyclin D1 is differentially expressed during early embryogenesis.
Biochim. Biophys. Acta
1264,257
-260.[Medline]
Yoshida, M., Horinouchi, S. and Beppu, T.
(1995). Trichostatin A and trapoxin: novel chemical probes for
the role of histone acetylation in chromatin structure and function.
BioEssays 17,423
-430.[CrossRef][Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
M. Agathocleous, I. Iordanova, M. I. Willardsen, X. Y. Xue, M. L. Vetter, W. A. Harris, and K. B. Moore A directional Wnt/{beta}-catenin-Sox2-proneural pathway regulates the transition from proliferation to differentiation in the Xenopus retina Development, October 1, 2009; 136(19): 3289 - 3299. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Burns, J. L. Galloway, A. C. H. Smith, M. D. Keefe, T. J. Cashman, E. J. Paik, E. A. Mayhall, A. H. Amsterdam, and L. I. Zon A genetic screen in zebrafish defines a hierarchical network of pathways required for hematopoietic stem cell emergence Blood, June 4, 2009; 113(23): 5776 - 5782. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Kubo and S. Nakagawa Hairy1 acts as a node downstream of Wnt signaling to maintain retinal stem cell-like progenitor cells in the chick ciliary marginal zone Development, June 1, 2009; 136(11): 1823 - 1833. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Haumaitre, O. Lenoir, and R. Scharfmann Histone Deacetylase Inhibitors Modify Pancreatic Cell Fate Determination and Amplify Endocrine Progenitors Mol. Cell. Biol., October 15, 2008; 28(20): 6373 - 6383. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Yamaguchi, N. Fujimori-Tonou, Y. Yoshimura, T. Kishi, H. Okamoto, and I. Masai Mutation of DNA primase causes extensive apoptosis of retinal neurons through the activation of DNA damage checkpoint and tumor suppressor p53 Development, April 1, 2008; 135(7): 1247 - 1257. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Bessa, M. J. Tavares, J. Santos, H. Kikuta, M. Laplante, T. S. Becker, J. L. Gomez-Skarmeta, and F. Casares meis1 regulates cyclin D1 and c-myc expression, and controls the proliferation of the multipotent cells in the early developing zebrafish eye Development, March 1, 2008; 135(5): 799 - 803. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Heine, E. Dohle, K. Bumsted-O'Brien, D. Engelkamp, and D. Schulte Evidence for an evolutionary conserved role of homothorax/Meis1/2 during vertebrate retina development Development, March 1, 2008; 135(5): 805 - 811. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Baye and B. A. Link Interkinetic Nuclear Migration and the Selection of Neurogenic Cell Divisions during Vertebrate Retinogenesis J. Neurosci., September 19, 2007; 27(38): 10143 - 10152. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-Y. Kim, E.-J. Ann, J.-Y. Kim, J.-S. Mo, J.-H. Park, S.-Y. Kim, M.-S. Seo, and H.-S. Park Tip60 Histone Acetyltransferase Acts as a Negative Regulator of Notch1 Signaling by Means of Acetylation Mol. Cell. Biol., September 15, 2007; 27(18): 6506 - 6519. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhu, J. Zhang, J. Tollkuhn, R. Ohsawa, E. H. Bresnick, F. Guillemot, R. Kageyama, and M. G. Rosenfeld Sustained Notch signaling in progenitors is required for sequential emergence of distinct cell lineages during organogenesis Genes & Dev., October 1, 2006; 20(19): 2739 - 2753. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. Cho and C. L. Cepko Wnt2b/{beta}-catenin-mediated canonical Wnt signaling determines the peripheral fates of the chick eye Development, August 15, 2006; 133(16): 3167 - 3177. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||