|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online June 8, 2005
doi: 10.1242/10.1242/dev.01881
1 Masai Initiative Research Unit, RIKEN (The Institute of Physical and Chemical
Research), 2-1 Hirosawa, Wako-shi, Saitama 351-0198, Japan
2 Laboratory for Developmental Gene Regulation, RIKEN Brain Science Institute
and CREST, JST, 2-1 Hirosawa, Wako-shi, Saitama 351-0198, Japan
* Author for correspondence (e-mail: imasai{at}postman.riken.jp)
Accepted 27 April 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Cell cycle, Danio rerio, Histone deacetylase, Neurogenesis, Notch, Retina, Wnt, Zebrafish
| Introduction |
|---|
|
|
|---|
In various cell types, the progression of the cell cycle is regulated by
different combinations of cyclins and cyclin-dependent kinases (Cdks)
(Galderisi et al., 2003
).
However, three major types of Cdk inhibitor, Cip/Waf, Kip and Ink4 family
proteins, are important for the exit from the cell cycle
(Galderisi et al., 2003
). In
the vertebrate retina, cyclin D1 promotes the entry into the S phase
(Fantl et al., 1995
;
Sicinski et al., 1995
), while
the Kip family Cdk inhibitor, p27, plays a central role in the exit from the
cell cycle by suppressing cyclin D1 functions
(Nakayama et al., 1996
;
Geng et al., 2001
). Several
cell-extrinsic and -intrinsic factors regulating the cell cycle have been
identified (Ohnuma and Harris,
2003
; Levine and Green,
2004
; Yang, 2004
).
Wnt and Notch are the cell-extrinsic factors of the cell cycle, which
functions upstream of cyclin D1 and p27
(Kubo et al., 2003
;
Ohnuma et al., 2002
). In the
chick retina, a Wnt family protein, Wnt2b, is expressed in mitotic progenitor
cells and promotes cell proliferation
(Kubo et al., 2003
). It has
been reported that cyclin D1 is a target of ß-catenin/Lef-1, a component
of canonical Wnt signaling (Shtutman et
al., 1999
; Tetsu and
McCormick, 1999
). Notch signaling promotes the exit of retinal
progenitor cells from the cell cycle in Xenopus
(Ohnuma et al., 2002
),
although Notch plays a role in the maintenance of neural stem cells in the
brain (Ross et al., 2003
).
In zebrafish, postmitotic cells are initially generated in the ventronasal
retina adjacent to the optic stalk, and neuronal production progresses to the
entire neural retina (Hu and Easter,
1999
). Our previous study suggested that neuronal production is
initiated by the interaction between the optic stalk and the neural retina,
and that its progression to the entire neural retina is regulated by the relay
of short-range signaling (Masai et al.,
2000
). Several studies suggested that a candidate of this
short-range signaling is Hedgehog (Hh)
(Neumann and Nuesslein-Volhard,
2000
; Stenkamp and Frey,
2003
). Recently, we reported that the activation of cAMP-dependent
protein kinase (PKA) effectively inhibits the cell-cycle exit of retinoblasts
in zebrafish, and that continuous proliferation induced by the activation of
PKA depends on canonical Wnt signaling
(Masai et al, 2005
). As PKA is
an inhibitor of Hh signaling (reviewed by
Ingham and McMahon, 2001
) and
the blockade of the Hh signaling pathway shows severe defects in cell-cycle
exit of retinoblasts in zebrafish
(Stenkamp and Frey, 2003
;
Masai et al., 2005
), these
data support that Hh acts as a short-range signal to induce cell-cycle exit of
retinoblasts in the zebrafish retina. However, mechanisms underlying the
cell-cycle exit and subsequent neurogenesis after the reception of Hh signals
are largely unknown.
The acetylation and deacetylation of core histones of chromatin are among
the most important histone modifications and are essential for many biological
processes, including proliferation, differentiation and gene silencing
(reviewed by Roth et al.,
2001
; Kurdistani and
Grunstein, 2003
; Ahringer,
2000
). Histone deacetylases (Hdacs) are enzymes that remove acetyl
groups from histone lysine tails, resulting in the compaction of the chromatin
structure (de Ruijter et al.,
2003
; Marks et al.,
2003
). Hdacs are recruited to the multiprotein complex of
transcription repressors and co-repressors, and facilitate the inhibition of
target gene transcription by altering the acetylation states of chromatin
(Jepsen and Rosenfeld, 2002
;
Yang and Seto, 2003
). The Hdac
family proteins are classified into three major classes: class I (Hdac1, 2, 3,
8), class II (Hdac4, 5, 6, 7, 9, 10) and class III (Sir2-like NAD-dependent
Hdac), each of which plays different roles in cellular and developmental
processes (de Ruijter et al.,
2003
; Marks et al.,
2003
). However, the division of labor among Hdacs for various
biological processes is largely unknown.
It is generally accepted that co-repressor complexes containing N-CoR,
Bmi-1 and NRSF/REST are important for the maintenance of neural stem cells
(Hermanson et al., 2002
;
Molofsky et al., 2003
;
Kuwabara et al., 2004
).
However, there are some reports that the deacetylation and subsequent
methylation of histones promote the differentiation of neural stem cells into
neurons and glial cells. It has been reported that Hdac activity is necessary
for oligodendrocyte differentiation from rat cortical progenitor cells
(Marin-Husstege et al., 2002
).
In rat cortical progenitor cells, the methylation states of Lys4 and Lys9 of
histone H3 bound to the astrocyte-specific gene promoter is essential for
ciliary neurotrophic factor-induced astrocyte differentiation
(Song and Ghosh, 2004
). These
observations suggest that the chromatin state of regulatory genes is
dynamically regulated during development and modulates the behavior of neural
progenitors.
To clarify the mechanism that underlies the switch from proliferation to differentiation in the developing retina, we identified zebrafish mutants showing defects in neuronal differentiation. Here, we describe a zebrafish mutant, ascending and descending (add), in which retinal progenitor cells fail to exit from the cell cycle but instead continue to proliferate. The identification of the add mutational locus indicates that the add gene encodes Hdac1. The ratio of the number of differentiating cells to the total number of cells increases in proportion to Hdac activity, suggesting that Hdac is an essential component of the switch from proliferation to differentiation of retinal cells in zebrafish. Canonical Wnt signaling promotes proliferation and Notch signaling inhibits neurogenesis in zebrafish retina. We found that both the Wnt and Notch signaling pathways are activated in the add mutant retina. The cell-cycle progression and the expression of the neurogenic inhibitor in the add mutant retina are suppressed by the blockade of Wnt and Notch signaling pathways. These data suggest that Hdac1 antagonizes these signaling pathways to promote retinal neurogenesis in zebrafish. Taken together, these data suggest that Hdac1 functions as a dual switch molecule that suppresses the cell-cycle progression and the inhibition of neurogenesis in the zebrafish retina.
| Materials and methods |
|---|
|
|
|---|
Histological analysis, immunohistochemistry and whole-mount in situ hybridization
Histological analysis, immunohistochemistry and whole-mount in situ
hybridization were performed as previously described
(Masai et al., 2000
). The
antibodies used in this study were zpr1 (Oregon Monoclonal Bank, 1:500), zn5
(Oregon Monoclonal Bank, 1:50), anti-glutamine synthetase (Chemicon, 1:250),
anti-5-bromo-2'-deoxyuridine (BrdU) (Roche, 1:100), anti-Myc (Medical
& Biological Laboratories, 1:100), anti-GFP (Santa Cruz Biotechnology,
1:100) and anti-phosphorylated histone H3 (Upstate, 1:500) antibodies. Sytox
Green Nucleic Acid Stain (Molecular probes) was used at 1:50,000.
BrdU incorporation
Dechorionated embryos were soaked for 30 minutes in Ringer's solution
containing 10 mM BrdU (Sigma) and 15% dimethylsulfoxide (DMSO) at 6°C.
Alternatively, Ringer's solution with 10 mM BrdU was injected into the yolk of
embryos. After BrdU treatment, the embryos were washed, incubated for at least
1 hour in water at 28.5°C and fixed with 4% paraformaldehyde (PFA).
The ratio of the number of dividing cells to total number of retinal cells
Embryos were labeled with anti-phosphorylated histone H3 antibody and Sytox
Green Nucleic Acid Stain. These double-labeled embryos were scanned under a
LSM510 laser-scanning microscope (Carl Zeiss) to acquire images of a 1.7 µm
thick plane corresponding to the central retina. The numbers of dividing cells
and total cells were counted using one image per eye.
Cell transplantation, mutagenesis, mapping and cloning
Cell transplantation at the late blastula stage, mutagenesis and mutant
locus mapping were carried out as described previously
(Masai et al., 2003
).
Morpholino oligo injection
Morpholino oligos (Gene Tools) targeted against hdac1
(TTGTTCCTTGAGAACTCAGCGCCAT) and a five-base mismatch containing control
morpholino (TTcTTgCTTGAcAACTCAGgGCgAT) were injected at the one-cell stage at
a concentration of 0.25 mg/ml.
DNA construction and expression from constructs
To induce ectopic expression of zebrafish hdac1, its coding region
was inserted into the pCS2-MT expression vector, resulting in the addition of
the Myc-tag to N terminus of the coding region of Hdac1. The plasmid was
modified to generate the expression construct, pCS2[hsp:myc-hdac1], by
replacing the CMV promoter with zebrafish heat-shock promoter (hsp)
(Halloran et al., 2000
). The
coding regions of Xenopus p27,
N-Tcf3 and
47-ß-catenin was fused to myc-tag (Xenopus p27,
N-Tcf3) or GFP (
47-ß-catenin) and inserted into a modified
CS2 expression vector, in which the CMV promoter is replaced by hsp, to
generate pCS2[hsp:myc-p27], pCS2[hsp:myc-
N-Tcf3] and
pCS2[hsp:
47-ß-catenin-GFP], respectively. The detailed procedures
for generating these constructs have been described previously
(Masai et al., 2005
). These
constructs were injected into zebrafish fertilized eggs, and embryos were
incubated in water at 39°C for 1 hour repeatedly at 18, 26 and 42
hours-post-fertilization (hpf). After the heat-shock treatment, embryos were
reared at 28.5°C and fixed at 33 hpf (Hdac1, p27,
N-Tcf3) or 48 hpf
(
47-ß-catenin). To introduce the co-expression of Hdac1 and
47-ß-catenin, a mixture of pCS2[hsp:myc-hdac1] (30 µg/ml) and
pCS2[hsp:
47-ß-catenin-GFP] (30 µg/ml) was co-injected into
embryos. To introduce ectopic expression of NICD, transgenic embryos carrying
hsp:GAL4; UAS:NICD were incubated in water at 39°C for 1 hour repeatedly
at 18, 26 and 42 hpf, and fixed at 48 hpf.
Quantification of the ratio of BrdU incorporation
By injecting DNA constructs pCS2[hsp:myc-hdac1], pCS2[hsp:myc-p27],
pCS2[hsp:myc-
N-Tcf3] and pCS2[hsp:
47-ß-catenin-GFP],
ectopic expression was usually introduced in a mosaic manner and retinal cells
expressing these genes produced their progeny forming a columnar cluster. To
elucidate whether these genes promote the cell-cycle exit of retinal cells, we
counted the number of cell clusters that contain BrdU-positive cells, and
calculated the ratio of the number of BrdU-positive clusters to the total
number of clusters.
To examine the ratio of the number of BrdU-labeled cells to total number of cells in wild-type and add mutant retinas, two adjacent serial sections corresponding to the central retina were prepared using a cryostat. One of sections was labeled with anti-BrdU antibody and used for counting the number of BrdU-labeled cells. As HCl treatment in BrdU labeling makes nucleic acid staining with Sytox Green inefficient, the other adjacent section was stained with Sytox Green and used for counting the number of nuclei. The percentage of BrdU-positive cells to total cells in the retina was approximated as the percentage of the number of BrdU-labeled cells in one section to the number of total cells in the other adjacent section.
In the experiment of Trichostatin A (TSA) treatment, BrdU signals scanned
by a laser-scanning microscope were converted using NIH Image to a binary
scale with two digits, 0 (negative) and 1 (positive), by which the BrdU
positive area is adjusted to the outline of BrdU-positive cells. This
procedure approximated the ratio of BrdU-positive area to total area to the
ratio of the number of BrdU-positive cells to total number of cells. The ratio
of BrdU-positive area to total area was calculated as the ratio of the number
of pixels corresponding to 1 to total number of pixels corresponding to 0 and
1. The detailed procedures have been described previously
(Masai et al., 2005
).
Western blot analysis
Yolk-extirpated embryos (24 hpf) were homogenized using an extraction
buffer (50 mM Tris-HCl, pH 6.8; 2% SDS; 10% glycerol; 12% 2-mercaptoethanol)
to extract proteins. The extracted proteins were subjected to SDS-PAGE and
blotted onto a PVDF membrane (BioRad). After blocking with 5% skim milk and
0.1% Triton X in TBS, membrane filters were incubated with an anti-acetylated
histone H4 antibody or an anti-histone H4 antibody (Upstate) at 1:1,000.
Immunosignals were visualized with an alkali-phosphatase (AP)-conjugated
anti-rabbit IgG antibody (Promega) at 1:5,000.
The treatment with a Hdac inhibitor, Trichostatin A (TSA)
TSA stock solution (Sigma, 1 mg/ml in DMSO) was diluted to appropriate
concentrations for use. Embryos were soaked in a TSA-containing solution until
an appropriate stage.
Labeling for apoptosis
Embryos were fixed with 4% PFA and sectioned on a microtome cryostat.
Apoptotic cells were detected by terminal deoxynucleotidyl
transferase-mediated dUTP nick end labeling (TUNEL) using an in situ cell
death detection kit (Roche).
| Results |
|---|
|
|
|---|
tubulin antibody
(Masai et al., 2003
Our previous study showed that a zebrafish homolog of Drosophila
atonal, ath5, is expressed transiently in retinoblasts undergoing the
final mitosis and also in their postmitotic daughter cells
(Masai et al., 2000
). In wild
type, GFP expression under the control of the ath5 retinal enhancer
(ath5:GFP) (Masai et al.,
2005
) spread in the large region of the neural retina at 34 hpf
(Fig. 1D). However, ath5:GFP
expression was not observed in the add mutant retina, except in the
ventronasal region, from which retinal neurogenesis is initiated in zebrafish
(Hu and Easter, 1999
)
(Fig. 1E). The labeling of 2
dpf wild-type and add mutant retinas with zn5 antibody revealed that
the number of retinal ganglion cells markedly decreases in the add
mutant retina (Fig. 1G). At 3
dpf, double-cone type of photoreceptors differentiated to form the outer
photoreceptor layer in wild type (Fig.
1H), but the differentiation of photoreceptors was not observed in
the add mutant (Fig.
1I). At 5 dpf, Müller glial cells differentiated in wild type
(Fig. 1J), but did not
differentiate in add mutant embryos
(Fig. 1K). In addition to
severe blockade of neuronal and glial differentiation, apoptosis gradually
increased in the add mutant retinas after 3 dpf, and most retinal
cells were TUNEL positive at 5 dpf (data not shown). These data suggest that
most of retinal cells in the add mutant fail to differentiate into
neurons and glial cells, and eventually undergo apoptosis at the later stages.
As apoptosis was rarely observed in add mutant retinas at 2 dpf, we
focus on retinal phenotypes before 3 dpf in this study.
|
It has been reported that the rate of proliferation in the zebrafish retina
is regulated in a stage-dependent manner probably through the modulation of
the cell-cycle length (Li et al.,
2000
). The length of the cell cycle is estimated between 32 and 49
hours within 16-24 hpf, but abruptly shortened to about 10 hours after 24 hpf
in the developing zebrafish retina. We examined whether the rate of
proliferation is altered in the add mutant retinas. The rate of
proliferation correlates with the ratio of the number of BrdU-labeled cells or
mitotic cells to total number of cells for a given period. When BrdU was
incorporated within 90 minutes at 24 hpf, the ratio of the number of
BrdU-labeled cells to total number of cells in the add mutant retinas
was not significantly different from that in wild-type retinas
(Fig. 1R), suggesting that the
percentage of cells undergoing the S phase within 90 minutes is not
significantly altered in add mutant retinas. We also observed that
some of BrdU-positive cells undergo mitosis in wild-type and add
mutant retinas (data not shown), suggesting that the length of the G2 phase is
less than 90 minutes in both cases. The labeling of retinas with
anti-phosphorylated histone H3 antibody revealed that the ratio of the number
of dividing cells to total number of cells in the add mutant retina
is not significantly different from that in wild-type retina at 24 hpf (data
not shown) and 27 hpf (Fig.
1S), suggesting that the percentage of cells undergoing the M
phase is not altered in the add mutant retinas. These data suggest
that the rate of proliferation is similar between wild-type and add
mutant retinas. As the rate of proliferation is governed by the number of
proliferative cells and the length of the cell cycle, it seems unlikely that
the cell-cycle length is significantly altered at 24 hpf in the add
mutant retina. These data are consistent with the observation that the
morphology of the neural retina in the add mutant seems normal at 24
hpf, when neuronal differentiation begins in wild-type retinas (data not
shown). Although it is still possible that the activity of maternal Add
compensates for the defect in the cell-cycle length in the add mutant
retinas, these data suggest that the blockade of cell-cycle exit primarily
causes the overgrowth of the neural retina in add mutant embryos.
Add is required for the cell-cycle exit of retinal progenitor cells in a cell-autonomous manner
To elucidate whether the add mutation behaves in a cell-autonomous
manner, we examined the behavior of add mutant cells transplanted
into wild-type retinas and vice versa. When add mutant cells were
transplanted into wild-type retinas, add mutant cells failed to exit
from the cell cycle and continued to divide even in the wild-type environment
(Fig. 2B). In the reserve case,
when wild-type cells were transplanted into add mutant retina,
wild-type cells exited from the cell cycle and some of them differentiated
into photoreceptors in add mutant retinas
(Fig. 2D). These data suggest
that Add is required for the cell-cycle exit of retinal progenitor cells in a
cell-autonomous manner.
|
|
To elucidate the relationship between cell-cycle exit and Hdac activity, we applied TSA at different concentrations. Following the treatment of wild-type embryos with low concentrations of TSA, such as 400 nM, retinal cells differentiated and formed normal lamination at 3 dpf (Fig. 5C), and this phenotype was much milder than that in add mutant embryos. BrdU labeling of 2 dpf retinas treated with TSA at different concentrations revealed that the ratio of the number of proliferating cells to the total number of cells was proportional to the concentration of TSA (Fig. 5I). For example, almost all retinal cells were mitotic at 2 dpf in the treatment with 1200 nM TSA (Fig. 5D). A small number of postmitotic cells were generated in the presumptive retinal ganglion cell layer in the treatment with 800 nM TSA (Fig. 5E). The large population of retinal ganglion cells exited from the cell cycle in the treatment with 400 nM TSA (Fig. 5F). Almost all cells in the retinal ganglion cell and inner layers were postmitotic in the absence of TSA treatment (Fig. 5G). These observations suggest that the percentage of BrdU-positive cells correlates with the dose of TSA. Furthermore, the level of histone acetylation in these series of TSA-treated wild-type embryos correlated with the concentration of TSA applied (Fig 5H,I). Taken together, these data suggest that the ratio of the number of differentiating cells to that of proliferating cells correlates with Hdac activity.
|
|
|
N-Tcf3, which
lacks the ß-catenin-binding site, functions as a dominant suppressor of
canonical Wnt signaling (Kim et al.,
2000
N-Tcf3 significantly suppressed
BrdU incorporation in add mutant embryos
(Fig. 4;
Fig. 7C-D), suggesting that the
activation of Wnt signaling is required for continuous progression of the cell
cycle in add mutant embryos.
To elucidate whether the activation of Wnt signaling alone is sufficient to
induce hyperproliferation in the zebrafish retina, we examined the phenotypes
of retinas expressing
47-ß-catenin, which lacks N-terminal
phosphorylation sites and functions as an activated form of ß-catenin
(Chenn and Walsh, 2002
). We
injected the expression construct pCS2[hsp:
47-ß-catenin-GFP] into
wild-type embryos at one-cell stage. As GFP was fused to the C terminus of the
coding region of
47-ß-catenin, we monitored ectopic expression of
47-ß-catenin by GFP fluorescence. After heat-shock treatment, we
selected 2 dpf embryos that expressed GFP in a large region of the neural
retina (inset in Fig. 7F). In
this case, the neural retina was folded like that of add mutants
(Fig. 7E) and retinal cells
expressing
47-ß-catenin incorporated BrdU
(Fig. 7F). These data suggest
that the activation of Wnt signaling inhibits the cell-cycle exit and instead
promotes proliferation in the zebrafish retina.
To elucidate whether the introduction of Hdac1 inhibits the cell-cycle
progression induced by
47-ß-catenin, we examined the phenotypes of
retinas co-expressing
47-ß-catenin and Hdac1. A mixture of two DNA
constructs, pCS2[hsp:
47-ß-catenin-GFP] and pCS2[hsp:myc-hdac1],
was injected into fertilized eggs. Double labeling with anti-Myc and anti-GFP
antibodies confirmed that heat-shock treatment induced ectopic co-expression
of
47-ß-catenin and Hdac1 in the neural retina (data not shown).
For a statistical analysis, we selected embryos in which GFP expression was
introduced sparsely in the neural retina, and examined whether BrdU
incorporation occurs in each of GFP-positive cells/cell clusters. As a
control, retinal cells co-expressing
47-ß-catenin and EGFP
frequently incorporated BrdU even in the wild-type post-mitotic environment
(Fig. 7G-H). However, BrdU
incorporation was significantly suppressed in retinal cells co-expressing
47-ß-catenin and Hdac1, compared with that of co-expression of
47-ß-catenin and EGFP (Fig.
4; Fig. 7I-J).
These data suggest that Hdac1 antagonizes Wnt signaling to suppress the
proliferation of retinal cells in zebrafish.
|
N-Tcf3 inhibited BrdU incorporation in
add mutant retinas (Fig.
4), but did not effectively induce ath5 expression in the
add mutant retinas (Fig.
8B), suggesting that the blockade of Wnt signaling does not fully
rescue neuronal differentiation in the add mutant retina. Notch
inhibits the expression of proneural bHLH genes through the activation of the
neurogenic inhibitors Hairy/Enhancer-of-split-related (Hes)
(Artavanis-Tsakonas et al.,
1999
The Notch signaling pathway is severely inhibited in the mib
mutant (Jiang et al., 1996
)
and the mib gene encodes a RING-domain containing E3-type ubiquitin
ligase, which is required for Notch activation through its interaction with
Delta (Itoh et al., 2003
).
her4 expression was absent in the mib mutant retinas
(Fig. 8G), suggesting that
her4 expression in the zebrafish retina is regulated by Notch
signaling. Furthermore, the upregulation of her4 expression in the
add mutant retina is inhibited by the introduction of mib
mutation (Fig. 8H). These data
suggest that a high level of her4 expression in the add
mutant retina depends on the activation of Notch signaling. Taken together,
these data suggest that Hdac1 antagonizes Notch signaling to inhibit
her4 expression in the zebrafish retina. To examine whether the
activation of Wnt signaling induces her4 expression, the expression
construct pCS2[hsp:
47-ß-catenin-GFP] was injected into fertilized
wild-type eggs. After heat-shock treatment, we selected 2 dpf embryos showing
GFP expression in a large region of the neural retina. In the neural retina
expressing
47-ß-catenin, her4 expression was observed in
the central part of CMZ and the presumptive outer layer, the latter of which
is undulated along the outline of folded retinas
(Fig. 8J). It is unlikely that
canonical Wnt signaling directly activates Notch-mediated her4
expression.
|
In the 2 dpf add; mib double mutant, BrdU incorporation still
occurred in the CMZ (Fig. 9D),
where Wnt signaling is highly activated
(Fig. 7A). This observation
raises the possibility that high activation of the Wnt signaling pathway
promotes Notch-independent cell proliferation in the retina. To elucidate this
possibility, we examined BrdU incorporation in mib mutant retinas
with a highly activated Wnt signaling. We injected the expression construct
pCS2[hsp:
47-ß-catenin-GFP] into mib mutant eggs. After
heat-shock treatment, we selected 2 dpf embryos that express GFP in a large
region of neural retina (Fig.
9J, inset). We observed that cells expressing
47-ß-catenin incorporate BrdU even in the central region of
mib mutant retina (Fig.
9J), while cells expressing control EGFP were BrdU negative in the
central retina of mib mutants
(Fig. 9I). These data suggest
that Notch signaling is dispensable for the maintenance of cell proliferation
when Wnt signaling is highly activated. TSA treatment at high concentrations
or for a longer period induced more severe hyperproliferation than the
add mutation (Fig. 5B;
Fig. 9K). We examined whether
Notch signaling is required for cell proliferation induced by the treatment of
TSA in a high dose. As in the case of the mib mutant injected with
47-ß-catenin (Fig.
9J), BrdU incorporation was not inhibited in the central retina of
mib mutants treated with TSA (Fig.
9L), suggesting that Notch signaling is also dispensable for the
proliferation induced by the severe blockade of Hdac activity. These data
suggest that retinal proliferation is maintained independent of the activity
of Notch signaling, when Wnt signaling is highly activated or Hdac activity is
severely inhibited.
|
|
| Discussion |
|---|
|
|
|---|
Hdac1 antagonizes Wnt signaling to promote the cell-cycle exit of retinoblasts
Members of the Wnt growth factor family are involved in the regulation of
multiple processes during development in flies and vertebrate animals
(Wodarz and Nusse, 1998
).
Recent studies suggested that the canonical Wnt signaling promotes the
proliferation of various types of stem cell population
(Morin, 1999
;
van de Wetering et al., 2002
;
Reya et al., 2003
), including
neural progenitor cells (Chenn and Walsh,
2002
; Megason and McMahon,
2002
). In contrast to the role of Wnt signaling in the maintenance
of progenitor cells, it also promotes neuronal differentiation from neural
progenitor cells (Hirabayashi et al.,
2004
; Israsena et al.,
2004
), suggesting that Wnt signaling modulates the behavior of
stem cells in a stage-dependent manner. In the developing vertebrate retina,
Wnt signaling regulates both proliferation and neuronal differentiation. A
recent study has suggested that Wnt2b promotes the cell-cycle progression in
the chick retina (Kubo et al.,
2003
). It has been reported that a Wnt signaling molecule,
glycogen synthase kinase 3ß, modifies the activity of Xenopus
neuroD in a post-translational manner, and controls the timing of neuroD
functions (Moore et al.,
2002
).
In this study, we show that the introduction of
47-ß-catenin
induces hyperproliferation in the zebrafish retina, suggesting that the
activation of Wnt signaling promotes proliferation of retinal cells in
zebrafish. The hyperproliferation phenotype induced by
47-ß-catenin is morphologically similar to that of add
mutant retinas, raising the possibility that Wnt signaling is activated in the
add mutant retinas. Indeed, the expression of targets of canonical
Wnt signaling, such as cyclin D1 and cmyc, is elevated in
the add mutant or TSA-treated retinas. Furthermore, the
hyperproliferation of retinal cells in add mutant retina is
suppressed by the introduction of
N-Tcf3, which functions as a dominant
suppressor of canonical Wnt signaling. These data support the possibility that
aberrant activation of Wnt signaling causes the hyperproliferation in the
add mutant retinas. We also show that the introduction of Hdac1
significantly suppresses the cell-cycle progression induced by
47-ß-catenin. These data suggest that Hdac1 antagonizes Wnt
signaling to promote the cell-cycle exit of retinal progenitor cells in
zebrafish.
TSA treatment of wild-type embryos in different concentrations revealed
that the ratio of differentiation to proliferation in the zebrafish retina
correlates with the level of Hdac activity, raising the possibility that a
balance between Wnt signaling and Hdac activity is important to determine
whether retinal cells exit from the cell cycle or re-enter it. In this study,
we examined retinal phenotypes in four different combinations of Hdac and Wnt
activities: the add mutant (Hdac1, low; Wnt, intact), the
add mutant injected with
N-Tcf3 (Hdac1 low; Wnt, low), the
wild type injected with
47-ß-catenin (Hdac1, intact; Wnt, high),
and the wild type co-injected with
47-ß-catenin and Hdac1 (Hdac1,
high; Wnt, high). The phenotypes in these four combinations clearly showed
that the balance between Hdac1 and ß-catenin correlates with retinal cell
exit from or re-entry into the cell-cycle, respectively
(Fig. 10A). This is
reminiscent of previous in vitro and genetic experiments demonstrating that
the expression of Tcf target genes is regulated by a balance between
ß-catenin and Hdac/co-repressors
(Cavallo et al., 1998
;
Roose et al., 1998
;
Billin et al., 2000
). Hdac
activity may increase a threshold level of ß-catenin, at which retinal
cells respond to Wnt signals. It is interesting that the manipulation of only
two factors, Hdac1 and ß-catenin, can regulate the ratio of the number of
differentiating cells to the number of proliferating cells. This may imply
that Hdac1-mediated suppression of Wnt signaling is an essential component of
the mechanism determining the rate of neurogenesis in the zebrafish
retina.
How does Hdac1 suppress the Wnt signaling pathway? As Hdac proteins are
recruited by transcription repressors and suppress the transcription of target
genes, it is possible that Hdac1 switches off the transcription of genes that
are activated by Wnt signaling and important for cell proliferation. One of
the candidates is cyclin D1. It has been reported that cyclin
D1 is a target of canonical Wnt signaling
(Shtutman et al., 1999
;
Tetsu and McCormick, 1999
),
and that the competition between ß-catenin and Hdac proteins regulates
the transition of Tcf/Lef from a transcription repressor to an activator
(Billin et al., 2000
). We
showed that the cyclin D1 expression is not downregulated in the
add mutant retinas. Furthermore, the introduction of p27 inhibits the
cell-cycle progression in the add mutant retinas, suggesting that
Hdac1 functions upstream of the interaction between cyclin D1 and p27. These
data suggest that Hdac1 antagonizes Wnt signaling to suppress the
transcription of cyclin D1 in the zebrafish retina. If this is the
case, Hdac1 or a Hdac1-associated co-repressor directly competes with
ß-catenin to interact with the bipotential transcription factor Tcf/Lef.
Such a direct competition model between Hdac1/co-repressor and ß-catenin
seems to agree with the observation that a balance between Hdac1 and
ß-catenin correlates with the ratio of differentiating cells to
proliferating cells in the zebrafish retina.
Recent study revealed that various types of Wnt ligands are expressed in
the murine neural retina and that there is a dynamic pattern of Wnt receptor
(Frizzled) and Wnt antagonist (Secreted-frizzled-related protein, Sfrp) gene
expression in the murine neural retina
(Liu et al., 2003
), raising
the possibility that retinal cells may receive a variety of Wnt signals that
are secreted from different sources and modulated in different ways. The most
recent study using Xenopus retinas showed that Frizzled 5-mediated
canonical Wnt signaling is involved in the maintenance of the potential of
progenitor cells to generate neurons as well as their proliferation rate
(Van Raay et al., 2005
). The
blockade of Frizzled 5 in the Xenopus retina does not influence the
expression of progenitor markers such as Rx and Chx10, but biases progenitor
cells toward a non-neural fate through the inactivation of Sox2.
Hdac1-mediated inhibition of Wnt signaling may influence not only the entry of
the cell cycle but also different aspects of retinal progenitor cells, such as
the potential to generate neurons in the zebrafish retina.
Hdac1 antagonizes Notch-mediated activation of HES in the zebrafish retina
N-Tcf3 suppresses the cell-cycle progression in add mutant
retinas. However, add mutant cells expressing
N-Tcf3 fail to
express neurogenic markers such as ath5. This observation indicates
that the inhibition of Wnt signaling does not fully restore neuronal
differentiation in the add mutant retina. These data suggest that
Hdac1 also regulates Wnt-independent targets during retinal neurogenesis.
Candidates are neurogenic inhibitors such as Hes
(Hatakeyama and Kageyama,
2004
). In the Hes1 knockout mouse, retinal neurons differentiate
precociously (Tomita et al.,
1996
). In the absence of Notch signaling, a transcription factor
of the Cbf1/Su(H)/Lag1 (CSL) family associates with Hdac proteins and actively
keeps the transcription of Hes genes switched off
(Kao et al., 1998
). In this
study, we show that the expression of a zebrafish ortholog of murine Hes5,
her4, is upregulated in the add mutant retina, suggesting
that Hdac1 negatively regulates the transcription of neurogenic inhibitors
such as Hes. We found that this upregulation of her4 expression in
the add mutant retina is inhibited by the introduction of the
mib mutation, suggesting that her4 expression in the
add mutant retinas requires the activation of Notch signaling. NICD,
an active form of Notch, which is produced by ligand-dependent proteolytic
cleavages, disrupts the association of CSL with co-repressors, resulting in
the conversion of CSL from a transcription repressor to an activator
(Lai, 2004
). The decrease in
Hdac activity may facilitate the interaction between CSL and NICD to induce
her4 expression.
It has been reported that the expression of a zebrafish Hes1 ortholog,
her6, is upregulated in the hindbrain of the zebrafish hdac1
mutant (Cunliffe, 2004
), which
was isolated by the insertional mutagenesis
(Golling et al., 2002
). This
previous study, carried out by Cunliffe
(Cunliffe, 2004
), also showed
that her6 expression is not inhibited in mib mutants
injected with morpholino-antisense oligos of the hdac1 gene,
suggesting that the upregulation of her6 expression in the
hdac1 mutant hindbrain seems independent of the activation of Notch
signaling. This contrasts with our observation that the activation of Notch
signaling is required for the upregulation of her4 expression in the
add mutant retina. In mib mutants injected with
hdac1 morpholino oligos, both Notch signaling and Hdac1 activities
are attenuated, but the residual Notch signaling mediated by maternal Mib may
counter residual Hdac activity derived from other Hdac proteins to induce
her6 expression in the hindbrain. By contrast, it is possible that
maternal Hdac1 or other Hdac proteins counter Notch signaling mediated by
maternal Mib to inhibit her4 expression in the add; mib
mutant retina. However, her4 expression was not observed in the
mib mutant treated with TSA, by which almost all Hdac activity,
including maternal Hdac1 and other Hdac proteins, could be inhibited (M.Y. and
I.M., unpublished). This observation suggests that maternal Mib-mediated Notch
signaling in the retina may be too low to activate her4 expression
even in the severe blockade of Hdac activity. Previous studies have suggested
that the Notch signaling pathway is modulated by several Notch-modifying
proteins, such as Numb, Deltex and Mastermind-like (reviewed by
Hansson et al., 2004