|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online June 8, 2005
doi: 10.1242/10.1242/dev.01879
Department of Developmental and Cell Biology, University of California, Irvine, CA 92697-2300, USA
* Author for correspondence (e-mail: tschilli{at}uci.edu)
Accepted 26 April 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Tcfap2, Neural crest, Craniofacial, Danio rerio
| Introduction |
|---|
|
|
|---|
AP2 transcription factors are highly conserved DNA-binding proteins
implicated in cranial NCC development. Three of the five members of this
family in mammals (Tcfap2a, Tcfap2b and Tcfap2g) are
expressed in migrating NCCs (Moser et al.,
1995
; Hilger-Eversheim et al.,
2000
). Tcfap2a-/- mutant mice have defects in
the neural tube, body wall and limbs, and striking malformations of
NCC-derived craniofacial structures (palate and ear ossicles) that correlate
with defects in NCC survival (Schorle et
al., 1996
; Zhang et al.,
1996
; Morris-Kay et al., 1996). Craniofacial defects, however,
could be indirectly due to disruptions in neural tube and epithelial
morphogenesis in Tcfap2a-/- mutants, because early NCC
migration appears grossly unaffected
(Schorle et al., 1996
).
Tcfap2b-/- mutant mice and TFAP2B+/-
humans have renal epithelial apoptosis and patent ductus arteriosus (Char
syndrome), and mild defects in the NCC-derived craniofacial skeleton
(Chazaud et al., 1996
;
Moser et al., 1997b
;
Satoda et al., 2000
). The only
defects reported in Tcfap2g-/- mutant mice are placental
(Auman et al., 2002
). Thus,
co-expression and conserved protein structures of Tcfap2a and
Tcfap2b suggest that their functions are redundant, but specific
requirements in NCCs remain unclear.
Insights into tfap2a function in NCCs have come from analysis of
the zebrafish lockjaw (lowts213) mutation, which
eliminates tfap2a function but lacks the severe neural tube defects
seen in Tcfap2a-/- mice. lowts213
mutants have early defects in NCC specification, prior to migration, and later
lack subsets of cartilage and pigment cells
(Schilling et al., 1996
;
Knight et al., 2003
).
low/tfap2a is required for kit expression in pigment cell
precursors and differentiation of early melanocytes and iridophores
(Knight et al., 2004
), and
previous studies of the mammalian KIT promoter suggests that this
regulation is direct (Huang et al.,
1998
). Similar to studies of the Hoxa2 promoter in mice
(Maconochie et al., 1999
),
zebrafish low/tfap2a is required to activate transcription of Hox
group 2 genes in NCCs of the second pharyngeal arch (hyoid), suggesting that
tfap2a regulates the segmental identities of NCCs
(Knight et al., 2004
). Hyoid
defects and fusions with the mandibular arch in low mutants also
resemble embryos lacking hoxa2/hoxb2 gene functions
(Hunter and Prince, 2002
).
These studies demonstrate a cell-autonomous role for tfap2a in
subsets of NCC, but cannot account for more widespread defects in NCC survival
and chondrogenesis in AP2-deficient embryos
(Schorle et al., 1996
;
Knight et al., 2003
;
Barrallo-Gimeno et al., 2004
).
Thus, Tcfap2a may have additional, non-autonomous roles in the
tissues with which NCCs interact.
Tcfap2a was previously known as keratin transcription factor,
KTF-1, a regulator of epidermal differentiation in vitro
(Leask et al., 2001
).
Tcfap2a-/- mutant mice and zebrafish have normal skin
architecture, suggesting that other AP2 family members can compensate in vivo.
However, this has not been carefully examined in facial ectoderm, where
specialized domains of pharyngeal ectoderm interact with NCCs in a similar way
to the apical ectoderm of the limb bud, and these may depend on AP2
(Wall and Hogan, 1995
;
Hu and Helms, 1999
). The
pharyngeal ectoderm induces cartilage in mammals
(Hall, 1980
) and expresses
signaling molecules (e.g. Fgf8, Shh, Bmp4) involved in craniofacial
development. Fgf8 from the oral ectoderm patterns the mouse mandible
(Trumpp et al., 1999
;
Tucker et al., 1999
;
Abu-Issa et al., 2002
;
Macatee et al., 2003
), while
Fgf4, Fgf9, Fgf17 and Fgf18 from pharyngeal ectoderm pattern other bones and
teeth (Kettunen and Thesleff,
1998
; Bachler and Neubuser,
2001
). Shh signaling is required for patterning many regions of
the skull, including the jaw and facial midline, and recent evidence suggest
that this is a direct effect on NCCs
(Jeong et al., 2004
). Thus,
multiple ectodermal signals converge on NCCs to control growth and patterning.
NCCs also signal back to the overlying ectoderm to maintain ectodermal
development (Creuzet et al.,
2004
).
In this study, we identify tfap2b as a pivotal factor in craniofacial skeletal development in zebrafish. tfap2b is expressed in the pharyngeal ectoderm, not in NCCs, and the combined loss of tfap2b and tfap2a function leads to defects in NCC-derived pharyngeal cartilages. Grafts of pharyngeal ectoderm into AP2-deficient embryos restores cartilage development. Taken together, these findings indicate that tfap2b and its close relative, tfap2a, play redundant roles in the ectoderm to control skeletogenesis of NCCs. This is the first in vivo demonstration of a requirement for AP2 transcription factors in the ectoderm, and strong evidence for redundant functions among AP2 family members.
| Materials and methods |
|---|
|
|
|---|
Cloning and PCR amplification of tfap2b transcripts
Forward and reverse primers ap2b-7f (CGAGGCGAACGGACGGAGCG) and ap2b-1r
(CCTTCACCACATAACACC) were designed to EST sequences fp02d11.y1 (GenBank
Accession Number BG737469) and fp60d09.x1 (GenBank Accession Number BI671067),
respectively. A 3.1 kb band corresponding to the full-length tfap2b
(GenBank Accession Number DQ060246) was amplified by RT-PCR from 26 hpf
embryos. This was cloned into pGEM T'Easy (Promega), completely sequenced in
both directions using the Big Dye Terminator Sequencing reagent (ABI), and run
on an ABI PRISM 310 sequencer (PE Applied Biosystems). RT-PCR amplification of
tfap2b over exon 5 in morpholino-injected animals and for staging of
tfap2b expression used 10 pmol each of primers ap2b-6f
(AGAGCGGAGGTTTACTG) and ap2b-6r (ATGTGACATTCGCTGCC) with a slightly lower
annealing temperature of 50°C for 30 seconds.
Whole-mount in situ hybridization and immunohistochemistry
In situ hybridization was carried out as described previously
(Thisse et al., 1993
).
Antisense probe for tfap2b was synthesized with SP6 RNA polymerase
from the amplified tfap2b clone following linearization by
NcoI. Probes and antibodies used were dlx2
(Akimenko et al., 1994
),
hoxa2 (Prince at al.,
1998
), tfap2a and fgf8
(Furthauer et al., 1997
),
fli1 (Brown et al.,
2000
), gsc (Stachel
et al., 1993
), nkx2.3
(Lee et al., 1996
),
sef (Furthauer et al.,
2002
; Tsang et al.,
2002
), and sox9b (Li
et al., 2002
). Sectioning was performed after in situ
hybridization. Embryos were immersed in 30% sucrose, embedded in 1% agar
blocks, frozen in liquid nitrogen and cryostat sections cut at a thickness of
12 µm on a Leica cryostat.
Cell death detection assays
Apoptotic cell death was detected using a terminal transferase, dUTP
nick-end labeling method (TUNEL) using several modifications suggested by the
manufacturer (POD In Situ Cell Death Detection Kit, Roche). To avoid
overfixing, embryos were dechorionated, and fixed in 4% PFA at 4°C
overnight. They were then permeabilized with acetone at -20°C for 7
minutes and incubated in 2% goat serum at room temperature for 3 hours as a
protein block prior to the TUNEL reaction. Apoptotic cells were counted in the
pharyngeal region, between the posterior margin of the eye and anterior otic
vesicle.
Morpholino injections
A morpholino ap2b-x5.1 (GCCATTTTTCGACTTCGCTCTGATC) was designed against the
splice acceptor site of exon 5 in the tfap2b sequence at 1031 bp
(Fig. 1B) by comparison with
the corresponding genomic contig BX005121.8 from the zebrafish genome assembly
(www.ensembl.org/D_rerio).
The ap2b-x5.1 morpholino was reconstituted in 0.2M KCl and 3-5 ng was injected
into one- or two-cell stage embryos together with 3% TRITC-dextran to act as a
lineage tracer.
Ectoderm cell transplantation
Wild-type donor animals were injected with a combination of 3%
TRITC-dextran (neutral, 10,000 Mr) and 3% biotin-dextran
(lysine-fixable, 10,000 Mr) at the one- to two-cell stage.
Cells within a few cell diameters of the animal pole were transplanted at the
late blastula stage, as cell-tracing studies have shown that this region forms
cranial ectoderm (Kimmel et al.,
1990
). Transplants in this position never formed endoderm or
mesoderm, and were generally segregated in either non-neural ectoderm or in
the neural tube and NCCs. Cells were transplanted into this location in
low mutants and in wild-type siblings, and allowed to develop to 25
hpf, when transplanted cells were visualized by rhodamine fluorescence. Each
embryo was then either: (1) fixed in 4% PFA and processed individually by in
situ hybridization for sef expression, and detection of the
biotin-labeled donor cells with a peroxidase coupled avidin-streptavidin
complex (Vectastain) using DAB as the colored substrate; or (2) raised to 4
days postfertilization and processed for biotin detection and Alcian Blue
staining for cartilage, as above.
| Results |
|---|
|
|
|---|
|
tfap2a and tfap2b are co-expressed in neural tube and ectoderm, but not neural crest
Unlike tfap2a, which is first expressed in the non-neural ectoderm
during gastrulation and later in NCCs (Fig.
2A), tfap2b expression is first detected at six- to
seven-somite stages in the hindbrain (Fig.
2B). Later, tfap2a is expressed throughout the surface
ectoderm and in migrating NCCs, while tfap2b expression remains
restricted to the hindbrain (Fig.
2C,D). Both genes are co-expressed in the developing intermediate
mesoderm and by 24 hours postfertilization (hpf) in the pronephric ducts.
tfap2b expression was not detected during gastrulation or early
somitogenesis by in situ hybridization, or by RT-PCR on cDNA prepared from
embryos harvested hourly between 6 and 10 hpf
(Fig. 1D).
Surprisingly, tfap2b is not expressed in NCCs at any stage. Migrating NCCs in the pharyngeal arches express tfap2a at 24 hpf (Fig. 2E,G). At this stage, tfap2b is weakly expressed in the arches, but not in NCCs (Fig. 2F,H), and expression is restricted to surface pharyngeal ectoderm (see Fig. 6). By contrast, tfap2a is expressed in both NCCs and more broadly throughout the surface ectoderm. Its expression overlaps that of tfap2b in the diencephalon and rhombencephalon (Fig. 2E-H). These patterns of expression are maintained, with tfap2b expression restricted to a subset of tfap2a-expressing cells in the pharyngeal ectoderm (Fig. 2I,J). tfap2a and tfap2b are also co-expressed in the lens and retina (ganglion cell layer), midbrain (tectum and tegmentum), cerebellum and spinal cord. These expression domains persist until 52 hpf, whereas, by contrast, tfap2b mRNA is no longer detected in the pharyngeal ectoderm after 48 hpf (Fig. 2K,L).
|
Closer examination of cartilage confirmed that ap2bMO has no effect in the presence of a functional tfap2a gene. In low mutants alone, both dorsal (hyosymplectic, hs) and ventral (ceratohyal, ch) hyoid cartilages are reduced, and remnants of the hyoid fuse with the mandibular arch (Fig. 3F). By contrast, AP2a/b-deficient larvae also lack an anterior neurocranium and much of the mandibular arch (Fig. 3H). The posterior neurocranium and pectoral fin skeletons, which are derived from mesoderm, are not affected. Rather, defects are restricted to NCC-derived cartilage, suggesting that tfap2a and tfap2b play redundant roles in the development of skeletogenic NCCs.
tfap2b is not required for early neural crest cell specification
To determine if tfap2b, like tfap2a, is required during
early NCC development, we examined dlx2 and hoxa2 expression
in the pharyngeal arches. At 26 hpf, dlx2 expression marks migrating
NCCs in mandibular, hyoid and branchial NCCs (m, h and b in
Fig. 4A). hoxa2 is
co-expressed in hyoid and branchial NCCs
(Fig. 4D). Both are reduced in
the hyoid arch to a few ventral cells in low mutants. By contrast,
mandibular expression of dlx2 is unaffected
(Fig. 4A,B)
(Knight et al., 2003
). ap2bMO
injections into low mutant embryos did not enhance this phenotype
(Fig. 4C,F) or disrupt
dlx2 or hoxa2 expression (data not shown). Thus, unlike
tfap2a, tfap2b is not required for early homeobox gene activation in
NCCs.
To test later requirements for tfap2b in the arches, we examined
expression of the ETS-domain transcription factor fli1 in
AP2a/b-deficient embryos (Brown et al.,
2000
). fli1 is first expressed in NCCs at 22 hpf, after
migration, and also in vascular endothelia
(Fig. 4G-I). In low
mutants, fli1 expression is slightly reduced in the hyoid and
branchial arches (Fig. 4H), but
not in the mandibular arch, similar to dlx2. Injection of up to 5 ng
of ap2bMO had no effect on fli1 expression in wild-type controls
(data not shown). However, ap2bMO nearly eliminated fli1 expression
in the arches when injected into low mutants
(Fig 4I). These results are
consistent with a requirement for tfap2b in NCCs after migration into
the arch primordia.
tfap2b regulates patterns of cartilage condensation
To address requirements for tfap2b in skeletogenic NCCs, we
examined goosecoid (gsc) and sox9a expression
(Fig. 4J-O). Both genes play
important roles in skeletal differentiation
(Rivera-Perez et al., 1999
).
gsc expression is reduced in the dorsal hyoid arch in low
mutants, and this correlates with loss of hoxa2 expression and
hyosymplectic cartilage. Expression in the ventral arch is unaffected
(Fig. 4K)
(Knight et al, 2003
).
Injection of up to 5 ng of ap2bMO has no effect on gsc expression
(data not shown). However, in AP2a/b-deficient embryos, gsc
expression is eliminated throughout the hyoid
(Fig. 4L). This suggests that
tfap2b is required for the specification of NCC skeletal
progenitors.
|
|
We used a transgenic line in which the fli1 promotor drives eGFP
(fli1-GFP), to correlate NCC and skeletal defects
(Lawson and Weinstein, 2002
).
This fli1-GFP transgene was crossed into lowts213
and used to visualize NCCs in the pharyngeal arches of 36 hpf individuals,
that were then raised to 4 dpf and stained for cartilage
(Fig. 5). In this line, the
fli1-GFP co-localizes with dlx2 expression in NCCs (data not
shown). fli1-GFP expression was reduced in low mutants
(Fig. 5E) and much more
severely reduced in AP2a/b-deficient embryos at 36 hpf
(Fig. 5F).
|
|
tfap2a and tfap2b promote survival of pharyngeal ectoderm
tfap2a is required cell autonomously in NCCs
(Knight et al., 2003
), and in
mice Tcfap2a directly regulates hoxa2 transcription in NCCs
(Maconochie et al., 1999
). By
contrast, zebrafish tfap2b is not expressed in NCCs, yet both
tfap2a and tfap2b are required in the NCC-derived skeleton.
The only tissue likely to account for this redundancy is the cranial ectoderm,
as tfap2a is expressed throughout this ectoderm and tfap2b
is expressed locally in a small patch of pharyngeal ectoderm at 20 hpf.
Sections of embryos at both 24 and 36 hpf, labeled by whole-mount in situ
hybridization prior to sectioning, reveal that tfap2a is expressed in
both NCCs and ectoderm (Fig.
6B), and overlaps in NCCs with dlx2 expression
(Fig. 6A). By contrast,
tfap2b expression is restricted to ectoderm
(Fig. 6C). These results
suggest that tfap2b function is required in the pharyngeal ectoderm,
and redundant with that of tfap2a.
Do AP2a/b-deficient embryos have defects in pharyngeal ectoderm? AP2
proteins play important roles in cell survival, and Tcfap2a mutant
mice show elevated apoptosis. We examined apoptosis in the ectoderm using
TUNEL labeling (Fig. 7A-I). In
the lowts214 allele of tfap2a, a brief period of
apoptosis occurs in NCCs between 10 and 14 somites
(Knight et al, 2003
), and
apoptosis is more widespread in the mob610 allele
(Barallo-Gimeno et al., 2004). We performed TUNEL labeling in either
low mutants alone (Fig.
7B,E,H) or AP2a/b-deficient embryos
(Fig. 7C,F,I) carrying the
fli1-GFP transgene. Colocalization of GFP and TUNEL showed that apoptosis was
excluded from NCCs, and confined to the ectoderm. The number of TUNEL labeled
cells in pharyngeal ectoderm at 28 hpf was similar in low mutants
(4.5±2.62; n=4) and wild-type controls (4.3±2.32;
n=6), and only slightly increased in embryos injected with the ap2b
MO alone (7.3±4.49; n=5). By contrast, TUNEL labeling was
dramatically elevated in AP2a/b-deficient embryos (75.8±16.22;
n=6). Large numbers of apoptotic NCCs were observed along the dorsal
edges of the spinal cord in the tail, and this correlates with pigment cell
defects in the tail in low mutants
(Fig. 7G-I)
(Knight et al, 2004
). Elevated
ectodermal apoptosis was observed not only in the pharyngeal arches in
AP2-deficient animals, but also in olfactory epithelia and in the skin
overlying the hindbrain (data not shown).
By contrast, other epithelia such as the pharyngeal endoderm are unaffected by the loss of AP-2. The NK homeobox gene, nkx2.3, marks the pharyngeal pouch endoderm at 34 hpf (Fig. 7J), and this endoderm forms a normal series of pouches in low mutants and in AP2a/b-deficient embryos (Fig. 7K,L).
|
|
AP2 regulates Fgf signaling from the ectoderm
What ectodermal signal is disrupted in AP2a/b-deficient embryos? Shh, Bmp4
and Fgf8 are expressed in the facial ectoderm, and all three have been
implicated in NCC patterning, proliferation and survival
(Bachler and Neubeuser, 2001
).
tfap2a mutants lack Shh expression in the posterior ectoderm of the
hyoid arch (Knight et al.,
2003
), but injection of ap2b-MO into low mutants does not
cause any defects in shh expression. Likewise, bmp4
expression is only slightly reduced in the ventral ectoderm in
AP2a/b-deficient embryos (data not shown). To address requirements for AP-2 in
regulating Fgfs, we examined fgf3 and fgf8 expression, both
of which have been implicated in craniofacial development in zebrafish
(Roehl and Nusslein-Volhard,
2001
; David et al.,
2002
). fgf8 is expressed in the mandibular ectoderm and
more weakly in more posterior arch ectoderm at 28 hpf. Expression of both
fgf3 and fgf8 persists in AP2a/b-deficient embryos
(Fig. 9A,B).
Other Fgf proteins (Fgf9, Fgf17 and Fgf18) expressed in cranial ectoderm in mammals have not been well characterized in zebrafish. Therefore, we examined expression of the interleukin receptor-related Fgf target sef as a general indicator of responses to Fgfs in the arches. sef is expressed in cranial NCCs in the arches beginning at 18 hpf, and near other sources of Fgfs at the mid-hindbrain boundary and in the pectoral fin buds (Fig. 9C). Expression of sef is lost in the first arch (mandibular) and strongly reduced in the second arch (hyoid) in AP2a/b-deficient embryos, while other domains of expression are unaffected (Fig. 9D). This appears to reflect a loss of Fgf produced by the ectoderm, as transplantation of wild-type pharyngeal ectoderm partially rescues sef expression on the grafted side (8/18; Fig. 9E). Our results implicate Fgfs as one component of the ectodermal signals that require the combined functions of Tfap2a and Tfap2b.
|
| Discussion |
|---|
|
|
|---|
Redundancies between tfap2a and tfap2b
In mice, Tcfap2a and Tcfap2b are co-expressed in many
embryonic tissues such as NCCs, yet have unique requirements in development.
Loss-of-function mutations in Tcfap2a disrupt neural tube closure and
craniofacial NCCs (Schorle et al.,
1996
; Zhang et al.,
1996
). By contrast, mutations in Tcfap2b or human
TFAP2B, cause renal failure and craniofacial defects associated with
Char syndrome (Moser et al.,
1997b
; Satoda et al.,
2000
). AP2 proteins may function redundantly in tissues where they
are co-expressed, and our results support this hypothesis for the ectoderm
(Moser et al., 1997a
).
Zebrafish tfap2b is only co-expressed with tfap2a in a
restricted domain within the pharyngeal ectoderm. Few studies have addressed
AP2 functions in ectoderm as the skin appears to develop normally in
Tfap2a-/- and Tfap2b-/- mutant mice
(Schorle et al., 1996
).
Disruption of tfap2b alone has no effect on zebrafish embryos, but
enhances defects in ectodermal cell survival and craniofacial cartilage caused
by loss of tfap2a alone, suggesting that the two AP2 proteins can
compensate for one another. tfap2a and tfap2b are also
co-expressed in the pronephric ducts, and in several regions of the CNS, where
they may also be redundant.
|
Rather, we argue that tfap2b regulates NCC specification after migration into the arches as cells condense to form cartilage. In contrast to hoxa2, expression of fli1 is reduced in AP2a/b-deficient embryos, compared with low alone, and we used a fli1-GFP transgene to show that this prefigures condensation defects. Later markers of differentiating cartilage, such as gsc and sox9a, are almost completely eliminated in these embryos. Surprisingly, AP2a/b-deficient embryos also have defects in the neurocranium. As both pharyngeal and neurocranial cartilages derive from NCCs (the posterior head skeleton is mesodermal) these results suggest that AP2 genes are required for the development of other NCC-derived cartilages. tfpa2a and tfap2b may be partially redundant in more anterior cartilages of the mandibular arch and neurocranium, which are not disrupted in tfap2a-/- mutants alone.
Separate requirements for AP2 genes in NCCs and in surface ectoderm
Tcfap2a is required cell-autonomously for NCC specification, prior
to migration into the pharyngeal arches
(Knight et al., 2003
;
Knight et al., 2004
), and
directly regulates hoxa2 and kit transcription
(Maconochie et al., 1999
).
Here, we show an additional non-autonomous requirement for AP2 proteins in the
pharyngeal ectoderm. To achieve this, we grafted ectodermal precursors from
wild-type donors into either low or AP2a/b-deficient embryos and
analyzed the cartilage pattern. Grafts that included pharyngeal ectoderm
rescued cartilage unilaterally on the transplanted side, including restoration
of dorsal first (palatoquadrate) and second (hyosymplectic) arch cartilages,
as well as their separation from the neurocranium. This is a dramatic example
of a non-autonomous role for ectoderm in cartilage development and is
consistent with previous studies in mice implicating the surface ectoderm in
arch patterning (Trumpp et al.,
1999
; Trokovic et al.,
2003
; Macatee et al.,
2003
). A non-autonomous requirement for tfap2a has
previously been suggested for NCC-derived melanocytes
(O'Brien et al., 2004
). These
requirements in ectoderm appear to act separately and in parallel to
chondrogenic signals from the pharyngeal endoderm
(Hall, 1980
;
David et al., 2002
), and
AP2-deficient embryos show no defects in endoderm.
Ectodermal signals may also regulate Hox gene expression in the arches and
arch identities. Cartilage defects in low (tfap2a) mutant
zebrafish resemble homeotic defects caused by loss of Hox group 2 gene
function, in which hyoid cartilages are transformed to a mandibular fate
(Knight et al., 2004
). This
could be caused directly by loss of Hoxa2 transcriptional activation
by AP2 proteins in NCCs, or indirectly by defects in surrounding tissues. Our
results indicate both direct and indirect roles for tfap2a, as
ectodermal grafts rescue cartilage formation as well as homeotic
transformations of the hyoid skeleton in low mutant embryos
(Knight et al., 2004
). This
suggests that Hox genes initially specify the segmental identities of
migrating NCCs, but then require ectodermal signals to maintain this identity
(Trainor and Krumlauf, 2000
;
Schilling et al., 2000). Defects in Hoxa2-/- mutant mice
have been interpreted as intrinsic changes in NCC, but Hoxa2
expression is lost in both ectoderm and NCCs, and the role of the ectoderm has
been largely ignored. In Hoxa2 mutants, ectopic expression of mandibular arch
genes in the hyoid arch results from defects in reciprocal signals between
NCCs and ectoderm (Bobola et al.,
2003
). Our results suggest that the ectoderm maintains Hox
expression in NCCs during migration, and this depends on AP2 genes.
Tcfap2a expression begins during gastrulation in the non-neural
ectoderm and persists in the skin throughout embryonic development. We show
that AP2-deficient zebrafish have defects in ectodermal survival.
Tcfap2a promotes ectoderm formation in Xenopus
(Luo et al., 2002
;
Luo et al., 2003
) and
regulates genes involved in epidermal differentiation in mammals
(Pfisterer et al, 2002
;
Zhang et al, 1996
;
Schorle et al, 1996
). In
contrast to tfap2a, however, which is expressed broadly in the
ectoderm, tfap2b expression is restricted to the pharyngeal ectoderm,
and it is here that we find elevated apoptosis by TUNEL labeling in
AP2a/b-deficient embryos. We previously described a wave of early apoptosis in
the premigratory NCCs and overlying ectoderm in low mutants at
neurula stages (Knight et al.,
2003
) and death is even more extensive in the pharyngeal arches of
the mob610 allele of tfap2a
(Barrallo-Gimeno et al., 2004
).
Apoptosis in the NCCs is considered to be the causative phenotype for mouse
Tcfap2a mutants, implying that AP2 genes function cell-autonomously
in NCC survival (Hilger-Eversheim et al.,
2000
; Decary et al.,
2002
), but we have not observed extensive death in NCCs in
AP2-deficient zebrafish, only ectoderm.
AP2, Hoxa2 and Fgf signaling
Many growth factors (e.g. Fgf8, Shh, Bmp4, etc.) are expressed in
pharyngeal ectoderm and have been implicated in craniofacial development
(Wall and Hogan, 1995
). Our
results suggest that one component of the ectodermal signal to NCCs is an Fgf,
but probably not Fgf8. Expression of the Fgf-responsive gene sef, is
disrupted in AP2a/b-deficient embryos, and can be partially rescued by grafts
of wild-type ectoderm. Several Fgfs are expressed in the pharyngeal ectoderm,
including Fgf8 and Fgf17 (Reifers et al.,
2000
). However, fgf8 mRNA appears unaffected in
AP2a/b-deficient zebrafish embryos. We have previously shown that
tfap2a is also required for shh expression in the posterior
ectodermal margin of the hyoid arch
(Knight et al., 2004
). Thus,
in the hyoid arch, AP2 proteins may simultaneously regulate Shh and Fgf
signals from the pharyngeal ectoderm that control skeletal growth and
pattern.
Fgf8 seemed the most likely candidate to be regulated in the ectoderm,
because it is required for mandibular development in the mouse
(Trumpp et al., 1999
;
Abu-Issa et al., 2002
). Macatee
et al. (Macatee et al., 2003
)
used Cre-lox mediated removal of Fgf8 in the pharyngeal ectoderm to
demonstrate an ectodermal requirement in mice. These animals lacked mandibular
arches and more posterior arches were fused. By contrast, fgf3 is
required in the endoderm for formation of the posterior, branchial arch
skeleton, but appears to play less of a role in the mandibular and hyoid
(David et al., 2002
) and we
have not detected any defects in fgf3 expression in AP2a/b-deficient
embryos. Both fgf3 and fgf8 in zebrafish play a role in
endodermal pouch formation, and the combined disruption of both leads to
severe reductions in the cranial skeleton
(Walshe and Mason, 2003
;
Crump et al., 2004
). Likewise,
a hypomorphic mutation in Fgfr1 in the facial ectoderm in mice
eliminates the hyoid arch skeleton but not the mandibular arch, similar to
low/tfap2a mutant zebrafish
(Trokovic et al., 2003
),
suggesting that Fgfs expressed in the ectoderm autoregulate their own
expression and subsequent signaling to adjacent NCCs.
Interestingly, Fgf signaling in the mouse has been proposed to inhibit
Hoxa2 expression in mandibular arch NCCs, suggesting that this may be
a convergence point for AP2 and Fgf functions in establishing pharyngeal arch
identity. Hoxa2 represses Fgf activated genes such as Pitx1
and Lhx6 in NCCs of the hyoid arch
(Bobola et al., 2003
). In
Hoxa2-/- mutants, these genes are ectopically expressed
and the hyoid arch is transformed to a mandibular fate. We previously
described similar transformations in low mutant zebrafish. Our data
suggest that these are due to an early function for tfap2a in
regulating the expression of hoxa2 directly in NCCs, while a
tfap2b-dependent signal from the ectoderm (possibly an Fgf) is
involved only later in chondrogenesis.
Conserved functions for AP2 transcription factors in vertebrate development
NCCs arose at the origin of vertebrates and many of the genes involved in
NCC patterning evolved from ancestral genes that had more ancient roles in
patterning other tissues. In the invertebrate chordate, amphioxus, an AP2 gene
is expressed in the non-neural ectoderm, indicating that this is a conserved
feature of AP2 genes in all chordates
(Meulemans and Bronner-Fraser,
2002
). Pharyngeal arches also have an origin prior to that of the
NCCs, as evidenced by the presence of branchial gills in amphioxus and
appendicularian urochordates. The pharyngeal arches are initially patterned
independently of NCCs as shown by NCC extirpations in the chick, in which
ectodermal and endodermal patterning is not perturbed
(Veitch et al., 1999
). Given
that AP2 genes have ancient roles in patterning of the ectoderm and that
pharyngeal arches arose prior to the NCCs, it is tempting to speculate that
AP2 genes were involved in patterning the pharyngeal ectoderm prior to the
origin of NCCs. Thus, when NCCs first gained their migratory behavior, they
retained some of their identity from their site of origin in the hindbrain
through NCC-specific genes, such as tfap2a, but were influenced by
signals already present in the arch environment into which they migrated,
including those regulated by AP2.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Abu-Issa, R., Smyth, G., Smoak, I., Yamamura, K. and Meyers, E.
N. (2002). Fgf8 is required for pharyngeal arch and
cardiovascular development in the mouse. Development
129,4613
-4625.
Akimenko, M. A., Ekker, M., Wegner, J., Lin, W. and Westerfield, M. (1994). Combinatorial expression of three zebrafish genes related to distal-less: part of the homeobox gene code for the head. J. Neurosci. 14,3475 -3486.[Abstract]
Auman, H. J., Nottoli, T., Lakiza, O., Winger, Q., Donaldson, S.
and Williams, T. (2002). Transcription factor AP-2gamma is
essential in the extra-embryonic lineages for early postimplantation
development. Development
129,2733
-2747.
Bachler, M. and Neubuser, A. (2001). Expression of members of the Fgf family and their receptors during midfacial development. Mech. Dev. 100,313 -316.[CrossRef][Medline]
Barrallo-Gimeno, A., Holzschuh, J., Driever, W. and Knapik, E.
W. (2004). Neural crest survival and differentiation in
zebrafish depends on mont blanc/tfap2a gene function.
Development 131,1463
-1477.
Bobola, N., Carapuco, M., Ohnemus, S., Kanzler, B., Leibbrandt,
A., Neubuser, A., Drouin, J. and Mallo, M. (2003).
Mesenchymal patterning by Hoxa2 requires blocking Fgf-dependent activation of
Ptx1. Development 130,3403
-3414.
Brown, L. A., Rodaway, A. R., Schilling, T. F., Jowett, T., Ingham, P. W., Patient, R. K. and Sharrocks, A. D. (2000). Insights into early vasculogenesis revealed by expression of the ETS-domain transcription factor Fli-1 in wild-type and mutant zebrafish embryos. Mech. Dev. 90,237 -252.[CrossRef][Medline]
Chazaud, C., OuladAbdelghani, M., Bouillet, P., Decimo, D., Chambon, P. and Dolle, P. (1996). AP-2.2, a novel gene related to AP-2, is expressed in the forebrain, limbs and face during mouse embryogenesis. Mech. Dev. 54, 83-94.[CrossRef][Medline]
Creuzet, S., Schuler, B., Couly, G. and LeDouarin, N. M.
(2004). Reciprocal relationships between Fgf8 and neural crest
cells in facial and forebrain development. Proc. Natl. Acad. Sci.
USA 101,4843
-4847.
Crump, J. G., Maves, L., Lawson, N. D., Weinstein, B. M. and
Kimmel, C. B. (2004). An essential role for Fgfs and
endodermal pouch formation influences later craniofacial skeletal patterning.
Development 131,5703
-5716.
David, N. B., Saint-Etienne, L., Tsang, M., Schilling, T. F. and
Rosa, F. M. (2002). Requirement for endoderm and FGF3 in
ventral head skeleton formation. Development
129,4457
-4468.
Decary, S., Decesse, J. T., Ogryzko, V., Reed, J. C.,
Naguibneva, I., Harel- Bellan, A. and Cremisi, C. E. (2002).
The retinoblastoma protein binds the promoter of the survival gene bcl-2 and
regulates its transcription in epithelial cells through transcription factor
AP-2. Mol. Cell. Biol.
22,7877
-7888.
Furthauer, M., Thisse, C. and Thisse, B. (1997). A role for FGF-8 in the dorsoventral patterning of the zebrafish gastrula. Development 124,4253 -4264.[Abstract]
Furthauer, M., Lin, W., Ang, S. L., Thisse, B. and Thisse, C. (2002). Sef is a feedback-induced antagonist of Ras/MAPK-mediated Fgf signaling. Nat. Cell Biol. 4, 170-174.[CrossRef][Medline]
Graham, A. (2003). Development of the pharyngeal arches. Am. J. Med. Genet. 119A,251 -256.
Hall, B. K. (1980). Tissue interactions and the initiation of osteogenesis and chondrogenesis in the neural crest-derived mandibular skeleton of the embryonic mouse as seen in isolated murine tissues and in recombinations of murine and avian tissues. J. Embryol. Exp. Morph. 58,251 -264.[Medline]
Hilger-Eversheim, K., Moser, M., Schorle, H. and Buettner, R. (2000). Regulatory roles of AP-2 transcription factors in vertebrate development, apoptosis and cell cycle control. Gene 260,1 -12.[CrossRef][Medline]
Hu, D. and Helms, J. A. (1999). The role of sonic hedgehog in normal and abnormal craniofacial morphogenesis. Development 126,4873 -4884.[Abstract]
Huang, S., Jean, D., Luca, M., Tainsky, M. A. and Bar-Eli, M. (1998). Loss of AP-2 results in downregulation of c-KIT and enhancement of melanoma tumorigenicity and metastasis. EMBO J. 17,4358 -4369.[CrossRef][Medline]
Hunter, M. P. and Prince, V. E. (2002). Zebrafish hox paralogue group 2 genes function redundantly as selector genes to pattern the second pharyngeal arch. Dev. Biol. 247,367 -389.[CrossRef][Medline]
Javidan, Y. and Schilling, T. F. (2004). Development of cartilage and bone. In Methods in Cell Biology: Zebrafish Biology (ed. H. W. Detrich, M. Westerfield and L. I. Zon), pp. 415-436. London: Academic Press.
Jeong, J., Mao, J., Tenzen, T., Kottmann, A. H. and McMahon, A.
P. (2004). Hedgehog signaling in neural crest cells regulates
the patterning and growth of facial primordia. Genes
Dev. 18,937
-951.
Kettunen, P. and Thesleff, I. (1998). Expression and function of FGFs-4, -8, and -9 suggest functional redundancy and repetitive use as epithelial signals during tooth morphogenesis. Dev. Dyn. 211,256 -268.[CrossRef][Medline]
Kimmel, C. B., Warga, R. M. and Schilling, T. F.
(1990). Origin and organization of the zebrafish fate map.
Development 108,581
-594.
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and Schilling, T. F. (1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203,253 -310.[Medline]
Kimmel, C. B., Miller, C. T., Kruze, G., Ullmann, B., BreMiller, R. A., Larison, K. D. and Snyder, H. C. (1998). The shaping of pharyngeal cartilages during early development of the zebrafish. Dev. Biol. 203,245 -263.[CrossRef][Medline]
Knight, R. D., Nair, S., Nelson, S. S., Afshar, A., Javidan, Y.,
Geisler, R., Rauch, G. J. and Schilling, T. F. (2003).
Lockjaw encodes a zebrafish tfap2a required for early neural crest
development. Development
130,5755
-5768.
Knight, R. D., Javidan, Y., Nelson, S., Zhang, T. and Schilling, T. F. (2004). Skeletal and pigment cell defects in the lockjaw mutant reveal multiple roles for zebrafish tfap2a in neural crest development. Dev. Dyn. 229, 87-98.[CrossRef][Medline]
Lawson, N. D. and Weinstein, B. M. (2002). In vivo imaging of embryonic vascular development using transgenic zebrafish. Dev. Biol. 248,307 -318.[CrossRef][Medline]
Leask, A., Byrne, C. and Fuchs, E. (2001). Transcription factor AP2 and its role in epidermal-specific gene expression. Proc. Natl. Acad. Sci. USA 88,7948 -7952.
Lee, K. H., Xu, Q. and Breitbart, R. E. (1996). A new tinman-related gene, nkx2.7, anticipates the expression of nkx2.5 and nkx2.3 in zebrafish heart and pharyngeal endoderm. Dev. Biol. 180,722 -731.[CrossRef][Medline]
Li, M., Zhao, C., Wang, Y., Zhao, Z. and Meng, A. (2002). Zebrafish sox9b is an early neural crest marker. Dev. Genes Evol. 212,203 -206.[CrossRef][Medline]
Luo, T., Matsuo-Takasaki, M., Thomas, M. L., Weeks, D. L. and Sargent, T. D. (2002). Transcription factor AP-2 is an essential and direct regulator of epidermal development in Xenopus. Dev. Biol. 245,136 -144.[CrossRef][Medline]
Luo, T., Lee, Y. H., Saint-Jeannet, J. P. and Sargent, T. D.
(2003). Induction of neural crest in Xenopus by transcription
factor AP-2 alpha. Proc. Natl. Acad. Sci. USA
100,532
-537.
Maconochie, M., Krishnamurthy, R., Nonchev, S., Meier, P., Manzanares, M., Mitchell, P. J. and Krumlauf, R. (1999). Regulation of Hoxa2 in cranial neural crest cells involves members of the AP-2 family. Development 126,1483 -1494.[Abstract]
Macatee, T. L., Hammond, B. P., Arenkiel, B. R., Francis, L.,
Frank, D. U. and Moon, A. M. (2003). Ablation of specific
expression domains reveals discrete functions of ectoderm- and
endoderm-derived FGF8 during cardiovascular and pharyngeal development.
Development 130,6361
-6374.
Meulemans, D. and Bronner-Fraser, M. (2002).
Amphioxus and lamprey AP-2 genes: implications for neural crest evolution and
migration patterns. Development
129,4953
-4962.
Morriss-Kay, G. M. (1996). Craniofacial defects in AP-2 null mutant mice. BioEssays 18,785 -788.[CrossRef][Medline]
Moser, M., Imhof, A., Pscherer, A., Bauer, R., Amselgruber, W., Sinowatz, F., Hofstadter, F., Schule, R. and Buettner, R. (1995). Cloning and characterization of a second AP-2 transcription factor: AP-2 beta. Development 121,2779 -2788.[Abstract]
Moser, M., Ruschoff, J. and Buettner, R. (1997a). Comparative analysis of AP-2 alpha and AP-2 beta gene expression during murine embryogenesis. Dev. Dyn. 208,115 -124.[CrossRef][Medline]
Moser, M., Pscherer, A., Roth, C., Becker, J., Mucher, G.,
Zerres, K., Dixkens, C., Weis, J., Guay-Woodford, L., Buettner, R. et al.
(1997b). Enhanced apoptotic cell death of renal epithelial cells
in mice lacking transcription factor AP-2beta. Genes
Dev. 11,1938
-1948.
O'Brien, E. K., d'Alencon, C., Bonde, G., Li, W., Schoenebeck, J., Allende, M. L., Gelb, B. D., Yelon, D., Eisen, J. S. and Cornell, R. A. (2004). Transcription factor Ap-2alpha is necessary for development of embryonic melanophores, autonomic neurons and pharyngeal skeleton in zebrafish. Dev. Biol. 265,246 -261.[CrossRef][Medline]
Pfisterer, P., Ehlermann, J., Hegen, M. and Schorle, H.
(2002). A subtractive gene expression screen suggests a role of
transcription factor AP-2 alpha in control of proliferation and
differentiation. J. Biol. Chem.
277,6637
-6644.
Prince, V. E., Moens, C. B., Kimmel, C. B. and Ho, R. K. (1998). Zebrafish hox genes: expression in the hindbrain region of wild-type and mutants of the segmentation gene, valentino. Development 125,393 -406.[Abstract]
Reifers, F., Adams, J., Mason, I. J., Schulte-Merker, S. and Brand, M. (2000). Overlapping and distinct functions provided by fgf17, a new zebrafish member of the Fgf8/17/18 subgroup of Fgfs. Mech. Dev. 99,39 -49.[CrossRef][Medline]
Rivera-Perez, J. A., Wakamiya, M. and Behringer, R. R. (1999). Goosecoid acts cell autonomously in mesenchyme-derived tissues during craniofacial development. Development 126,3811 -3821.[Abstract]
Roehl, H. and Nusslein-Volhard, C. (2001). Zebrafish pea3 and erm are general targets of FGF8 signaling. Curr. Biol. 11,503 -507.[CrossRef][Medline]
Santagati, F. and Rijli, F. M. (2003). Cranial neural crest and the building of the vertebrate head. Nat. Rev. Neurosci. 4,806 -818.[Medline]
Satoda, M., Zhao, F., Diaz, G. A., Burn, J., Goodship, J., Davidson, H. R., Pierpont, M. E. and Gelb, B. D. (2000). Mutations in TFAP2B cause Char syndrome, a familial form of patent ductus arteriosus. Nat. Genet. 25, 42-46.[CrossRef][Medline]
Schilling, T. F., Piotrowski, T., Grandel, H., Brand, M., Heisenberg, C.-P., Jiang, Y. J., Beuchle, D., Hammerschmidt, M., Kane, D. A., Mullins, M. et al. (1996). Jaw and branchial arch mutants in zebrafish 1, branchial arches. Development 123,329 -344.[Abstract]
Schilling, T. F., Prince, V. and Ingham, P. W. (2001). Plasticity in zebrafish hox expression in the hindbrain and cranial neural crest. Dev. Biol. 231,201 -216.[CrossRef][Medline]
Schorle, H., Meier, P., Buchert, M., Jaenisch, R. and Mitchell, P. J. (1996). Transcription factor AP-2 essential for cranial closure and craniofacial development. Nature 381,235 -238.[CrossRef][Medline]
Stachel, S. E., Grunwald, D. J. and Myers, P. Z. (1993). Lithium perturbation and goosecoid expression identify a dorsal specification pathway in the pregastrula zebrafish. Development 117,1261 -1274.[Abstract]
Thisse, C., Thisse, B., Schilling, T. F. and Postlethwait, J. H. (1993). Structure of the zebrafish snail1 gene and its expression in wild-type, spadetail and no-tail mutant embryos. Development 119,1203 -1215.[Abstract]
Trainor, P. A. and Krumlauf, R. (2000). Plasticity in mouse neural crest cells reveals a new patterning role for cranial mesoderm. Nat. Cell Biol. 2, 96-102.[CrossRef][Medline]
Trainor, P. A., Melton, K. R. and Manzanares, M. (2003). Origins and plasticity of neural crest cells and their roles in jaw and craniofacial evolution. Intl. J. Dev. Biol. 47,541 -553.[Medline]
Trokovic, N., Trokovic, R., Mai, P. and Partanen, J.
(2003). Fgfr1 regulates patterning of the pharyngeal region.
Genes Dev. 17,141
-153.
Trumpp, A., Depew, M. J., Rubenstein, J. L., Bishop, J. M. and
Martin, G. R. (1999). Cre-mediated inactivation demonstrates
that FGF8 is required for cell survival and patterning of the first branchial
arch. Genes Dev. 13,3136
-3148.
Tsang, M., Friesel, R., Kudoh, T. and Dawid, I. B. (2002). Identification of Sef, a novel modulator of FGF signaling. Nat. Cell Biol. 4, 165-169.[CrossRef][Medline]
Tucker, A. S., Yamada, G., Grigoriou, M., Pachnis, V. and Sharpe, P. T. (1999). Fgf-8 determines rostral-caudal polarity of the first branchial arch. Development 126, 51-61.[Abstract]
Veitch, E., Begbie, J., Schilling, T. F., Smith, M. M. and Graham, A. (1999). Pharyngeal arch patterning in the absence of neural crest. Curr. Biol. 9,1481 -1484.[CrossRef][Medline]
Wall, N. A. and Hogan, B. L. (1995). Expression of a bone morphogenetic protein-4 (BMP-4), bone morphogenetic protein-7 (BMP-7), fibroblast growth factor-8 (FGF-8) and sonic hedgehog (SHH) during branchial arch development in the chick. Mech. Dev. 53,383 -392.[CrossRef][Medline]
Walshe, J. and Mason, I. (2003). Fgf signaling is required for formation of cartilage in the head. Dev. Biol. 264,522 -536.[CrossRef][Medline]
Zhang, J. A., Hagopian-Donaldson, S., Serbedzija, G., Elsemore, J., Plehn- Dujowich, D., McMahon, A. P., Flavell, R. A. and Williams, T. (1996). Neural tube, skeletal and body wall defects in mice lacking transcription factor AP-2. Nature 381,238 -241.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
N. Nikitina, T. Sauka-Spengler, and M. Bronner-Fraser Gene Networks in Development and Evolution Special Feature Sackler Colloquium: Dissecting early regulatory relationships in the lamprey neural crest gene network PNAS, December 23, 2008; 105(51): 20083 - 20088. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sauka-Spengler and M. Bronner-Fraser Insights From a Sea Lamprey Into the Evolution of Neural Crest Gene Regulatory Network Biol. Bull., June 1, 2008; 214(3): 303 - 314. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Luo, Y. Xu, T. L. Hoffman, T. Zhang, T. Schilling, and T. D. Sargent Inca: a novel p21-activated kinase-associated protein required for cranial neural crest development Development, April 1, 2007; 134(7): 1279 - 1289. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nair, W. Li, R. Cornell, and T. F. Schilling Requirements for Endothelin type-A receptors and Endothelin-1 signaling in the facial ectoderm for the patterning of skeletogenic neural crest cells in zebrafish Development, January 15, 2007; 134(2): 335 - 345. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Tucker, R. I. Richards, and M. Lardelli Contribution of mGluR and Fmr1 functional pathways to neurite morphogenesis, craniofacial development and fragile X syndrome Hum. Mol. Genet., December 1, 2006; 15(23): 3446 - 3458. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Webb and T. F. Schilling Zebrafish in comparative context: A symposium Integr. Comp. Biol., October 1, 2006; 46(5): 569 - 576. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||