|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online June 8, 2005
doi: 10.1242/10.1242/dev.01875
- and ß-cell development in the pancreas

1 Department of Developmental and Cell Biology, University of California at
Irvine, 4203 McGaugh Hall, Irvine, CA 92697-2300, USA
2 Center for Molecular Neurobiology, Martinistrasse 85, 20251 Hamburg,
Germany
3 Department of Cell and Molecular Biology, Medical Nobel Institute, Karolinska
Institute, S-171 77 Stockholm, Sweden
Author for correspondence (e-mail:
msander{at}uci.edu)
Accepted 21 April 2005
| SUMMARY |
|---|
|
|
|---|
-cell
formation. This finding suggests a more general role for NKX6 factors in
endocrine cell differentiation than formerly suggested. Similar to NKX6
factors, the transcription factor MYT1 has recently been shown to regulate
- as well as ß-cell development. We demonstrate that expression of
Myt1 depends on overall Nkx6 gene dose, and therefore identify
Myt1 as a possible downstream target of Nkx6 genes in the endocrine
differentiation pathway.
Key words: Nkx6.1, Nkx6.2, Myt1, Pancreas, Islet, Endocrine, Insulin, Glucagon, Development, Mouse
| Introduction |
|---|
|
|
|---|
-,
- and PP-cells that produce glucagon, somatostatin and
pancreatic polypeptide (PP), respectively. Because of their role in the
pathogenesis of diabetes mellitus, the mechanisms that underlie formation of
ß-cells have been studied in most detail. Although ß-cell
proliferation appears to be the predominant mechanism of ß-cell
regeneration during adulthood (Dor et al.,
2004
Formation of the mouse pancreas begins at embryonic day (E) 9.5 as separate
dorsal and ventral evaginations from the foregut endoderm
(Slack, 1995
). At this stage,
the epithelium contains multipotent progenitors that express the transcription
factor PDX1 and have the potential to give rise to all pancreatic lineages,
comprising endocrine and exocrine cells, as well as cells of the pancreatic
ducts (Gu et al., 2002
;
Herrera, 2002
). The first
endocrine cells appear as early as E10.5 and produce glucagon- and/or insulin,
but lack specific products characteristic of mature hormone-producing cells
(Oster et al., 1998
;
Wilson et al., 2002
). Mature
insulin- and glucagon-producing cells, as well as cells expressing the
exocrine-specific markers amylase and carboxypeptidase A are first detected
around E13.5. The first
- and PP-cells are found at E15.5 and E18.5,
respectively (Pictet and Rutter,
1972
; Slack,
1995
).
It has been shown that specific transcription factors restrict the
developmental potential of the initially multipotent pancreatic progenitors
and promote their differentiation into specific cell types
(Jensen, 2004
). This is
exemplified by the basic helix-loop-helix (bHLH) transcription factor NGN3,
which limits the potential of a specific subset of pancreatic precursors to
undergo endocrine differentiation while prohibiting an exocrine or ductal cell
fate (Gu et al., 2002
). The
complete absence of hormone-producing cells from the pancreas of
Ngn3-/- mice further supports a role for NGN3 in endocrine
specification (Gradwohl et al.,
2000
). Interestingly, ectopic expression of NGN3 in all pancreatic
precursors largely results in excess differentiation of
-cells, but not
of other endocrine cell types. This indicates that although able to confer
endocrine identity to early pancreatic progenitors, NGN3 requires additional
factors for the differentiation of ß-,
- and PP-cells
(Apelqvist et al., 1999
;
Schwitzgebel et al.,
2000
).
Among the transcription factors that are required for ß-cell
development are NKX2.2, PAX4, HB9 and NKX6.1. In Nkx2.2 and
Pax4 mutants, loss of ß-cells results from a switch to an
alternative endocrine fate (Prado et al.,
2004
; Sosa-Pineda et al.,
1997
), whereas HB9 has been implicated in the control of
ß-cell maturation (Harrison et al.,
1999
; Li et al.,
1999
). Mice deficient for the NK-homeodomain factor NKX6.1 have a
specific defect in ß-cell neogenesis, while all other endocrine cell
types develop normally (Sander et al.,
2000
). In Nkx6.1 mutants, ß-cell development is
disrupted only after E13.5, when the first mature ß-cells appear. This
suggests that the differentiation of early-appearing insulin-positive cells
and mature ß-cells is controlled by independent mechanisms and implies a
selective role for NKX6.1 in just the major ß-cell differentiation
pathway.
The observation that a significant number of ß-cells still form in the
absence of NKX6.1 even after E13.5 points to the existence of an
NKX6.1-independent pathway of ß-cell development. In this study, we
examined the Nkx6.1 paralog Nkx6.2 for its function and
possible synergy with NKX6.1 in pancreatic development. In contrast to NKX6.1,
we found NKX6.2 function to be dispensable for normal endocrine development.
However, our analysis of Nkx6.1;Nkx6.2 double nullizygous mice not
only revealed a partially compensatory role for NKX6.2 in ß-cell
development, but an as of yet unappreciated requirement for NKX6 activity in
-cell formation. We further discovered that NKX6 activity controls
expression of the NGN3 co-factor MYT1 in a dose-dependent manner, thus
providing a possible mechanism by which NKX6 activity may control endocrine
development.
| Materials and methods |
|---|
|
|
|---|
Immunohistochemistry, in situ hybridization, TUNEL assay and X-gal staining
Pancreata were removed from adult mice and embryos at E15.5 and later
stages; pancreatic tissue in embryos at earlier stages was studied in whole
embryos. Samples were fixed in 4% paraformaldehyde in PBS and either
paraffin-embedded or frozen in OCT.
Immunohistochemical detection of proteins was performed as described
previously (Sander et al.,
1997
). The following primary antibodies were used in these assays:
rabbit
-amylin (IAPP) diluted 1:2000 (Peninsula); rabbit
-Hb9
diluted 1:8000 (Harrison et al.,
1999
); rabbit
-amylase (Sigma) diluted 1:500; goat
-ghrelin diluted 1:1000 (Santa Cruz); guinea pig
-glucagon
diluted 1:8000 (Linco); mouse
-glucagon diluted 1:8000 (Sigma); guinea
pig
-insulin diluted 1:8000 (Linco); mouse
-insulin diluted
1:8000 (Sigma); rabbit
-ISL1 diluted 1:5000
(Tsuchida et al., 1994
);
rabbit
-NKX6.1 diluted 1:3000
(Jensen et al., 1996
); guinea
pig
-NKX6.2 diluted 1:4000
(Vallstedt et al., 2001
);
rabbit
-pancreatic polypeptide diluted 1:2000 (Dako); rabbit
-PDX1 diluted 1:3000 (Ohlsson et
al., 1993
); rabbit
-somatostatin diluted 1:3000 (Dako);
rabbit
-NGN3 diluted 1:3000 (Sander
et al., 2000
); rabbit
-PAX6 diluted 1:3000 (S. Saule);
mouse
-BrdU diluted 1:200 (Chemicon); mouse
-ß-galactosidase diluted 1:200 (ICN); NGN3 and NKX6.1 antigens
were produced by inserting the coding sequence for the N-terminal 95 amino
acids (NGN3) and the C-terminal 66 amino acids (NKX6.1) from the mouse genes
downstream of the glutathione-S-transferase coding sequence in the pGEX-2T
vector (Pharmacia). The resulting fusion proteins were purified from E.
coli and injected into guinea pigs; guinea pig
-NGN3 and guinea
pig
-NKX6.1 were diluted 1:1000.
Secondary antibodies used for immunofluorescence were as follows:
Cy3-conjugated
-guinea pig,
-rabbit and
-mouse diluted
1:2000 (Jackson Laboratory); Cy5 conjugated
-rabbit diluted 1:200
(Jackson Laboratory); Alexa (488 nm)-conjugated
-mouse,
-guinea
pig and
-rabbit diluted 1:2000 (Molecular Probes). Images were
collected on a Zeiss Axioplan2 microscope with a Zeiss AxioCam or a Leica
confocal microscope (Leica TCS NT).
TUNEL assays on tissue sections were performed using a commercially available kit (Oncor).
Whole-mount X-gal staining was performed on Nkx6.2tlz/+
mice, in which the Tau-lacZ gene was inserted into the
Nkx6.2 locus. Using
5-bromo-4-chloro-3-indolyl-ß-galactopyranoside (X-gal) as a substrate,
staining was performed on either whole embryos or isolated abdominal organs as
described previously (Mombaerts et al.,
1996
). In situ hybridizations with either digoxigenin-
(Gradwohl et al., 1996
;
Wilkinson, 1992
) or
[
-35S]UTP-labeled antisense riboprobes
(Susens et al., 1997
) were
performed on 10 µm cryosections as described. The following cDNA probes
were used: Myt1 (Gu et al.,
2004
), Ngn3 (Gradwohl
et al., 2000
) and Pax4
(Wang et al., 2004
).
RNA preparation and real-time quantitative PCR
Total RNA from dissected pancreatic anlagen was extracted with the RNeasy
kit (Qiagen) and treated with DNAse. cDNA was prepared by in vitro
transcription using SuperscriptII reverse transcriptase (Invitrogen). PCR
reactions were performed in triplicate in a total reaction volume of 50 µl,
and amplifications performed in an ABI Prism 7700 sequence detecting system
(Applied Biosystems). With the exception of Myt1, which was detected
with Taqman Universal PCR Mastermix (Applied Biosystems), all transcripts were
amplified with 1 x SYBR Green PCR master mix (Applied Biosystems) and
300 nM of each primer. To exclude contamination with non-specific PCR
products, melting curves were analyzed for all PCR products. The following
cycle was used for the amplification: 50°C for 2 minutes; 95°C for 10
minutes; followed by 40 cycles of denaturation at 95°C for 15 seconds; and
primer extension at 60°C for 1 minute. For each reaction, a parallel
reaction that lacked template was performed as a negative control. Relative
changes in gene expression were calculated by the comparative
Ct method
in which
-actin was used for normalization with the SYBR Green method
and HPRT with the Taqman method (Livak and
Schmittgen, 2001
). Listed 5' to 3', primer sequences
were as follows:
-actin forward, GCACCCGGTGCTTCTGAC;
-actin
reverse, CCAGATGCATACAAGGAC; glucagon forward, TTCCCAGAAGAAGTCGCCATT; glucagon
reverse, TCCCTGGTGGCAAGATTATCC; insulin forward, CCACCCAGGCTTTTGTCAAA; insulin
reverse, CCCAGCTCCAGTTGTTCCAC. The Taqman gene expression IDs were
Mm00456190_m1 for Myt1 and Mm00446968_m1 for HPRT.
Hormone quantification and cell counting
Protein was extracted from individual pancreata of E18.5 embryos using acid
extraction and protein concentration was then determined by the Bradford
dye-binding assay. The concentrations of insulin and glucagon were determined
by radioimmunoassay (RIA) using commercially available kits (Linco).
To obtain a representative average of the number of hormone-positive cells, an entire pancreas was used for quantification. Immunofluorescence staining was performed on 10 µm sections and positive cells counted on every ninth section throughout the pancreas at E16.5 and E18.5, every fifth section at E12.5 and E14.5, and all sections at E10.5. The average cell number per section was determined for all sections counted from each individual pancreas. Mean differences were tested for statistical significance using the Student's t-test.
|
| Results |
|---|
|
|
|---|
To examine which pancreatic cell types express NKX6.2, we performed
co-immunofluorescence analyses with an anti-NKX6.2 antibody, together with
antibodies against various pancreatic markers. Demonstrating specificity of
the anti-NKX6.2 antibody, NKX6.2 and ß-gal colocalized in cells of the
distal stomach epithelium and dorsal pancreas in
Nkx6.2tlz/+ embryos
(Fig. 1B), whereas no NKX6.2
staining was detected in Nkx6.2tlz/tlz embryos (see Fig.
S1B in the supplementary material). At E10.5, when PDX1 marks the entire
pancreatic epithelium as well as the prospective distal stomach and duodenum
(Fig. 1C; see Fig. S1C in the
supplementary material) (Offield et al.,
1996
), NKX6.2 colocalized with PDX1 in the pancreatic and stomach
epithelium (Fig. 1C). Notably,
NKX6.2 was found in a large percentage (
70%) of, but not in all,
PDX1+ cells, and was absent from the early glucagon-expressing
cells at E10.5 (Fig. 1D). By
E12.5, NKX6.2 expression became restricted to a few epithelial cells, of which
a significant proportion expressed glucagon
(Fig. 1E). At E15.5, the
pancreatic epithelium contains undifferentiated pancreatic progenitors, which
include the NGN3+ endocrine progenitors, as well as already
differentiated
-, ß- and exocrine cells. Nkx6.2 is not
part of the endocrine progenitor pool at E15.5 or prior, as NKX6.2 does not
colocalize with NGN3 (Fig. 1G,
data not shown). Likewise, NKX6.2 was not detected in insulin-producing
ß-cells (Fig. 1H).
Instead, we found that all NKX6.2+ cells co-expressed either
glucagon or amylase (Fig. 1I).
As both endocrine and exocrine cells express PDX1 at E15.5, this finding is
consistent with the observation that the vast majority of NKX6.2+
cells were PDX1+ (Fig.
1J). Interestingly, only a subset of, but not all
- and
exocrine cells expressed NKX6.2 (Fig.
1I). Together with the finding that NKX6.2 expression disappears
from the pancreas around birth, these observations indicate that maturation of
- and exocrine cells coincides with the downregulation of NKX6.2.
As NKX6.2 is not expressed in NGN3+ endocrine progenitors or ß-cells (Fig. 1G,H), we asked whether PDX1/NKX6.2 co-expressing progenitors could give rise to NGN3+ or insulin+ cells. To test this issue, we used the highly stable ß-gal protein as a tracer for the fate of Nkx6.2-expressing cells. Similar to NKX6.2 protein (Fig. 1I), we found ß-gal to colocalize with glucagon and amylase (Fig. 1M,N). However, in contrast to NKX6.2 protein, a number of ß-gal+ cells co-expressed either NGN3 or insulin (Fig. 1K,L). Given the stability of ß-gal protein, these data are consistent with the idea that Nkx6.2-expressing cells differentiate into NGN3+ endocrine progenitors and ultimately into ß-cells.
|
33% of all
NKX6+ cells) or NKX6.2 (
16%); second, a small population of
cells that expressed both NKX6 proteins at similar levels; and finally, cells
that produced low levels of one NKX6 factor, but high levels of the other (all
three populations of co-expressing cells account for
51% of
NKX6+ cells). At E12.5, the vast majority of pancreatic epithelial
cells exclusively expressed NKX6.1 (
86% of all NKX6+ cells),
and only a few, scattered cells co-expressed NKX6.1 and NKX6.2 (
3%)
(Fig. 2C). Consistent with the
absence of NKX6.2 from insulin+ and NGN3+ cells
(Fig. 1G,H), NKX6.1 and NKX6.2
were found in entirely separate domains at E15.5
(Fig. 2D). Thus, with the
exception of the early, undifferentiated epithelium, NKX6.1 and NKX6.2 mark
different cell populations in the pancreas.
Nkx6.2 is regulated by NKX6.1
Similar to our observations in the pancreas, a progressive segregation of
the NKX6.1 and NKX6.2 expression domains was also noted during spinal cord
development (Vallstedt et al.,
2001
). Moreover, it was observed that NKX6.1 represses the
expression of NKX6.2 in the spinal cord, providing a possible mechanism for
how their exclusive expression domains are established and maintained.
To determine if a similar mechanism operates in the pancreas, we examined
whether absence of NKX6.1 affects expression of NKX6.2. Although we did not
detect any difference in the number of NKX6.2+ cells between
wild-type and Nkx6.1 mutants at E10.5
(Fig. 3Q), their number was
increased in Nkx6.1 mutants at E12.5
(Fig. 3E,F,Q). Likewise,
microarray experiments from whole pancreatic epithelium showed a significant
upregulation of Nkx6.2 mRNA in Nkx6.1 mutants at E13.5
(5.2-fold) and E15.5 (2.8-fold) (data not shown). To test if there is mutual
cross-repression between the two NKX6 factors, we also analyzed the expression
of NKX6.1 in Nkx6.2 mutants, but did not detect an increase in the
number of NKX6.1+ cells (data not shown). Therefore, similar to
spinal cord (Vallstedt et al.,
2001
), NKX6.1 represses Nkx6.2, but NKX6.2 does not
repress Nkx6.1 in the pancreas.
Next, we examined whether the normal expression domain of NKX6.1 is fully reconstituted by NKX6.2 in Nkx6.1 mutants. Between E10.5 and E15.5, NKX6.1 is normally found in a large percentage of undifferentiated epithelial cells, which includes the majority of NGN3+ endocrine progenitors (Fig. 3A; data not shown). In addition, NKX6.1 was expressed in all insulin+ cells, occasionally in glucagon+ cells, but was absent from the exocrine lineage (Fig. 3B-D). In Nkx6.1 mutants, NKX6.2 was not detected in insulin+ or NGN3+ cells at E15.5 or prior (Fig. 3H,J; data not shown), indicating that the absence of NKX6.1 does not result in a full reconstitution of the genuine NKX6.1 expression domain by NKX6.2.
|
-
or exocrine cells. This did not appear to be the case, as a similar fraction
of glucagon- and amylase-producing cells stained positive for NKX6.2 in wild
type and Nkx6.1 mutants (Fig.
3K-N). Together, these findings suggest that NKX6.2 is not
ectopically activated in differentiated cells. Therefore, we tested if
NKX6.2+ cells co-expressed PDX1, which in addition to ß- and
exocrine cells, marks pancreatic progenitors at E15.5. Indeed, more than 90%
of NKX6.2+ cells in Nkx6.1 mutants were also
PDX1+ (Fig. 3P). As
we did not observe ectopic expression of NKX6.2 in ß- or exocrine cells,
we can infer that upregulation of NKX6.2 in the absence of NKX6.1 most
probably occurs in pancreatic progenitors. Notably, at E18.5, NKX6.2 is no
longer detected in either wild-type or Nkx6.1 mutant pancreas,
suggesting that NKX6.2 is only transiently upregulated during development.
|
These findings demonstrate that NKX6.2 is dispensable for normal pancreas
development, but do not exclude a compensatory function of NKX6.2 in the
absence of NKX6.1 activity. To test if NKX6.1 and NKX6.2 have partially
redundant functions, we compared pancreatic endocrine development
Nkx6.1 single and Nkx6.1;Nkx6.2 double nullizygous embryos.
As in Nkx6.1 and Nkx6.2 single mutants, the pancreas was of
normal size in Nkx6.1-/-;Nkx6.2-/- embryos at
E18.5. In the absence of NKX6.1 alone, the number of insulin+ cells
was reduced by
85%, while the number of glucagon+,
somatostatin+ and PP+ cells was normal
(Fig. 4A,C,E;
Fig. 5A,C,E,G). Additional
deletion of Nkx6.2 in an Nkx6.1 mutant background resulted
in a significant further reduction of insulin+ cells to only
8% of wild-type embryos (Fig.
4C,D,E). Notably, the insulin+ cells in both
Nkx6.1-/- and
Nkx6.1-/-;Nkx6.2-/- embryos lacked expression
of the mature ß-cell marker MAFA and Glut2, but were PDX1-, PAX6- and
HB9-positive (data not shown). Surprisingly, we also observed a drastic
(
65%) reduction in glucagon cell numbers in
Nkx6.1-/-;Nkx6.2-/- embryos
(Fig. 4D,E), a phenotype that
was not observed in either of the two Nkx6 single mutants
(Fig. 4B,C,E). Development of
somatostatin- and PP-producing cells was not affected in
Nkx6.1-/-;Nkx6.2-/- embryos
(Fig. 5D,H). Similar to cell
numbers, pancreatic insulin and glucagon mRNA levels were also significantly
lower in Nkx6.1-/-;Nkx6.2-/- than in
Nkx6.1-/- embryos (Fig.
4F). Thus, our present findings reveal a requirement for NKX6
activity in the development of both the insulin and the glucagon lineages. The
role of NKX6 proteins in
-cell development could not be revealed from
the analysis of either Nkx6 single mutant, as the other NKX6 factor
fully compensates.
|
- and ß-cells, which only form
later during embryogenesis (Herrera,
2000
No evidence for endocrine cell conversion in the absence of NKX6 activity
A possible mechanism that could account for the reduction in insulin- and
glucagon-producing cells is that progenitors differentiate along an alternate
path. Such fate conversion has recently been shown to be the cause of
ß-cell loss in Nkx2.2 and Pax4 mutant mice
(Prado et al., 2004
), where
cells producing the hormone ghrelin are formed at the expense of ß-cells.
To determine if a similar fate conversion underlies the ß- and
-cell loss in the absence of NKX6 activity, we analyzed the expression
of ghrelin in Nkx6 compound mutants, but did not detect an increase
in ghrelin+ cells (Fig.
5I-L). Together with our finding that the number of somatostatin-
and PP-producing cells were normal in
Nkx6.1-/-;Nkx6.2-/- embryos
(Fig. 5D,H), these results
indicate that endocrine fate conversion does not account for the reduction in
insulin- and glucagon-producing cells in NKX6-deficient mice.
An alternative explanation for the reduction in insulin and glucagon cell
numbers is that endocrine cells are arrested in their final steps of
differentiation and therefore fail to produce hormones. If endocrine
precursors were arrested before their final differentiation, one would expect
to detect cells that have initiated expression of some endocrine markers, such
as IAPP, ISL1 or PAX6. However, we found that the number of IAPP-, ISL1- and
PAX6-producing cells mirrored the number of hormone-positive cells in all
Nkx6 compound mutants. Although Nkx6.2 mutants resembled
wild-type embryos, a gradual reduction in the number of IAPP-, ISL1- and
PAX6-producing cells was observed with deletion of either Nkx6.1
alone or the combined deletion of both Nkx6.1 and Nkx6.2
(Fig. 6A-L). Likewise,
expression of the ß-cell markers HB9 and PDX1 was markedly reduced in
Nkx6.1-/- and almost absent in
Nkx6.1-/-;Nkx6.2-/- embryos (see Fig. S2I in
the supplementary material; data not shown). These results argue against a
defect in terminal differentiation of ß- and
-cells in
Nkx6 mutants.
NKX6 activity regulates expression of the NGN3 co-factor Myt1
We next addressed whether loss of both NKX6.1 and NKX6.2 affects the
formation of NGN3+ endocrine progenitors. As determined by in situ
hybridization and immunofluorescence staining, all Nkx6 compound
mutants had similar numbers of NGN3-expressing cells as did wild-type embryos
at E14.5 (Fig. 7A-D;
NGN3+ cell numbers as determined by immunofluorescence:
Nkx6.2-/-
80% of wild type;
Nkx6.1-/-
80% of wild type;
Nkx6.1-/-;Nkx6.2-/-
92% of wild type).
Likewise, in our microarray experiments we found no reduction in Ngn3
mRNA levels in Nkx6.1 mutant pancreas at E13.5 or E15.5 (data not
shown). At E16.5, we consistently observed a slight (
20%), but not
statistically significant reduction in the number of NGN3+ cells in
Nkx6.1-/- and
Nkx6.1-/-;Nkx6.2-/- embryos
(Table 1). Notably, in all
genotypes, more than 95% of all NGN3+ or PAX6+ cells
were BrdU negative (data not shown), indicating that the majority of endocrine
progenitors are not in S-phase of the cell cycle. It is therefore unlikely
that differences in the proliferative rate of NGN3+ progenitors
account for the loss of endocrine cells in Nkx6 mutants. Likewise, as
there is no increase in the number of TUNEL+ cells
(Table 1), cell death does not
appear to be the underlying mechanism.
|
|
Recent findings indicate that NGN3 alone is insufficient to induce
endocrine differentiation, but requires the zinc-finger transcription factor
MYT1 as a co-factor. Expression of a dominant-negative form of Myt1
(DnMYT1) reduces the ability of NGN3 to induce ectopic glucagon expression
from chicken endoderm (Gu et al.,
2004
). Moreover, inhibition of MYT1 activity in endocrine
progenitors by DnMYT1 in transgenic mice results in a severe reduction in the
number of insulin- and glucagon-producing cells
(Gu et al., 2004
), suggesting
that both NGN3 and MYT1 need to be present for normal
- and ß-cell
development. As the phenotype caused by expression of DnMYT1 resembles our
observations in Nkx6.1-/-;Nkx6.2-/- embryos, we
considered the possibility that Nkx6 genes function in a common
genetic pathway with Myt1. A first hint that NKX6 factors regulate
Myt1 came from our microarray experiments, which showed a significant
reduction of Myt1 expression in Nkx6.1 mutants at E13.5 and
E15.5 (1.7- and 1.8-fold, respectively; data not shown). To test whether
Myt1 expression depends on overall Nkx6 gene dose, we
analyzed Myt1 in pancreas of Nkx6 compound mutants by in
situ hybridization. Corresponding to the microarray data, we found that the
number of Myt1-expressing cells was mildly reduced in Nkx6.1
mutants (Fig. 7E,G), while
severely diminished in Nkx6.1-/-;Nkx6.2-/-
embryos (Fig. 7E,H). Such
dose-dependent regulation of Myt1 expression by NKX6 activity was
confirmed by quantitative RT-PCR, which showed a 1.5-fold and 3.3-fold
reduction in Myt1 mRNA levels in Nkx6.1-/- and
Nkx6.1-/-;Nkx6.2-/- embryos, respectively
(Fig. 7I). These findings
suggest that NKX6 factors control
- and ß-cell differentiation by
either directly or indirectly regulating the expression of the NGN3 co-factor
MYT1.
| Discussion |
|---|
|
|
|---|
-cell numbers are normal in either Nkx6.1 or
Nkx6.2 single null mutants, but markedly reduced in the absence of
both NKX6 factors. Based on the observation that NKX6 factors control
pancreatic expression of the NGN3 co-factor Myt1 in a dose-dependent
fashion, we propose that NKX6 factors function in endocrine differentiation
through regulation of Myt1.
Distinct and redundant activities of NKX6.1 and NKX6.2 proteins in pancreatic development
In this study, we show that proper
- and ß-cell development
requires the combined activities of both NKX6.1 and NKX6.2. Although NKX6.2
fully rescues
-cell formation in the absence of NKX6.1, it only
partially compensates for NKX6.1 in ß-cell development. One possible
explanation for the only partial rescue of ß-cells is that both NKX6
factors have distinct biological functions. Although we cannot exclude this
possibility, there is currently little biochemical or biological evidence to
suggest that NKX6.1 and NKX6.2 have disparate activities. First, both NKX6
factors share almost identical DNA-binding homeodomains, bind to similar
target sequences (Awatramani et al.,
2000
; Jorgensen et al.,
1999
; Mirmira et al.,
2000
), and function both as transcriptional repressors through
interaction with Gro/TLE co-repressor proteins
(Muhr et al., 2001
). Second,
when transfected into the developing neural tube, NKX6.1 and NKX6.2 have
qualitatively similar activities in inducing motoneurons
(Vallstedt et al., 2001
). A
second potential mechanism that could account for the inability of NKX6.2 to
compensate for NKX6.1 in ß-cell differentiation is the difference in
their spatial expression domains. In support of this idea, we found only
NKX6.1, but not NKX6.2, to be expressed in NGN3+ endocrine
progenitors and ß-cells. It is therefore possible that normal development
of the ß-cell lineage requires sustained expression of NKX6 factors in
endocrine progenitors and/or ß-cells, while
-cell development
requires only NKX6 activity in PDX1+ progenitors. Consistent with
this view, ectopic expression of Ngn3 under control of the
Pdx1 promoter leads to premature formation of
- but not
ß-cells (Apelqvist et al.,
1999
; Schwitzgebel et al.,
2000
).
|
|
NKX6 and MYT1 function in pancreatic endocrine development
Based upon the finding that Nkx6.1 mutants display a selective
reduction in ß-cells, it was suggested that NKX6.1 functions exclusively
in the ß-cell differentiation pathway
(Sander et al., 2000
). Our
present results demonstrate a previously unrecognized requirement for NKX6
activity in
-cell formation, therefore suggesting a more general role
for NKX6 factors in pancreatic endocrine development. A possible mechanism for
how NKX6 activity may control
- and ß-cell differentiation is
provided by our finding that NKX6 proteins regulate expression of the
neurogenin (NGN) co-factor MYT1 in a dose-dependent manner. Both neurogenesis
and pancreatic endocrine differentiation require the combined activities of
MYT1 and NGN (Bellefroid et al.,
1996
; Gu et al.,
2004
). In the nervous system, NGN can induce the expression of
Myt1, which suggests that they may function in a linear genetic
pathway (Bellefroid et al.,
1996
). If regulation of these factors in the pancreas is similar
to the nervous system, and NGN3 would be able to induce the expression of
Myt1, it would explain why ectopic expression of Ngn3 alone
is sufficient to induce pancreatic endocrine differentiation. However, from
our results we can conclude that regulation of Myt1 by NKX6 factors
is independent of NGN3, as Ngn3 is normally expressed in
Nkx6 single and in Nkx6.1;Nkx6.2 double mutant mice. Thus,
we propose that NGN3 is not sufficient to induce and/or maintain Myt1
in the pancreas, but that Myt1 expression requires the activity of
NKX6 factors. Although we cannot exclude a cell-autonomous mechanism, our
finding that NKX6.2 is expressed only in PDX1+, but absent from
NGN3+ progenitors, while Myt1 is enriched in
Ngn3-expressing cells (Gu et al.,
2004
), suggests that NKX6 factors regulate Myt1 through a
non-cell autonomous mechanism (Fig.
8).
If NKX6 activity is necessary for Myt1 expression, how can we
reconcile the fact that Myt1 is still present in
Nkx6.1;Nkx6.2 double mutant mice? One possible explanation is that
NKX6.1 and NKX6.2 do not account for all NKX6 activity in the pancreas. The
mouse genome indeed contains a third Nkx6 class gene that we found to
be expressed in E10.5 and E14.5 pancreas by RT-PCR (K.D.H. and M.S.,
unpublished). This residual NKX6 activity could account for the low levels of
Myt1 as well as for the small numbers of
- and ß-cells
that still differentiate in the pancreas of
Nkx6.1-/-;Nkx6.2-/- embryos. It remains to be
shown if deletion of all three Nkx6 genes in mice will result in a
complete absence of Myt1 expression and a subsequent block of all
endocrine cell differentiation, or whether, alternatively, NKX6 factors have a
specific role in the development of just the
- and ß-cell
lineages, while
- and PP-cell differentiation are controlled by a
NKX6-independent mechanism.
In contrast to Myt1, NGN3 expression appears to be independent of
NKX6 activity. This is supported by our finding that NGN3 expression is normal
in Nkx6 mutants until E15.5 and only slightly (
20%) reduced at
E16.5. As the reduction in NGN3 cell numbers at E16.5 is small and observed to
the same extent in Nkx6.1-/- and
Nkx6.1-/-;Nkx6.2-/- embryos, it is
unlikely to account for the loss of glucagon+ cells, which is only
seen in Nkx6.1-/-;Nkx6.2-/- embryos.
This raises the issue of how absence of NKX6 activity affects the fate of
NGN3+ cells. In our analyses, we did not find any evidence for
persistence of NGN3+ cells at later developmental time points (data
not shown) or a subsequent arrest in their endocrine differentiation.
Moreover, our observation that the number of apoptotic, somatostatin-, PP- or
ghrelin-producing cells was normal in Nkx6 mutants, argues against
cell death or endocrine fate conversion as an underlying cause of
- and
ß-cell loss. This leaves the possibility that absence of NKX6 activity
leads to the differentiation of NGN3+ progenitors into
non-endocrine cells; a hypothesis that we are currently testing.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/132/13/3139/DC1
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Apelqvist, A., Li, H., Sommer, L., Beatus, P., Anderson, D. J.,
Honjo, T., Hrabe de Angelis, M., Lendahl, U. and Edlund, H.
(1999). Notch signalling controls pancreatic cell
differentiation. Nature
400,877
-881.[CrossRef][Medline]
Awatramani, R., Beesley, J., Yang, H., Jiang, H., Cambi, F.,
Grinspan, J., Garbern, J. and Kamholz, J. (2000). Gtx, an
oligodendrocyte-specific homeodomain protein, has repressor activity.
J. Neurosci. Res. 61,376
-387.[CrossRef][Medline]
Bellefroid, E. J., Bourguignon, C., Hollemann, T., Ma, Q.,
Anderson, D. J., Kintner, C. and Pieler, T. (1996). X-MyT1, a
Xenopus C2HC-type zinc finger protein with a regulatory function in
neuronal differentiation. Cell
87,1191
-1202.[CrossRef][Medline]
Dor, Y., Brown, J., Martinez, O. I. and Melton, D. A.
(2004). Adult pancreatic beta-cells are formed by
self-duplication rather than stem-cell differentiation.
Nature 429,41
-46.[CrossRef][Medline]
Gradwohl, G., Fode, C. and Guillemot, F.
(1996). Restricted expression of a novel murine atonal-related
bHLH protein in undifferentiated neural precursors. Dev.
Biol. 180,227
-241.[CrossRef][Medline]
Gradwohl, G., Dierich, A., LeMeur, M. and Guillemot, F.
(2000). neurogenin3 is required for the development of the four
endocrine cell lineages of the pancreas. Proc. Natl. Acad. Sci.
USA 97,1607
-1611.
Gu, G., Dubauskaite, J. and Melton, D. A.
(2002). Direct evidence for the pancreatic lineage: NGN3+ cells
are islet progenitors and are distinct from duct progenitors.
Development 129,2447
-2457.
Gu, G., Wells, J. M., Dombkowski, D., Preffer, F., Aronow, B.
and Melton, D. A. (2004). Global expression analysis of gene
regulatory pathways during endocrine pancreatic development.
Development 131,165
-179.
Harrison, K. A., Thaler, J., Pfaff, S. L., Gu, H. and Kehrl, J.
H. (1999). Pancreas dorsal lobe agenesis and abnormal islets
of Langerhans in Hlxb9-deficient mice. Nat. Genet.
23, 71-75.[Medline]
Herrera, P. L. (2000). Adult insulin- and
glucagon-producing cells differentiate from two independent cell lineages.
Development 127,2317
-2322.[Abstract]
Herrera, P. L. (2002). Defining the cell
lineages of the islets of Langerhans using transgenic mice. Int. J.
Dev. Biol. 46,97
-103.[CrossRef][Medline]
Jensen, J. (2004). Gene regulatory factors in
pancreatic development. Dev. Dyn.
229,176
-200.[CrossRef][Medline]
Jensen, J., Serup, P., Karlsen, C., Nielsen, T. F. and Madsen,
O. D. (1996). mRNA profiling of rat islet tumors reveals nkx
6.1 as a beta-cell-specific homeodomain transcription factor. J.
Biol. Chem. 271,18749
-18758.
Jorgensen, M. C., Vestergard Petersen, H., Ericson, J., Madsen,
O. D. and Serup, P. (1999). Cloning and DNA-binding
properties of the rat pancreatic beta-cell-specific factor Nkx6.1.
FEBS Lett. 461,287
-294.[CrossRef][Medline]
Kim, S. K. and MacDonald, R. J. (2002).
Signaling and transcriptional control of pancreatic organogenesis.
Curr. Opin. Genet. Dev.
12,540
-557.[CrossRef][Medline]
Li, H., Arber, S., Jessell, T. M. and Edlund, H.
(1999). Selective agenesis of the dorsal pancreas in mice lacking
homeobox gene Hlxb9. Nat. Genet.
23, 67-70.[Medline]
Livak, K. J. and Schmittgen, T. D. (2001).
Analysis of relative gene expression data using real-time quantitative PCR and
the 2(-Delta Delta C(T)) method. Methods
25,402
-408.[CrossRef][Medline]
Mirmira, R. G., Watada, H. and German, M. S.
(2000). Beta-cell differentiation factor Nkx6.1 contains
distinct DNA binding interference and transcriptional repression domains.
J. Biol. Chem. 275,14743
-14751.
Mombaerts, P., Wang, F., Dulac, C., Chao, S. K., Nemes, A.,
Mendelsohn, M., Edmondson, J. and Axel, R. (1996).
Visualizing an olfactory sensory map. Cell
87,675
-686.[CrossRef][Medline]
Muhr, J., Andersson, E., Persson, M., Jessell, T. M. and
Ericson, J. (2001). Groucho-mediated transcriptional
repression establishes progenitor cell pattern and neuronal fate in the
ventral neural tube. Cell
104,861
-873.[CrossRef][Medline]
Muller, M., Jabs, N., Lorke, D. E., Fritzsch, B. and Sander,
M. (2003). Nkx6.1 controls migration and axon
pathfinding of cranial branchio-motoneurons.
Development 130,5815
-5826.
Offield, M. F., Jetton, T. L., Labosky, P. A., Ray, M., Stein,
R. W., Magnuson, M. A., Hogan, B. L. and Wright, C. V.
(1996). PDX-1 is required for pancreatic outgrowth and
differentiation of the rostral duodenum. Development
122,983
-995.[Abstract]
Ohlsson, H., Karlsson, K. and Edlund, T.
(1993). IPF1, a homeodomain-containing transactivator of the
insulin gene. EMBO J.
12,4251
-4259.[Medline]
Oster, A., Jensen, J., Serup, P., Galante, P., Madsen, O. D. and
Larsson, L. I. (1998). Rat endocrine pancreatic development
in relation to two homeobox gene products (Pdx-1 and Nkx
6.1). J. Histochem. Cytochem.
46,707
-715.
Pictet, R. and Rutter, W. J. (1972).
Development of the embryonic endocrine pancreas. In Handbook of
Physiology, Section 7, Vol. 1 (ed. A. P.
Society, D. F. Steiner and N. Frenkel), pp. 25-66.
Washington DC: Williams and Wilkins.
Prado, C. L., Pugh-Bernard, A. E., Elghazi, L., Sosa-Pineda, B.
and Sussel, L. (2004). Ghrelin cells replace
insulin-producing beta cells in two mouse models of pancreas development.
Proc. Natl. Acad. Sci. USA
101,2924
-2929.
Sander, M., Neubuser, A., Kalamaras, J., Ee, H. C., Martin, G.
R. and German, M. S. (1997). Genetic analysis reveals that
PAX6 is required for normal transcription of pancreatic hormone genes and
islet development. Genes Dev.
11,1662
-1673.
Sander, M., Sussel, L., Conners, J., Scheel, D., Kalamaras, J.,
Dela Cruz, F., Schwitzgebel, V., Hayes-Jordan, A. and German, M.
(2000). Homeobox gene Nkx6.1 lies downstream of
Nkx2.2 in the major pathway of beta-cell formation in the pancreas.
Development 127,5533
-5540.[Abstract]
Schwitzgebel, V. M., Scheel, D. W., Conners, J. R., Kalamaras,
J., Lee, J. E., Anderson, D. J., Sussel, L., Johnson, J. D. and German, M.
S. (2000). Expression of neurogenin3 reveals an islet cell
precursor population in the pancreas. Development
127,3533
-3542.[Abstract]
Slack, J. M. (1995). Developmental biology of
the pancreas. Development
121,1569
-1580.[Abstract]
Sosa-Pineda, B., Chowdhury, K., Torres, M., Oliver, G. and
Gruss, P. (1997). The Pax4 gene is essential for
differentiation of insulin-producing beta cells in the mammalian pancreas.
Nature 386,399
-402.[CrossRef][Medline]
Susens, U., Aguiluz, J. B., Evans, R. M. and Borgmeyer, U.
(1997). The germ cell nuclear factor mGCNF is expressed in the
developing nervous system. Dev. Neurosci.
19,410
-420.[Medline]
Tsuchida, T., Ensini, M., Morton, S. B., Baldassare, M., Edlund,
T., Jessell, T. M. and Pfaff, S. L. (1994). Topographic
organization of embryonic motor neurons defined by expression of LIM homeobox
genes [see comments]. Cell
79,957
-970.[CrossRef][Medline]
Vallstedt, A., Muhr, J., Pattyn, A., Pierani, A., Mendelsohn,
M., Sander, M., Jessell, T. M. and Ericson, J. (2001).
Different levels of repressor activity assign redundant and specific roles to
Nkx6 genes in motor neuron and interneuron specification.
Neuron 31,743
-755.[CrossRef][Medline]
Wang, J., Elghazi, L., Parker, S. E., Kizilocak, H., Asano, M.,
Sussel, L. and Sosa-Pineda, B. (2004). The concerted
activities of Pax4 and Nkx2.2 are essential to initiate
pancreatic beta-cell differentiation. Dev. Biol.
266,178
-189.[CrossRef][Medline]
Wilkinson, D. G. (1992). Whole mount in situ
hybridisation of vertebrate embryos. In In Situ Hybridisation. A
Practical Approach (ed. D. G. Wilkinson), pp.75
-83. Oxford: Oxford University Press.
Wilson, M. E., Kalamaras, J. A. and German, M. S.
(2002). Expression pattern of IAPP and prohormone convertase 1/3
reveals a distinctive set of endocrine cells in the embryonic pancreas.
Mech. Dev. 115,171
-176.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
T. Guo and M. Hebrok Stem Cells to Pancreatic {beta}-Cells: New Sources for Diabetes Cell Therapy Endocr. Rev., May 1, 2009; 30(3): 214 - 227. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Haumaitre, O. Lenoir, and R. Scharfmann Histone Deacetylase Inhibitors Modify Pancreatic Cell Fate Determination and Amplify Endocrine Progenitors Mol. Cell. Biol., October 15, 2008; 28(20): 6373 - 6383. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Oliver-Krasinski and D. A. Stoffers On the origin of the {beta} cell Genes & Dev., August 1, 2008; 22(15): 1998 - 2021. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Jin Mechanisms underlying proglucagon gene expression J. Endocrinol., July 1, 2008; 198(1): 17 - 28. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Y. Choi, A. I. Romer, Y. Wang, M. P. Wu, S. Ito, A. B. Leiter, and R. A. Shivdasani Requirement of the Tissue-Restricted Homeodomain Transcription Factor Nkx6.3 in Differentiation of Gastrin-Producing G Cells in the Stomach Antrum Mol. Cell. Biol., May 15, 2008; 28(10): 3208 - 3218. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Klinck, P. Serup, O. D. Madsen, and M. C. Jorgensen Specificity of Four Monoclonal Anti-Nkx6-1 Antibodies J. Histochem. Cytochem., April 1, 2008; 56(4): 415 - 424. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kodama, F. Takeshita, S. Kanegasaki, T. Ochiya, and G. Quinn Pancreatic Endocrine and Exocrine Cell Ontogeny From Renal Capsule transplanted Embryonic Stem Cells in Streptozocin-injured Mice J. Histochem. Cytochem., January 1, 2008; 56(1): 33 - 44. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Jorgensen, J. Ahnfelt-Ronne, J. Hald, O. D. Madsen, P. Serup, and J. Hecksher-Sorensen An Illustrated Review of Early Pancreas Development in the Mouse Endocr. Rev., October 1, 2007; 28(6): 685 - 705. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Doyle and L. Sussel Nkx2.2 Regulates {beta}-Cell Function in the Mature Islet Diabetes, August 1, 2007; 56(8): 1999 - 2007. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. B. Nelson, A. E. Schaffer, and M. Sander The transcription factors Nkx6.1 and Nkx6.2 possess equivalent activities in promoting beta-cell fate specification in Pdx1+ pancreatic progenitor cells Development, July 1, 2007; 134(13): 2491 - 2500. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Attali, V. Stetsyuk, A. Basmaciogullari, V. Aiello, M. A. Zanta-Boussif, B. Duvillie, and R. Scharfmann Control of {beta}-Cell Differentiation by the Pancreatic Mesenchyme Diabetes, May 1, 2007; 56(5): 1248 - 1258. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Seymour, K. K. Freude, M. N. Tran, E. E. Mayes, J. Jensen, R. Kist, G. Scherer, and M. Sander From the Cover: SOX9 is required for maintenance of the pancreatic progenitor cell pool PNAS, February 6, 2007; 104(6): 1865 - 1870. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Doyle, Z. L. Loomis, and L. Sussel Nkx2.2-repressor activity is sufficient to specify {alpha}-cells and a small number of {beta}-cells in the pancreatic islet Development, February 1, 2007; 134(3): 515 - 523. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sugiyama, R. T. Rodriguez, G. W. McLean, and S. K. Kim Conserved markers of fetal pancreatic epithelium permit prospective isolation of islet progenitor cells by FACS PNAS, January 2, 2007; 104(1): 175 - 180. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E Cerf Transcription factors regulating {beta}-cell function. Eur. J. Endocrinol., November 1, 2006; 155(5): 671 - 679. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. L. Pedersen, R. Klinck, J. Hecksher-Sorensen, S. Zahn, O. D. Madsen, P. Serup, and M. C. Jorgensen Generation and Characterization of Monoclonal Antibodies against the Transcription Factor Nkx6.1 J. Histochem. Cytochem., May 1, 2006; 54(5): 567 - 574. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Wang, T. Liu, Z. Li, X. Ma, and T. Jin Redundant and Synergistic Effect of Cdx-2 and Brn-4 on Regulating Proglucagon Gene Expression Endocrinology, April 1, 2006; 147(4): 1950 - 1958. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||