spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 8 June 2005
doi: 10.1242/dev.01898


Development 132, 3163-3173 (2005)
Published by The Company of Biologists 2005


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow A corrigendum has been published
Right arrow All Versions of this Article:
dev.01898v1
132/14/3163    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by O'Hara, F. P.
Right arrow Articles by Riddle, R. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by O'Hara, F. P.
Right arrow Articles by Riddle, R. D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Zebrafish Lmx1b.1 and Lmx1b.2 are required for maintenance of the isthmic organizer

F. Patrick O'Hara, Ernestine Beck, Lauren K. Barr, Lily L. Wong*, Daniel S. Kessler{ddagger} and Robert D. Riddle{dagger}

Department of Cell and Developmental Biology, University of Pennsylvania School of Medicine, Philadelphia, PA 19104, USA

{ddagger} Author for correspondence (e-mail: kesslerd{at}mail.med.upenn.edu)

Accepted 11 May 2005


    SUMMARY
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
The mesencephalic and metencephalic region (MMR) of the vertebrate central nervous system develops in response to signals produced by the isthmic organizer (IsO). We have previously reported that the LIM homeobox transcription factor Lmx1b is expressed within the chick IsO, where it is sufficient to maintain expression of the secreted factor wnt1. In this paper, we show that zebrafish express two Lmx1b orthologs, lmx1b.1 and lmx1b.2, in the rostral IsO, and demonstrate that these genes are necessary for key aspects of MMR development. Simultaneous knockdown of Lmx1b.1 and Lmx1b.2 using morpholino antisense oligos results in a loss of wnt1, wnt3a, wnt10b, pax8 and fgf8 expression at the IsO, leading ultimately to programmed cell death and the loss of the isthmic constriction and cerebellum. Single morpholino knockdown of either Lmx1b.1 or Lmx1b.2 has no discernible effect on MMR development. Maintenance of lmx1b.1 and lmx1b.2 expression at the isthmus requires the function of no isthmus/pax2.1, as well as Fgf signaling. Transient misexpression of Lmx1b.1 or Lmx1b.2 during early MMR development induces ectopic wnt1 and fgf8 expression in the MMR, as well as throughout much of the embryo. We propose that Lmx1b.1- and Lmx1b.2-mediated regulation of wnt1, wnt3a, wnt10b, pax8 and fgf8 maintains cell survival in the isthmocerebellar region.

Key words: Isthmus, Lmx1b, Mesencephalon, Metencephalon, Pax, Wnt, Zebrafish


    Introduction
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
The cerebellum and tectum develop in response to signals emanating from an organizer located at the isthmus, a constriction of the neural tube that forms between the mesencephalic and metencephalic vesicles (Joyner, 1996Go; Puelles et al., 1996Go; Wassef and Joyner 1997Go; Liu and Joyner, 2001Go). The organizing activity of the isthmus has been demonstrated by numerous classical embryonic manipulations (Nakamura et al., 1986Go; Alvarado-Mallart et al., 1990Go; Gardner and Barald, 1991Go; Itasaki et al., 1991Go; Martinez et al., 1991Go; Bally-Cuif et al., 1992Go; Marin and Puelles, 1994Go; Martinez et al., 1995Go). Several important signaling molecules and transcription factors have been shown to mediate isthmic organizer (IsO) function. These molecules coordinate the development of cells within the mes-metencephalic region (MMR), as well as provide necessary autocrine functions to maintain the IsO. Defining the signaling pathways that direct MMR cell fates and determining the mechanisms by which these pathways are regulated remain long-term goals for understanding IsO development.

The IsO is positioned at the juxtaposition of the otx2 and gbx2 expression domains (Simeone et al., 1992Go; Millet et al., 1996Go; Wassarman et al., 1997Go; Niss and Leutz, 1998Go; Shamim and Mason, 1998Go; Li and Joyner, 2001Go). Coincident with this border is the expression boundary of two major signaling molecules, wnt1 and fgf8. During IsO maintenance, wnt1 is expressed at the caudal edge of the mesencephalic vesicle (Wilkinson et al., 1987Go; Bally-Cuif et al., 1992Go; Kelly and Moon, 1995Go; Hidalgo-Sanchez et al., 1999Go), and wnt1 mutant mice fail to maintain a number of mesencephalic and metencephalic structures (McMahon and Bradley, 1990Go; Thomas and Capecchi, 1990Go). Although Wnt1 signaling is necessary for MMR development, ectopic Wnt1 does not appear to be sufficient to globally change the fate of MMR cells (Adams et al., 2000Go). By contrast, isthmic fgf8 expression is refined to the rostral edge of the metencephalic vesicle (Heikinheimo et al., 1994Go; Crossley and Martin, 1995Go; Riefers et al., 1998), and is necessary and sufficient to mediate IsO function (Brand et al., 1996Go; Meyers et al., 1998Go; Riefers et al., 1998). In fact, ectopic Fgf8 induces changes in gene expression and morphology strikingly similar to transplantation of isthmic tissue (Crossley et al., 1996Go; Funahashi et al., 1999Go; Martinez et al., 1999Go; Shamim et al., 1999Go). IsO regulation also requires a number of transcription factors that work in a coordinated fashion, including members of the Pax family (Brand et al., 1996Go; Favor et al., 1996Go; Torres et al., 1996Go; Lun and Brand, 1998Go; Pfeffer et al., 1998Go), the Engrailed family (Millen et al., 1994Go; Wurst et al., 1994Go) and Lmx1b.

Lmx1b is a LIM-homeodomain protein whose role in IsO patterning has only been addressed in gain-of-function studies. Originally identified as a regulator in dorsoventral limb patterning (Riddle et al., 1995Go; Vogel et al., 1995Go; Chen et al., 1998Go), Lmx1b has recently been shown to be required for dopaminergic and serotonergic neuron development in vertebrates (Smidt et al., 2000Go; Cheng et al., 2003Go). We originally reported that Lmx1b was expressed in the chick MMR and, using a retroviral approach, demonstrated that it was sufficient to maintain the expression of Wnt1 in the mesencephalon (Adams et al., 2000Go). More recently, Matsunaga et al. (Matsunaga et al., 2002Go) used an electroporation approach in the chick to demonstrate that Lmx1b induced wnt1 cell-autonomously and fgf8 non-cell-autonomously. However, direct evidence of a requirement for Lmx1b in IsO function has been lacking.

To further elucidate transcriptional regulation of the IsO, we have extended these studies to the zebrafish. The zebrafish provides a powerful means of studying the genetic basis of IsO formation and function. IsO regulation appears largely conserved among vertebrates, and the relative ease of gain- and loss-of-function experiments in zebrafish allows for a number of developmental studies not possible in the chick. Mutants of several major IsO genes are available in zebrafish, including pax2.1 (no isthmus) (Lun and Brand, 1998Go) and fgf8 (acerebellar) (Riefers et al., 1998). Study of these mutants and other developmental studies in fish have contributed to our understanding of a regulatory feedback loop that maintains IsO patterning function.

We report the isolation and functional analysis of lmx1b.1 and lmx1b.2, two zebrafish orthologs of lmx1b. Loss- and gain-of-function studies indicate that these two closely related transcription factors have redundant functions in maintaining gene expression and cell fate at the IsO, and that these genes are necessary and sufficient for maintenance of wnt1 and fgf8 expression. Pax2.1 is required for maintenance of lmx1b.1 and lmx1b.2 at the IsO, and Lmx1b.1 and Lmx1b.2 are required for pax8 maintenance. We propose a model in which Lmx1b.1 and Lmx1b.2 cooperate with Pax, Wnt and Fgf genes to maintain the IsO.


    Materials and methods
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Zebrafish methods
Zebrafish were raised under standard laboratory conditions as described before (Mullins et al., 1994Go). All injections were performed with wild-type TL embryos. Developmental stage was determined according to Kimmel et al. (Kimmel et al., 1995Go). No isthmus (noi) heterozygous mutants were verified by random intercrosses and homozygous mutant embryos were produced by crossing heterozygous parents.

Isolation of lmx1b.1 and lmx1b.2
Based on the published sequence of hamster (German et al., 1992Go) and human (German et al., 1994Go) Lmx1a, and human (Iannotti et al., 1997Go), mouse (Chen et al., 1998Go) and chick (Tsuchida et al., 1994Go) Lmx1b, a single pair of degenerate PCR primers was designed using the amino acid sequences indicated in Fig. 1A, that was predicted to amplify both lmx1a and lmx1b orthologs. Fragments resulting from PCR amplification of 24 hpf zebrafish cDNA were subcloned and two distinct species were isolated multiple times. Each insert was used to screen a 22-26 hpf zebrafish lambda zap cDNA library and a total of 38 purified positives was identified following screening of 1 million plaques. Multiple isolates of two distinct cDNAs were obtained, each ~2 kb in length and containing 300-500 bp of untranslated sequence (data not shown). Although this degenerate PCR strategy was predicted to identify zebrafish orthologs of lmx1a and lmx1b, both cDNAs isolated were closely related to lmx1b (Fig. 1B,C). The sequences for Lmx1b.1 (AY894989) and Lmx1b.2 (AY894990) have been submitted to GenBank. We have subsequently identified a putative lmx1a ortholog in the zebrafish genome database, so the failure to identify this sequence in our screen suggests that expression levels at 22-26 hpf were too low. ClustalW alignments and phylogenetic analyses were performed using MacVector (Accelrys), and the phylogenetic tree was produced using the Neighbor Joining Method with bootstrapping (1000 replicates).

Whole-mount in situ hybridization and histology
Digoxigenin- or fluorescein-labeled probes were generated from linearized templates using an RNA labeling and detection kit (Roche). Hybridization and detection with alkaline phosphatase-conjugated antibodies is described elsewhere (Odenthal and Nüsslein-Vollhard, 1998Go). Stained embryos were cleared in benzyl alcohol:benzyl benzoate (2:1), mounted in Canada balsam, and photographed using a Magnafire SP digital camera (Optronics). Alternatively, embryos were photographed in PBS using a Micropublisher digital camera (Qimaging). To obtain histological sections, embryos were embedded in JB-4 plastic resin (Polysciences). Sections (5 µm) were prepared with glass knives using a Leica RM2155 microtome. Sections were affixed to glass slides and stained with Methylene Blue/Azure II.

Morpholinos and microinjections
Antisense morpholino oligonucleotides were obtained from Gene Tools (Corvallis, OR). Morpholino sequences were CTTCGATTTTTATACCGTCCAACAT for lmx1b.1-MO (B1-MO) and CCTCAATTTTGATTCCGTCCAGCAT for lmx1b.2-MO (B2-MO). Mismatch oligonucleotides were designed for use as negative controls: CGTCTATTTTCATGCCGTCCATCAT for lmx1bN-MO (BN-MO) and CATCCATTTTAATCCCGTCCACCAT for lmx1bX-MO (BX-MO). An unrelated control oligonucleotide (CON-MO) was provided by the manufacturer. Morpholino microinjections were performed on 1- to 4-cell embryos. Morpholino solutions (4 mg/ml in Danieu buffer) were back-loaded into glass needles before injection, and 1.5-2.5 nl of morpholino solution were delivered to the yolk of each embryo. To verify morpholino specificity, in vitro translation analysis was performed using the TNT Coupled Transcription/Translation System (Ambion) with 0.5 µg of plasmid DNA and 0.5 µg of morpholino oligonucleotide. 35S-methionine was incorporated and labeled proteins were resolved by 10% SDS-PAGE and visualized by autoradiography.

Immunohistochemistry and TUNEL staining
For immunohistochemistry, a mixture of two mouse monoclonal anti-GFP antibodies was used (Roche) and detected with biotinylated anti-mouse secondary antibody. Phosphohistone H3 protein was detected with a rabbit polyclonal antibody (Upstate) and biotinylated anti-rabbit antibody. Color reaction was carried out using Vectastain ABC Kit (Vector) and FAST DAB (Sigma). For TUNEL staining, the ApopTag Peroxidase Detection Kit (Chemicon) was used, but anti-digoxigenin-AP was substituted for anti-digoxigenin-HRP. Color reaction was carried out using NBT/BCIP.

Visualization of cranial motoneurons
A previously described transgenic line allows for the visualization of cranial motoneurons that express GFP under control of the Islet1 promotor (Higashijima et al., 2000Go). Transgenic embryos were injected with both morpholino oligos, and expression of GFP was observed in live embryos at 12-hour intervals beginning at 24 hpf. For images shown in Fig. 7, embryos were fixed at 48 hpf and processed for immunohistochemical visualization of GFP.

Pharmacological inhibition of FGF signaling
To block FGF signaling, tailbud stage embryos were incubated in an 8 µM solution of SU5402 (Calbiochem) in E3/DMSO for 4 hours. Control embryos were incubated in E3/DMSO alone.

Hsp 70-driven misexpression of Lmx1b.1 and Lmx1b.2
To misexpress Lmx1b.1 and Lmx1b.2, cDNAs containing the complete coding regions were cloned into pBluescript SK plasmids downstream of the hsp70 promoter. Injection solutions were prepared at a concentration of 10 ng/µl in 0.2 M KCl and Phenol Red, and 1-3 nl of solution was injected directly into the cytoplasm of one-cell stage embryos. Embryos were then reared until early somitogenesis (1-5 somites). At that time, embryos were heat shocked at 37°C for 45 minutes. After heat shock, embryos were allowed to further develop for 2-29 hours before fixation.


    Results
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Zebrafish has two Lmx1b orthologs, Lmx1b.1 and Lmx1b.2
Degenerate PCR primers were designed based on Lmx1a and Lmx1b sequence information from a number of species (see Materials and methods), and two distinct zebrafish orthologs of Lmx1b were isolated (Fig. 1A). Comparison of the putative amino acid sequences of these cDNAs, designated lmx1b.1 and lmx1b.2, with other Lmx proteins in the published databases (Fig. 1A,B) shows that both zebrafish cDNAs encode proteins that are most similar to chicken Lmx1b (Lmx1b.1 88% identical, and Lmx1b.2 80% identical). These sequences also exhibit a high degree of identity with mouse and human Lmx1b proteins. Comparison of the two zebrafish Lmx1b genes reveal a relatively high degree of divergence (Fig. 1B). Although mammalian Lmx1b orthologs are very highly conserved (97-99% identical), zebrafish Lmx1b.1 and Lmx1b.2 share only 77% identity. Somewhat lower identity is observed when comparing Lmx1a and Lmx1b sequences (64-68% identity), whether within a species or between distantly related species.

Although our cloning strategy did not yield a Lmx1a homolog, we have identified a putative zebrafish Lmx1a by performing a BLAST search of available zebrafish genomic sequences. Phylogenetic analysis supports the grouping of this sequence with other known Lmx1a proteins, while both zebrafish sequences obtained in our screen cluster with Lmx1b proteins (Fig. 1C).



View larger version (65K):
[in this window]
[in a new window]
 
Fig. 1. (A) ClustalW alignment of the predicted amino acid sequences of zebrafish Lmx1b.1, Lmx1b.2 and chick Lmx1b. Identical residues are shaded and dashes indicate predicted gaps. Arrows indicate the positions of the residues against which degenerate primers were designed. (B) Matrix of amino acid sequence comparisons among Lmx sequences from zebrafish (z), chick (c), human (hu), mouse (m) and hamster (ha). Percentages of identical and, in brackets, similar residues are given. (C) Phylogenetic relationships among several Lmx protein sequences. Both zebrafish Lmx genes obtained in our screen cluster with other Lmx1b orthologs. A putative zebrafish Lmx1a ortholog (put zLmx1a) found in the Ensembl Zebrafish Genome Server (ENSDARP00000006532) clusters with Lmx1a orthologs. Numbers represent bootstrap values for each branchpoint. Accession numbers: zLmx1b.1, AY894989; zLmx1b.2, AY894990; cLmx1b, P53413; huLmx1b, CAI40918 mLmx1b, NP034855; huLmx1a, CAH73258 mLmx1a, Q9JKU8; haLmx1a, X81406.

 



View larger version (51K):
[in this window]
[in a new window]
 
Fig. 2. Expression of lmx1b.1 and lmx1b.2 in wild-type embryos. (A) Lateral view of a gastrula at 90% epiboly, animal pole leftwards. lmx1b.2 is expressed in the blastoderm margin (black arrowhead). (B-E) Dorsal views with anterior towards the left. (B,C) At the tailbud stage, lmx1b.1 and lmx1b.2 are both expressed in chevron-shaped domains at the presumptive MMR. Both are also expressed in the midline, with lmx1b.1 extending more rostrally and lmx1b.2 extending more caudally. (D,E) By the five-somite stage, expression of lmx1b.1 and lmx1b.2 are refined to rings at the MMR. lmx1b.1 is now expressed at the developing otic placode, while lmx1b.2 is expressed in the diencephalic region and in cells of the hindbrain that are converging on the dorsal midline. (F,G) Lateral views, rostral leftwards. By the 13-somite stage, lmx1b.1 and lmx1b.2 are both stably expressed at the MMR, the ventral diencephalon and the dorsal midline of the caudal CNS. lmx1b.1 is also stably expressed in the otic placodes. Red arrowheads indicate the MMR. ov, otic vesicle; dd, dorsal diencephalon; vd, ventral diencephalon.

 
Expression of Lmx1b.1 and Lmx1b.2 in the zebrafish brain
We next determined when and where each gene was expressed. Although the focus of these experiments is on the developing CNS, both genes are also expressed elsewhere, including the developing limb field (data not shown). lmx1b.2 expression initiates first at the margin of 90% epiboly embryos (Fig. 2A). Soon thereafter, lmx1b.1 and lmx1b.2 are both expressed at the tailbud stage in chevron-shaped domains corresponding to the presumptive MMR (Fig. 2B,C). Both genes are also expressed in distinct, overlapping domains at the midline, but only lmx1b.1 is expressed in the presumptive otic anlage. Expression of lmx1b.1 and lmx1b.2 in the MMR becomes refined to a narrow ring by the five-somite stage (Fig. 2D,E). By the 13-somite stage, both lmx1b.1 and lmx1b.2 are strongly expressed in the MMR and in the ventral diencephalon (Fig. 2F,G). Additionally, lmx1b.1 is expressed in the developing otic placodes and the dorsal diencephalon, whereas lmx1b.2 is expressed in the dorsal midline of the hindbrain. The expression patterns of lmx1b.1 and lmx1b.2 are thus dynamic and different in some aspects, but both are strongly expressed in the developing MMR.



View larger version (54K):
[in this window]
[in a new window]
 
Fig. 3. lmx1b.1, lmx1b.2, wnt1 and pax2.1 are expressed in overlapping domains at the isthmus. (A) Dorsal view, with anterior leftwards. At the one-somite stage, lmx1b.1 is expressed in the midline and in the precursors of the MMR and the otic placodes. At the presumptive IsO, pax 2.1 expression completely overlaps with lmx1b.1 expression and the pax2.1 domain is slightly broader. (B-G) Lateral views, with dorsal upwards and anterior leftwards. (B,C) At the 13-somite stage, pax2.1 expression at the IsO overlaps the expression of lmx1b.1 (B) and lmx1b.2 (C), and extends posteriorly. (D-F) At 24 hpf, the expression domains of lmx1b.1 (D), lmx1b.2 (E) and wnt1 (F) are found in the posterior mesencephalic vesicle, abutting the metencephalic vesicle. (G,H)At 24 hpf, pax2.1 expression overlaps both wnt1 (G) and lmx1b.1 (H, dorsolateral view), and extends more posteriorly. Red arrowheads indicate the MMR.

 
Early expression of lmx1b.1 and lmx1b.2 overlaps extensively with pax2.1, a marker and regulator of the IsO. By the tailbud stage, the expression of lmx1b.1 at the presumptive MMR is contained entirely within the expression domain of Pax2.1 (Fig. 3A). lmx1b.2 has an identical expression domain at the MMR (data not shown). By the 13-somite stage, pax2.1 expression at the IsO becomes refined to a ring that appears to encompass the expression domains of lmx1b.1 and lmx1b.2 (Fig. 3B,C), and extend further caudally.

At 24 hpf, lmx1b.1 and lmx1b.2 are expressed at the caudal limit of the mesencephalon that abuts the isthmic constriction in a pattern similar to the wnt1 expression domain (Fig. 3D-F). All three genes are also expressed in the dorsal midline of the mesencephalon and metencephalon. During IsO patterning, the MMR expression of lmx1b.1 and wnt1 is contained within the anterior domain of pax2.1 expression (Fig. 3G,H), as is lmx1b.2 (data not shown).

Lmx1b.1 and Lmx1b.2 are required for maintenance of MMR structure and gene expression
To determine what developmental events require Lmx1b.1 and Lmx1b.2, we performed a series of morpholino knockdown experiments. Antisense morpholino oligos were designed to specifically block translation of Lmx1b.1 (B1-MO) or Lmx1b.2 (B2-MO). An in vitro translation assay to asses oligo efficacy and specificity demonstrated that B1-MO effectively blocked only Lmx1b.1 translation, and B2-MO blocked only Lmx1b.2 translation. Mismatch control oligos (see Materials and methods) did not block translation of either (Fig. 4A). Injection of embryos with single morpholinos directed against either Lmx1b.1 or Lmx1b.2 does not produce a discernible morphological phenotype (data not shown), nor does injection of any of the three control morpholinos, although one control, BN-MO, causes a small degree of nonspecific toxicity. Embryos injected with morpholinos targeting both Lmx1b.1 and Lmx1b.2 (B1B2-MO) fail to maintain the isthmic constriction or cerebellum (Fig. 4). At 24 hpf, experimental and control embryos are morphologically similar, but the loss of the isthmic constriction and cerebellum in B1B2-MO-injected embryos is easily observed by 30 hpf (92%, n=60). The affected embryos subsequently develop circulatory problems and severe cardiac edema by 48 hpf and die soon thereafter.



View larger version (81K):
[in this window]
[in a new window]
 
Fig. 4. Simultaneous knockdown of Lmx1b.1 and Lmx1b.2 results in a loss of isthmic and cerebellar structures. (A) Specific inhibition of Lmx1b.1 and Lmx1b.2 translation by morpholino oligonucloetides. In vitro translation of Lmx1b.1 (top panel) and Lmx1b.2 (bottom panel) in the absence of oligonuclotide (lane 1) or with addition of: an unrelated oligonucleotide (CON-MO, lane 2), a mismatch oligonucleotide (BN-MO lane 3), or oligonucleotides specific for Lmx1b.1 (B1-MO, lane 4) or Lmx1b.2 (B2-MO, lane 5). (B-E) Lateral views of anterior CNS, with dorsal upwards and anterior leftwards. Microtome sections at 30 hpf (B,C) and whole mounts at 36 hpf (D,E) of embryos injected with B1B2-MO (B,D) or Con-MO (C,E). Red arrowheads indicate the position of the isthmic constriction and white arrowheads indicate the missing isthmic constriction. t, tectum; c, cerebellum; *, missing structures.

 
Several genes have been identified that are expressed at the MMR and are necessary for MMR development. To determine if Lmx1b.1 and Lmx1b.2 loss of function affects gene expression in the MMR, we injected B1B2-MO and then determined the effects on the temporal and spatial expression of MMR genes. Based on the previously reported relationship between chick Lmx1b and Wnt1 (Adams et al., 2000Go; Matsunaga et al., 2002Go), we first examined wnt1 regulation. Initiation and early expression of wnt1 is unaffected by knockdown of Lmx1b.1 and Lmx1b.2 (n=18, Fig. 5A,B). However, wnt1 expression at the MMR is lost in B1B2-MO-injected embryos at the 15- to 18-somite stage (100%, n=37). By contrast, wnt1 expression persists in the midline and forebrain (Fig. 5C,D). Embryos injected with single morpholinos against Lmx1b.1 or Lmx1b.2 exhibit normal wnt1 expression as late as 24 hpf (data not shown). Knockdown of Lmx1b.1/2 also affects wnt3a and wnt10b expression (data not shown). At the 18-somite stage, wnt3a is normally expressed in the dorsal midline of the midbrain, with ventral extensions into the MMR. In embryos injected with B1B2-MO, the ventral extensions of wnt3a expression at the MMR are missing at the 18-somite stage (100%, n=12). Wnt3a expression is normal in embryos injected with BX-MO (100%, n=13). Wnt10b is expressed at the MMR and the dorsal midline of the mesencephalon, hindbrain and spinal cord at the 18-somite stage, and its expression strongly resembles that of wnt1. Injection with B1B2-MO results in loss of wnt10b expression at the MMR at the 18-somite stage (100%, n=9), and injection of BX-MO does not affect expression of wnt10b (n=8).



View larger version (64K):
[in this window]
[in a new window]
 
Fig. 5. Following knockdown of Lmx1b.1 and Lmx1b.2, IsO genes are initiated normally, but some are not maintained. Lateral views of anterior CNS, with dorsal upwards and anterior leftwards. Embryos were injected with B1B2-MO (A,C,E,G) or BX-MO (B,D,F,H). wnt1 is initiated normally at the 10-somite stage. (A,B), but fades at the MMR by 15-18 somites (C,D). pax8 expression fades by 15-18 somites (E,F), and fgf8 fades by 19-22 somites, with partial dorsal retention (G,H). Red arrowheads indicate the MMR.

 
The effect of Lmx1b.1 and Lmx1b.2 knockdown on Pax gene expression at the MMR was also examined. At the 15- to 18-somite stage, knockdown of Lmx1b.1 and Lmx1b.2 results in complete loss of pax8 expression (100%, n=10, Fig. 5E,F). Expression of pax2.1, pax2.2 and pax5 is unaffected until 24 hpf. Fgf8 expression was unaffected by morpholino injection at the 18-somite stage. However, knockdown of both Lmx1b.1 and Lmx1b.2 causes fgf8 expression at the MMR to fade by the 19- to 22-somite stage (93%, n=14, Fig. 5G,H). The loss of fgf8 expression in the MMR proceeds from ventral to dorsal. At the 19- to 22-somite stage in knockdown embryos, fgf8 is lost ventrally and consistently retained dorsally, but by 24 hpf, this dorsal expression is almost completely absent (data not shown).



View larger version (65K):
[in this window]
[in a new window]
 
Fig. 6. Knockdown of Lmx1b.1 and Lmx1b.2 affects cell fate in the isthmocerebellar region, but not the mesencephalon or ventral rhombomere 1 (R1). Lateral (A,B,G,H), dorsal (C-F) or dorsolateral views (I,J), with anterior leftwards. Embryos were injected with BX-MO (A,C,E,G,I) or B1B2-MO (B,D,F,H,J). pax5 expression (A,B), which marks the isthmus and cerebellum, is strongly reduced at 24 hpf in Lmx1b.1/2 knockdown embryos. Expression of otx2 (C,D) and mab21 (E,F), markers of the mesencephalon, is unaffected Lmx1b.1/2 knockdown embryos. Epha4a expression (G,H) marks several regions of the developing brain, including the ventral region of R1, and is unaffected in Lmx1b.1/2 knockdown embryos. Expression of en3 (I,J) marks both the tectum and the isthmocerebellar region. Knockdown of Lmx1b.1/2 results in a loss of en3 expression at the ventral isthmus, but normal expression is retained in the tectum and dorsal isthmus. Red arrowheads indicate the position of the MMR, black arrows indicate the ventral R1 staining of epha4a and horizontal lines indicate the ventral isthmic staining of en3.

 
The MMR deletion caused by knockdown of Lmx1b.1/2 affects cells at the isthmus and cerebellum, but not the tectum or ventral rhombomere 1 (R1). At 24 hpf, pax5 expression marks the caudal limit of the mesencephalon, the isthmic constriction and the cerebellar anlage (Pfeffer et al., 1998Go). Knockdown of Lmx1b.1/2 causes a strong reduction of pax5 expression at the MMR (100%, n=10), while injection of BX-MO has no effect (Fig. 6A,B). pax2.1 (100%, n=36), pax2.2 (100%, n=12) and pax8 (100%, n=10), markers of the isthmus but not the cerebellum, are strongly reduced by 24 hpf at the MMR following knockdown of Lmx1b.1/2 (data not shown). otx2 marks the mesencephalon, and its expression is neither deleted nor expanded in Lmx1b.1/2 knockdown embryos at 24 hpf (n=28) (Fig. 6C,D). Nor is an affect on otx2 expression observed after 36 hpf (n=18, data not shown). mab21l2 is an additional marker of the mesencephalon that is unaffected by knockdown of Lmx1b.1/2 (n=20) (Fig. 6E,F). epha4a expression marks several regions of the developing CNS, including the region of R1 caudal and ventral to the cerebellum. epha4a expression is unaffected in Lmx1b.1/2 knockdown embryos at 24 hpf (n=20) (Fig. 6G,H). en3 expression marks both the tectum and the isthmocerebellar region. Knockdown of Lmx1b.1/2 results in a partial deletion of en3 expression limited to the ventral isthmocerebellar region (50%, n=18) (Fig. 6I,J), while expression in the tectum and the dorsal isthmocerebellar region is unaffected. Therefore, Lmx1b.1/2 knockdown results in a loss of gene expression at the isthmocerebellar region, but not in the adjacent mecencephalon or rhombomeres. This suggests that anteroposterior patterning and specification is not altered in the absence of Lmx1b.1/2, but that cells fated to form the IsO and cerebellum are not maintained.



View larger version (102K):
[in this window]
[in a new window]
 
Fig. 7. Knockdown of Lmx1b.1 and Lmx1b.2 results in increased cell death around the IsO, with a concomitant failure of neural differentiation. (A-D) A TUNEL assay stains apoptotic cells blue. Dorsal views with anterior leftwards. (A) A low level of randomly distributed apoptosis is detected in wild-type embryos. (B) Injection of BX-MO results in a nonspecific increase in apoptosis. (C) Injection of B1B2-MO sharply increases apoptosis in the IsO, especially caudally. Nonspecific apoptosis is also increased. (D) Increased apoptosis is detected around the IsO in embryos homozygous for the pax2.1/no isthmus mutation, especially rostrally. (E,F) Cranial motoneurons were visualized by expressing GFP under the control of the Islet1 promoter and staining with an antibody against GFP. (E) Cranial motoneurons III and IV flank the IsO. (F) Neurons III and IV fail to form in B1B2-MO-injected embryos, while other neurons are unaffected. Red arrowheads indicate position of the MMR and asterisks mark normal position of missing neurons.

 
Lmx1b.1 and Lmx1b.2 loss-of-function results in cell death and loss of neuronal subtypes
To determine the consequences of altered IsO gene expression that cause the deletion of recognizable isthmic and cerebellar structures, we examined cell death and cell proliferation. We performed TUNEL staining to visualize apoptotic cells. At 24 hpf, uninjected embryos contain a low level of apoptotic cells distributed uniformly throughout the CNS (100%, n=11) (Fig. 7A). Injection of the BX-MO control results in a low and variable increase in cell death throughout the embryo (100%, n=19) (Fig. 7B). By contrast, injection of B1B2-MO results in a dramatic increase in the number of apoptotic cells in the MMR (83%, n=24) (Fig. 7C). Interestingly, the region of increased apoptosis is centered caudal to the lmx1b.1/2 expression domain. Conversely, in noi mutant embryos, cell death is visible at the same stages, but is centered more rostral to the isthmus (20%, n=20) (Fig. 7D). At 18 hpf (18 somites), embryos injected with B1B2-MO do not exhibit increased apoptosis around the isthmus, and therefore, the onset of increased cell death occurs between 18 and 24 hpf. In addition to examining cell death, we used antibodies against phosphohistone H3 (pH3) to determine if knockdown of Lmx1b.1/2 affected mitosis at the MMR. When embryos injected with B1B2-MO (n=35) were compared with embryos injected with BX-MO (n=20) at 24 hpf, no significant difference in pH3-positive cells at the MMR was observed (data not shown). Therefore, loss of isthmic and cerebellar identity in Lmx1b.1/2 knockdown embryos is associated with increased levels of apoptosis, but not altered cell proliferation.

We next examined the consequences of Lmx1b.1 and Lmx1b.2 loss of function on neuronal differentiation. Cranial motoneurons (CMNs) III and IV flank the isthmus, and thus serve as markers of neuronal differentiation at the MMR. A transgenic islet1-GFP line allows for the visualization of Islet1-expressing CMNs in the developing zebrafish brain (Higashijima et al., 2000Go). GFP expression in the cell bodies of these neurons was observed as early as 36 hpf. Live B1B2-MO-injected embryos were examined through 54 hpf, and CMNIII and CMNIV were never observed. CMNs were also visualized in fixed embryos using an antibody against GFP, which yielded better images of CMNs, and these data are presented in Fig. 7E,F. Islet1-GFP embryos were injected with BX-MO or B1B2-MO and fixed at 36, 48 and 72 hpf. Antibody staining for GFP revealed that while CMNs developed normally in BX-MO-injected embryos, CMNIII and CMNIV were not detected in B1B2-MO-injected embryos at any stage examined.

MMR expression of lmx1b.1 and lmx1b.2 requires Pax2.1 and FGF signals
To test the requirement for Pax2.1 in lmx1b.1 and lmx1b.2 expression, we performed whole-mount in situ hybridization on noi mutant embryos (Table 1). At the one-somite stage, all embryos expressed lmx1b.1 (n=17) and lmx1b.2 (n=17) normally. However, at subsequent developmental stages (5, 7, 12 and 18 somites) lmx1b.1 and lmx1b.2 expression at the MMR was absent in ~25% of embryos (59/234 and 64/214, respectively). This corresponds to the predicted one quarter of embryos homozygous for the pax2.1 mutation. Significantly, this loss of lmx1b.1 and lmx1b.2 expression occurs earlier than the loss of wnt1 (first affected at six somites) and fgf8 (first affected at nine somites) in noi mutant embryos (Lun and Brand, 1998Go). Therefore, Pax2.1 is not required for the initiation of lmx1b.1 or lmx1b.2 expression, but soon thereafter is required for their maintenance at the IsO in a manner independent of Wnt1 and Fgf8.


View this table:
[in this window]
[in a new window]
 
Table 1. IsO expression of lmx1b.1 and lmx1b.2 in offspring of no isthmus heterozygotes

 
To test the dependence of lmx1b.1 and lmx1b.2 expression on FGF signaling, we treated embryos with SU5402, a drug that inhibits the function of the FGFR1-4 receptors, and effectively eliminates the signaling of FGF8 and other FGFs (Mohammadi et al., 1997Go). Exposure of embryos to SU5402 in a DMSO solution at tailbud stage resulted in a loss of lmx1b.1 and lmx1b.2 expression at the MMR within 4 hours, while expression at the midline was retained (n=15) (Fig. 8A,B). Expression of lmx1b.1 and lmx1b.2 was not affected in embryos treated with DMSO alone (n=15) (Fig. 8C,D). Therefore, maintenance of lmx1b.1 and lmx1b.2 expression at the MMR requires FGF signaling.

Lmx1b.1 and Lmx1b.2 induce expression of wnt1 and fgf8
To determine which IsO genes are regulated by Lmx1b.1 and Lmx1b.2, we induced ectopic expression using constructs containing the lmx1b.1- or lmx1b.2-coding sequence under the control of the hsp70 promoter. Embryos were injected with plasmid at the one-cell stage and were heat-shocked during early somitogenesis to induce expression of lmx1b.1 (Fig. 9A,B) or lmx1b.2 (data not shown). Ectopic expression was highly variable, and the number of expressing clones varied from one to hundreds. The Lmx-positive clones were distributed randomly throughout most tissues of heat-shocked embryos, but the cells surrounding the yolk seemed most sensitive to the treatment. Wild-type embryos were heat-shocked, resulting in no ectopic induction of lmx1b.1 (n=26) or lmx1b.2 (n=20). Control embryos injected with hsp70-lmx1b.1, but not heat shocked, did not express ectopic lmx1b.1 (n=13) or wnt1 (n=12). Embryos injected with lmx1b.2-hsp70 and not heat-shocked did not express ectopic lmx1b.2 (n=10) or wnt1 (n=19).



View larger version (111K):
[in this window]
[in a new window]
 
Fig. 8. Blocking of FGF receptor activity results in loss of lmx1b.1 and lmx1b.2 expression at the developing IsO. (A,B) Four hours of exposure to SU5402 beginning at the tailbud stage eliminates expression of both lmx1b.1 (A) and lmx1b.2 (B) at the developing IsO, while expression at the midline is unaffected. (C,D) Exposure to DMSO alone does not affect expression. Red arrowheads indicate the position of the MMR and white arrowheads indicate missing MMR staining.

 



View larger version (100K):
[in this window]
[in a new window]
 
Fig. 9. Heatshock-induced ectopic expression of lmx1b.1, wnt1 and fgf8. (B,D,F) One-cell stage embryos were injected with Hsp70-Lmx1b.1 (B,D) or Hsp70-Lmx1b.2 (F), heat shocked during early somitogenesis, and fixed approximately 12 hours after heat shock. Embryos were then examined for lmx1b.1, wnt1 or fgf8 expression by whole-mount in situ hybridization. (A,C,E) Uninjected, heat-shocked embryos were used as controls. Lateral views with anterior leftwards and dorsal upwards are shown. Red arrowheads indicate position of MMR and white arrows indicate ectopic clones.

 
Both Lmx1b.1 and Lmx1b.2 induced ectopic expression of wnt1 (Fig. 9C,D). Hsp70-Lmx1b.1 induced mosaic ectopic expression of wnt1 in 36% of embryos (n=141), and Hsp70-Lmx1b.2 induced wnt1 in 71% of embryos (n=17). Wnt1 expression was induced in all regions of the embryo. Both Lmx1b.1 and Lmx1b.2 also induced fgf8 (Fig. 9E,F). Hsp70-Lmx1b.1 induced fgf8 in 81% of embryos (n=69) and Hsp70-Lmx1b.2 induced fgf8 in 96% (n=52).

As the Hsp70-Lmx1b.2 construct was more effective, we used it to test Lmx1b regulation of other IsO genes. We injected one-cell stage embryos with hsp70-lmx1b.2, heat shocked during early somitogenesis, and fixed embryos 2, 13 or 29 hours after treatment. Embryos were then examined for wnt1, fgf8, pax2.1 and pax8 expression. At each time point, ectopic expression of wnt1 (9/19, 4/14, 13/33) and fgf8 (8/20, 8/21, 2/29) was observed. Although strong endogenous expression was detected, no ectopic expression of pax2.1 (0/21, 0/20, 0/20) or pax8 (0/20, 0/18, 0/26) was detected. Therefore, whereas Lmx1b.1 and Lmx1b.2 are sufficient to induce wnt1 and fgf8, Lmx1b.2 is not sufficient to induce pax2.1 or pax8.



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 10. lmx1b.1 and lmx1b.2 cooperate with other IsO genes to maintain cell survival in the caudal MMR. (A) During IsO maintenance in wild-type embryos, Lmx1b.1 and Lmx1b.2 maintain wnt1, wnt3a and wnt10b expression at the caudal edge of the mesencephalic vesicle. fgf8 is expressed in an adjacent domain in the rostral metencephalic vesicle. pax2.1, pax5 and pax8 are expressed in a broader domain that encompasses the caudal mesencephalon and rostral metencephalon. When Lmx1b.1/2 activity is knocked down with morpholinos, increased apoptosis is observed, not in the lmx1b.1/2 expression domain, but in the adjacent region of the MMR, including the normal fgf8 domain. By contrast, loss of Pax2.1 function in noi mutant embryos results in increased apoptosis concentrated in the rostral region of the MMR. These data indicate that the IsO produces signals that maintain cell survival in an asymmetric, non-cell-autonomous manner. (B) The data presented are consistent with a model in which Lmx1b.1 and Lmx1b.2 maintain cell survival at the MMR by regulating fgf8, wnt1, wnt10b and wnt3a, secreted factors whose loss precipitates apoptosis in the MMR (Buckles et al., 2004Go; Jászai et al., 2003Go). Lmx1b.1/2 may maintain fgf8 by regulating expression of wnt1, wnt3a, wnt10b, pax8 or an alternative mechanism. Fgf8, in turn, functions in a positive feedback loop to maintain lmx1b.1/2 expression.

 

    Discussion
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
In this study, we have identified two zebrafish orthologs of lmx1b, lmx1b.1 and lmx1b.2, and show that both genes are expressed at the isthmus and are necessary for maintenance of the MMR. The functions of Lmx1b.1 and Lmx1b.2 at the isthmus are redundant: both proteins must be knocked down to disrupt MMR development, and either gene is sufficient to induce wnt1 and fgf8. The requirement for Lmx1b.1 and Lmx1b.2 at the isthmus is likely a result of their roles in maintaining expression of wnt1, wnt3a, wnt10b, pax8 and fgf8. Here, we discuss the interaction of Lmx1b.1 and Lmx1b.2 with other transcription factors and secreted factors to maintain the function of the IsO (Fig. 10).

Lmx1b.1 and Lmx1b.2 are required to maintain the IsO
Loss of Lmx1b.1 and Lmx1b.2 function causes the degeneration of the isthmus and cerebellum by 30 hpf. This morphological effect is preceded by a substantial increase in cell death at the MMR between 18 and 24 hpf. It is possible that the primary role of Lmx1b.1 and Lmx1b.2 at the isthmus is to maintain cell survival in the isthmocerebellar region. Alternatively, Lmx1b.1 and Lmx1b.2 may play an indirect role in the cell death; loss of Lmx1b.1 and Lmx1b.2 may result in a failure of IsO autoregulation, which leads to loss of maintenance of downstream trophic factors necessary for cell survival.

The requirement of Lmx1b.1 and Lmx1b.2 for maintenance of cell survival is probably tied to their regulation of Wnt1 and Fgf8. Wnt1 has been shown to have a proliferative role in the CNS (Dickinson et al., 1994Go; Matsunaga et al., 2002Go; Megason and McMahon, 2002Go; Panhuysen et al., 2004Go), and Wnt1–/– mice have ectopic cell death at the MMR (Serbedzija et al., 1996Go; Chi et al., 2003Go). Simultaneous loss of signaling from Wnt1, Wnt10b and Wnt3a results in increased apoptosis at the MMR (Buckles et al., 2004Go). Similarly, knockout of MMR fgf8 results in ectopic apoptosis in mice (Chi et al., 2003Go). In zebrafish, ace mutants lacking functional Fgf8 exhibit increased cell death concentrated above the rostral metencephalon from midsomitogenesis onwards, and a marked decrease in mitosis at the MMR at 57 hpf (Jászai et al., 2003Go). Cell death observed in the MMR of B1B2-MO-injected embryos could thus be attributed to the loss of wnt1/wnt3a/wnt10b and fgf8, and cell death may be initiated when cells fail to receive these essential proliferative signals.

A close regulatory relationship between Lmx proteins and Wnt1 at the IsO is conserved among vertebrates. Lmx1b can induce expression of wnt1 in the chick (Adams et al., 2000Go; Matsunaga et al., 2002Go). The gain-of-function experiments in the present study demonstrate that this regulatory relation is conserved in zebrafish, with wnt1 being regulated by both Lmx1b.1 and Lmx1b.2. Morpholino knockdown experiments demonstrate that Lmx1b.1 and Lmx1b.2 are required for maintenance of wnt1, but only at the IsO and only after the 18-somite stage. This function is preserved in the mouse, as Lmx1b-null mice fail to maintain wnt1 expression at the IsO beyond E9.5, and display a subsequent failure of MMR development (R. Johnson, personal communication).

As in the chick, the expression of lmx1b.1 and lmx1b.2 at the isthmus most closely resembles the expression of wnt1/10b during IsO development. Combined with our loss- and gain-of-function results, we conclude that Wnt gene expression at the IsO is fundamentally linked to Lmx1b.1 and Lmx1b.2 activity during this developmental period. Whether this transcriptional control is direct requires further study. Interestingly, knockdown of Wnt1 results in only a slight reduction of gene expression at the isthmus in zebrafish (Lekven et al., 2001), while simultaneous loss of Wnt1, Wnt10b and Wnt3a results in a complete loss of the isthmic constriction (Buckles et al., 2004Go). Consistent with these observations, Lmx1b.1 and Lmx1b.2 are required to maintain wnt1, wnt3a and wnt10b in the MMR and may regulate other Wnt genes.

Regulatory interactions between Pax and Lmx genes at the IsO
A clear positive feedback relationship exists between Lmx and Pax genes at the IsO, but we are only beginning to understand the details of these interactions. pax2.1, pax2.2, pax5 and pax8 are not maintained at the isthmus in the absence of functional Lmx1b.1/2 activity, and early maintenance of lmx1b.1 and lmx1b.2 requires Pax2.1. The failure of pax2.1, pax2.2 and pax5 maintenance past 24 hpf in B1B2-MO-injected embryos is consistent with the hypothesis that loss of Lmx1b.1/2 function results in a breakdown of IsO signaling, and precipitates programmed cell death at the isthmus. By contrast, the loss of pax8 expression by the 15-somite stage may reveal a more direct interaction between Pax8 and Lmx1b.1/2.

During IsO initiation, Pax, Fgf and Lmx gene expression is not yet interdependent, but by the mid- to late-somitogenesis stages, the IsO is regulated by a positive feedback loop in which these genes are mutually dependent for maintenance of expression. Regulation of pax8 by Lmx1b.1 and Lmx1b.2 may represent an intermediate stage in IsO development, between initiation and maintenance. As fgf8 is still expressed at the 19- to 22-somite stage in B1B2-MO-injected embryos, regulation of pax8 by Lmx1b.1 and Lmx1b.2 must occur via an Fgf8-indepentent mechanism that is yet to be defined. The early requirement for Pax2.1 in lmx1b.1/2 expression is further evidence of a Fgf8-independent regulatory pathway required for IsO development. Further supporting this idea, in noi mutant embryos lmx1b.1 and lmx1b.2 become dependent on Pax2.1 by the five-somite stage, while fgf8 is maintained until the nine-somite stage (Lun and Brand, 1998Go).

Although Lmx1b.1 and Lmx1b.2 are necessary for expression of multiple Pax genes, they do not appear to be sufficient. Ectopic Lmx1b.2 induced wnt1 and fgf8, but not pax2.1 or pax8. This result is surprising given that fgf8 is induced in this assay. As Fgf8 gain of function was sufficient to induce pax2.1 and other IsO genes in chick (Crossley et al., 1996Go), we expected that misexpression of Lmx1b.2 would result in induction of pax2.1, either directly or through Fgf8 induction. Failure to detect ectopic pax2.1 suggests that either the level of Fgf8 induced in this experiment was insufficient to subsequently induce pax2.1, or that, unlike in the chick, Fgf8 is not sufficient to induce pax2.1 in the zebrafish.

Anteroposterior and dorsoventral patterning of the MMR
The results presented are consistent with a hypothesis that ascribes a polarizing activity to the IsO (Lee et al., 1997Go; Riefers et al., 1998; Picker et al., 1999Go). We propose that Lmx1b.1 and Lmx1b.2 participate by maintaining cell survival in the region just posterior to the lmx1b.1/2 expression zone. During the maintenance phase of the IsO, MMR gene expression is co-dependent. Loss-of-function for a number of individual transcription factors and secreted factors results in loss of expression of the other regulators, increased cell death and the degeneration of the MMR. However, loss-of-function for individual IsO regulators has differing consequences for anteroposterior patterning of the MMR. Although lmx1b.1 and lmx1b.2 are expressed more rostral to the isthmic constriction, knockdown of Lmx1b.1 and Lmx1b.2 results in increased apoptosis caudal to the constriction. However, pax2.1 is expressed in a domain that flanks the isthmus, but apoptosis in the noi homozygous mutants is concentrated rostrally and extends well into the midbrain. This indicates that both Lmx1b.1/2 and Pax2.1 have asymmetric, non-cell-autonomous effects on cell survival. This is probably because of their regulation of trophic factors. Although a number of factors may be involved, we hypothesize that maintenance of the MMR depends on asymmetric responses to signaling from the expression boundary of Fgf8 and Wnt1/3a/10b, and that Lmx1b.1/2 mediate this regulation by maintaining Wnt1. Electroporation studies in chick suggest that Lmx1b.1/2 may have an additional role. Matsunaga et al. (Matsunaga et al., 2002Go) have proposed that fgf8 was cell-autonomously repressed by Lmx1b, but induced non-cell-autonomously by Lmx1b through Wnt1/3a/10b. However, we have not observed a repressive effect of Lmx1b.1 or Lmx1b.2 on fgf8 in zebrafish.

Our results also indicate a fine degree of specificity in dorsoventral patterning at the IsO. Morpholino knockdown of Lmx1b.1 and Lmx1b.2 affects ventral expression of IsO genes more than dorsal expression. pax2.1, pax2.2 and fgf8 expression was often lost throughout the MMR, but in some cases, a variable amount of dorsal expression was retained. The observed pattern of dorsal retention of IsO gene expression is also seen in the fgf8 mutant acerebellar (Pfeffer et al., 1998Go), while ventral retention is seen in the pax2.1 mutant noi (Lun and Brand, 1998Go). These results indicate that maintenance of the IsO is controlled differently in dorsal and ventral domains, although there is as yet no known mechanism that regulates dorsoventral patterning of the MMR. Further studies of Lmx1b.1 and Lmx1b.2 function at the IsO may help answer this and other questions concerning patterning and cell fate decisions in the MMR.


    ACKNOWLEDGMENTS
 
We thank Drs G. Bellipanni and E. Weinberg for providing noi heterozygotes; Dr M. Granato for the cDNA library; Drs A. Lekven and K. L. Chow for providing plasmids; Drs J. Golden, P. Klein, and V. Hatini for helpful comments on the manuscript; and Dr R. Johnson for sharing unpublished results. A. Sebastian and S. Wong aided in preliminary expression and in vitro translation studies. This work was supported by a grant from the National Institutes of Health (NS041005).


    Footnotes
 
* Present address: Department of Ophthalmology, University of Oklahoma Health Sciences Center, Oklahoma City, OK 73104, USA Back

{dagger} National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, MD 20892, USA Back


    REFERENCES
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 


Adams, K. A., Maida, J. M., Golden, J. A. and Riddle, R. D. (2000). The transcription factor Lmx1b maintains Wnt1 expression within the isthmic organizer. Development 127,1857 -1867.[Abstract]
Alvarado-Mallart, R. M., Martinez, S. and Lance-Jones, C. C. (1990). Pluripotentiality of the 2-day-old avian germinative neuroepithelium. Dev. Biol. 139, 75-88.[CrossRef][Medline]
Bally-Cuif, L., Alvarado-Mallart, R. M., Darnell, D. K. and Wassef, M. (1992). Relationship between Wnt-1 and En-2 expression domains during early development of normal and ectopic met-mesencephalon. Development 115,999 -1009.[Abstract]
Brand, M., Heisenberg, C. P., Jiang, Y. J., Beuchle, D., Lun, K., Furutani-Seiki, M., Granato, M., Haffter, P., Hammerschmidt, M., Kane, D. A. et al. (1996). Mutations in zebrafish genes affecting the formation of the boundary between midbrain and hindbrain. Development 123,179 -190.[Abstract]
Buckles, G. R., Thorpe, C. J., Ramel, M.-C. and Lekven, A. C. (2004). Combinatorial Wnt control of zebrafish midbrain-hindbrain boundary formation. Mech. Dev. 121,437 -447.[CrossRef][Medline]
Chen, H., Lun, Y., Ovchinnikov, D., Kokubo, H., Oberg, K. C., Pepicelli, C. V., Gan, L., Lee, B. and Johnson, R. L. (1998). Limb and kidney defects in Lmx1b mutant mice suggest an involvement of LMX1B in human nail patella syndrome. Nat. Genet. 19,51 -55.[CrossRef][Medline]
Cheng, L., Chen, C. L., Luo, P., Tan, M., Qiu, M., Johnson, R. and Ma, Q. (2003). Lmx1b, Pet-1, and Nkx2.2 coordinately specify serotonergic neurotransmitter phenotype. J. Neurosci. 23,9961 -9967.[Abstract/Free Full Text]
Chi, C. L., Martinez, S., Wurst, W. and Martin, G. R. (2003). The isthmic organizer signal FGF8 is required for cell survival in the prospective midbrain and cerebellum. Development 130,2633 -2644.[Abstract/Free Full Text]
Crossley, P. H., Martinez, S. and Martin, G. R. (1996). Midbrain development induced by FGF8 in the chick embryo. Nature 380,66 -68.[CrossRef][Medline]
Crossley, P. H. and Martin, G. R. (1995). The mouse Fgf8 gene encodes a family of polypeptides and is expressed in regions that direct outgrowth and patterning in the developing embryo. Development 121,439 -451.[Abstract]
Dickinson, M. E., Krumlauf, R. and McMahon, A. P. (1994). Evidence for a mitogenic effect of Wnt-1 in the developing mammalian central nervous system. Development 120,1453 -1471.[Abstract]
Favor, J., Sandulache, R., Neuhauser-Klaus, A., Pretsch, W., Chatterjee, B., Senft, E., Wurst, W., Blanquet, V., Grimes, P., Sporle, R. and Schughart, K. (1996). The mouse Pax2(1Neu) mutation is identical to a human PAX2 mutation in a family with renal-coloboma syndrome and result in developmental defects of the brain, ear, eye, and kidney. Proc. Natl. Acad. Sci. USA 93,13870 -13875.[Abstract/Free Full Text]
Funahashi, J., Okafuji, T., Ohuchi, H., Noji, S., Tanaka, H. and Nakamura, H. (1999). Role of Pax-5 in the regulation of a mid-hindbrain organizer's activity. Dev. Growth Differ. 41,59 -72.[CrossRef][Medline]
Gardner, C. A. and Barald, K. F. (1991). The cellular environment controls the expression of engrailed-like protein in the cranial neuroepithelium of quail-chick chimeric embryos. Development 113,1037 -1048.[Abstract]
German, M. S., Wang, J., Chadwick, R. B. and Rutter, W. J. (1992). Synergistic activation of the insulin gene by a LIM-homeo domain protein and a basic helix-loop-helix protein: building a functional insulin minienhancer complex. Genes Dev. 6,2165 -2176.[Abstract/Free Full Text]
German, M. S., Wang, J., Fernald, A. A., Espinosa, R., 3rd, Le Beau, M. M. and Bell, G. I. (1994). Localization of the genes encoding two transcription factors, LMX1 and CDX3, regulating insulin gene expression to human chromosomes 1 and 13. Genomics 24,403 -404.[CrossRef][Medline]
Heikinheimo, M., Lawshe, A., Shackleford, G. M., Wilson, D. B. and MacArthur, C. A. (1994). Fgf-8 expression in the post-gastrulation mouse suggests roles in the development of the face, limbs and central nervous system. Mech. Dev. 48,129 -138.[CrossRef][Medline]
Hidalgo-Sanchez, M., Millet, S., Simeone, A. and Alvarado-Mallart, R. M. (1999). Comparative analysis of Otx2, Gbx2, Pax2, Fgf8 and Wnt1 gene expressions during the formation of the chick midbrain/hindbrain domain. Mech. Dev. 81,175 -178.[CrossRef][Medline]
Higashijima, S., Hotta, Y. and Okamoto, H. (2000). Visualization of cranial motor neurons in live transgenic zebrafish expressing green fluorescent protein under the control of the islet-1 promoter/enhancer. J. Neurosci. 20,206 -218.[Abstract/Free Full Text]
Iannotti, C. A., Inoue, H., Bernal, E., Aoki, M., Liu, L., Donis-Keller, H., German, M. S. and Permutt, M. A. (1997). Identification of a human LMX1 (LMX1.1)-related gene, LMX1.2: tissue-specific expression and linkage mapping on chromosome 9. Genomics 46,520 -524.[CrossRef][Medline]
Itasaki, N., Ichijo, H., Hama, C., Matsuno, T. and Nakamura, H. (1991). Establishment of rostrocaudal polarity in tectal primordium: engrailed expression and subsequent tectal polarity. Development 113,1133 -1144.[Abstract]
Jászai, J., Reifers, F., Picker, A., Langenberg, T. and Brand, M. (2003). Isthmus-to-midbrain transformation in the absence of midbrain-hindbrain organizer activity. Development 130,6611 -6623.[Abstract/Free Full Text]
Joyner, A. L. (1996). Engrailed, Wnt and Pax genes regulate midbrain–hindbrain development. Trends Genet. 12,15 -20.[CrossRef][Medline]
Kelly, G. M. and Moon, R. T. (1995). Involvement of wnt1 and pax2 in the formation of the midbrain-hindbrain boundary in the zebrafish gastrula. Dev. Genet. 17,129 -140.[CrossRef][Medline]
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and Schilling, T. F. (1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203,253 -310.[Medline]
Lee, S. M., Danielian, P. S., Fritzsch, B. and McMahon, A. P. (1997). Evidence that FGF8 signalling from the midbrain-hindbrain junction regulates growth and polarity in the developing midbrain. Development 124,959 -969.[Abstract]
Lekven, A. C., Buckles, G. R., Kostakis, N. and Moon, R. T. (2003). Wnt1 and wnt10b function redundantly at the zebrafish midbrain-hindbrain boundary. Dev. Biol. 254,172 -187.[CrossRef][Medline]
Li, J. Y. and Joyner, A. L. (2001). Otx2 and Gbx2 are required for refinement and not induction of mid-hindbrain gene expression. Development 128,4979 -4991.
Liu, A. and Joyner, A. L. (2001). Early anterior/posterior patterning of the midbrain and cerebellum. Annu. Rev. Neurosci. 24,869 -896.[CrossRef][Medline]
Lun, K. and Brand, M. (1998). A series of no isthmus (noi) alleles of the zebrafish pax2.1 gene reveals multiple signaling events in development of the midbrain-hindbrain boundary. Development 125,3049 -3062.[Abstract]
Marin, F. and Puelles, L. (1994). Patterning of the embryonic avian midbrain after experimental inversions: a polarizing activity from the isthmus. Dev. Biol. 163, 19-37.[CrossRef][Medline]
Martinez, S., Wassef, M. and Alvarado-Mallart, R. M. (1991). Induction of a mesencephalic phenotype in the 2-day-old chick prosencephalon is preceded by the early expression of the homeobox gene En. Neuron 6,971 -981.[CrossRef][Medline]
Martinez, S., Marin, F., Nieto, M. A. and Puelles, L. (1995). Induction of ectopic engrailed expression and fate change in avian rhombomeres: intersegmental boundaries as barriers. Mech. Dev. 51,289 -303.[CrossRef][Medline]
Martinez, S., Crossley, P. H., Cobos, I., Rubenstein, J. L. and Martin, G. R. (1999). FGF8 induces formation of an ectopic isthmic organizer and isthmocerebellar development via a repressive effect on Otx2 expression. Development 126,1189 -1200.[Abstract]
Matsunaga, E., Katahira, T. and Nakamura, H. (2002). Role of Lmx1b and Wnt1 in mesencephalon and metencephalon development. Development 129,5269 -5277.
McMahon, A. P. and Bradley, A. (1990). The Wnt-1 (int-1) proto-oncogene is required for development of a large region of the mouse brain. Cell 62,1073 -1085.[CrossRef][Medline]
Megason, S. G. and McMahon, A. P. (2002). A mitogen gradient of dorsal midline Wnts organizes growth in the CNS. Development 129,2087 -2098.[Abstract/Free Full Text]
Meyers, E. N., Lewandoski, M. and Martin, G. R. (1998). An Fgf8 mutant allelic series generated by Cre- and Flp-mediated recombination. Nat. Genet. 18,136 -141.[CrossRef][Medline]
Millen, K. J., Wurst, W., Herrup, K. and Joyner, A. L. (1994). Abnormal embryonic cerebellar development and patterning of postnatal foliation in two mouse Engrailed-2 mutants. Development 120,695 -706.[Abstract]
Millet, S., Bloch-Gallego, E., Simeone, A. and Alvarado-Mallart, R. M. (1996). The caudal limit of Otx2 gene expression as a marker of the midbrain/hindbrain boundary: a study using in situ hybridisation and chick/quail homotopic grafts. Development 122,3785 -3797.[Abstract]
Mohammadi, M., McMahon, G., Sun, L., Tang, C., Hirth, P., Yeh, B. K., Hubbard, S. R. and Schlessinger, J. (1997). Structures of the tyrosine kinase domain of fibroblast growth factor receptor in complex with inhibitors. Science 276,955 -960.[Abstract/Free Full Text]
Mullins, M. C., Hammerschmidt, M., Haffter, P. and Nusslein-Volhard, C. (1994). Large-scale mutagenesis in the zebrafish: in search of genes controlling development in a vertebrate. Curr. Biol. 4,189 -202.[CrossRef][Medline]
Nakamura, H., Nakano, K. E., Igawa, H. H., Takagi, S. and Fujisawa, H. (1986). Plasticity and rigidity of differentiation of brain vesicles studied in quail-chick chimeras. Cell Differ. 19,187 -193.[CrossRef][Medline]
Niss, K. and Leutz, A. (1998). Expression of the homeobox gene GBX2 during chicken development. Mech. Dev. 76,151 -155.[CrossRef][Medline]
Odenthal, J. and Nusslein-Volhard, C. (1998). fork head domain genes in zebrafish. Dev. Genes Evol. 208,245 -258.[CrossRef][Medline]
Panhuysen, M., Vogt Weisenhorn, D. M., Blanquet, V., Brodski, C., Heinzmann, U., Beisker, W. and Wurst, W. (2004). Effects of Wnt1 signaling on proliferation in the developing mid-/hindbrain region. Mol. Cell. Neurosci. 26,101 -111.[CrossRef][Medline]
Pfeffer, P. L., Gerster, T., Lun, K., Brand, M. and Busslinger, M. (1998). Characterization of three novel members of the zebrafish Pax2/5/8 family: dependency of Pax5 and Pax8 expression on the Pax2.1 (noi) function. Development 125,3063 -3074.[Abstract]
Picker, A., Brennan, C., Reifers, F., Clarke, J. D., Holder, N. and Brand, M. (1999). Requirement for the zebrafish mid-hindbrain boundary in midbrain polarisation, mapping and confinement of the retinotectal projection. Development 126,2967 -2978.[Abstract]
Puelles, L., Martin, F., Martinez de la Torre, M. and Martinez, S. (1996). The midbrain-hindbrain junction: a model system for brain regionalization through morphogenetic and neuroepithelial interactions. In Mammalian Development, pp.173 -197. Newark, NJ: Gordon & Breach/Harwood Academic Publishing.
Reifers, F., Bohli, H., Walsh, E. C., Crossley, P. H., Stainier, D. Y. and Brand, M. (1998). Fgf8 is mutated in zebrafish acerebellar (ace) mutants and is required for maintenance of midbrain-hindbrain boundary development and somitogenesis. Development 125,2381 -2395.[Abstract]
Riddle, R. D., Ensini, M., Nelson, C., Tsuchida, T., Jessell, T. M. and Tabin, C. (1995). Induction of the LIM homeobox gene Lmx1 by WNT7a establishes dorsoventral pattern in the vertebrate limb. Cell 83,631 -640.[CrossRef][Medline]
Serbedzija, G. N., Dickinson, M. and McMahon, A. P. (1996). Cell death in the CNS of the Wnt-1 mutant mouse. J. Neurobiol. 31,275 -282.[CrossRef][Medline]
Shamim, H. and Mason, I. (1998). Expression of Gbx-2 during early development of the chick embryo. Mech. Dev. 76,157 -159.[CrossRef][Medline]
Shamim, H., Mahmood, R., Logan, C., Doherty, P., Lumsden, A. and Mason, I. (1999). Sequential roles for Fgf4, En1 and Fgf8 in specification and regionalisation of the midbrain. Development 126,945 -959.[Abstract]
Simeone, A., Acampora, D., Massino, G., Stornaiuolo, A. and Boncinelli, E. (1992). Nested expression domains of four homeobox genes in the developing rostral brain. Nature 358,687 -690.[CrossRef][Medline]
Smidt, M. P., Asbreuk, C. H., Cox, J. J., Chen, H., Johnson, R. L. and Burbach, J. P. (2000). A second independent pathway for development of mesencephalic dopaminergic neurons requires Lmx1b. Nat. Neurosci. 3,337 -341.[CrossRef][Medline]
Torres, M., Gomez-Pardo, E. and Gruss, P. (1996). Pax2 contributes to inner ear patterning and optic nerve trajectory. Development 122,3381 -3391.[Abstract]
Thomas, K. R. and Capecchi, M. R. (1990). Targeted disruption of the murine int-1 proto-oncogene resulting in severe abnormalities in midbrain and cerebellar development. Nature 346,847 -850.[CrossRef][Medline]
Tsuchida, T., Ensini, M., Morton, S. B., Baldassare, M., Edlund, T., Jessell, T. M. and Pfaff, S. L. (1994). Topographic organization of embryonic motor neurons defined by expression of LIM homeobox genes. Cell 79,957 -970.[CrossRef][Medline]
Vogel, A., Rodriguez, C., Warnken, W. and Izpisua Belmonte, J. C. (1995). Dorsal cell fate specified by chick Lmx1 during vertebrate limb development. Nature 378,716 -720.[CrossRef][Medline]
Wassarman, K. M., Lewandoski, M., Campbell, K., Joyner, A. L., Rubenstein, J. L., Martinez, S. and Martin, G. R. (1997). Specification of the anterior hindbrain and establishment of a normal mid/hindbrain organizer is dependent on Gbx2 gene function. Development 124,2923 -2934.[Abstract]
Wassef, M. and Joyner, A. L. (1997). Early mesencephalon/metencephalon patterning and development of the cerebellum. Persp. Dev. Neuro. 5,3 -16.
Wilkinson, D. G., Bailes, J. A. and McMahon, A. P. (1987). Expression of the proto-oncogene int-1 is restricted to specific neural cells in the developing mouse embryo. Cell 50,79 -88.[CrossRef][Medline]
Wurst, W., Auerbach, A. B. and Joyner, A. L. (1994). Multiple developmental defects in Engrailed-1 mutant mice: an early mid-hindbrain deletion and patterning defects in forelimbs and sternum. Development 120,2065 -2075.[Abstract]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
J. Neurosci.Home page
Y. Mishima, A. G. Lindgren, V. V. Chizhikov, R. L. Johnson, and K. J. Millen
Overlapping Function of Lmx1a and Lmx1b in Anterior Hindbrain Roof Plate Formation and Cerebellar Growth
J. Neurosci., September 9, 2009; 29(36): 11377 - 11384.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
A. Badde and D. Schulte
A Role for Receptor Protein Tyrosine Phosphatase {lambda} in Midbrain Development
J. Neurosci., June 11, 2008; 28(24): 6152 - 6164.
[Abstract] [Full Text] [PDF]


Home page
Schizophr BullHome page
R. V. Sillitoe and M. W. Vogel
Desire, Disease, and the Origins of the Dopaminergic System
Schizophr Bull, March 1, 2008; 34(2): 212 - 219.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
C. Guo, H.-Y. Qiu, Y. Huang, H. Chen, R.-Q. Yang, S.-D. Chen, R. L. Johnson, Z.-F. Chen, and Y.-Q. Ding
Lmx1b is essential for Fgf8 and Wnt1 expression in the isthmic organizer during tectum and cerebellum development in mice
Development, January 15, 2007; 134(2): 317 - 325.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
S.-L. Ang
Transcriptional control of midbrain dopaminergic neuron development
Development, September 15, 2006; 133(18): 3499 - 3506.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
P. Alexandre, I. Bachy, M. Marcou, and M. Wassef
Positive and negative regulations by FGF8 contribute to midbrain roof plate developmental plasticity
Development, August 1, 2006; 133(15): 2905 - 2913.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow A corrigendum has been published
Right arrow All Versions of this Article:
dev.01898v1
132/14/3163    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by O'Hara, F. P.
Right arrow Articles by Riddle, R. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by O'Hara, F. P.
Right arrow Articles by Riddle, R. D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?