|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
The fully linked HTML version of this article has now been published.
First published online 8 June 2005
doi: 10.1242/dev.01898
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


Department of Cell and Developmental Biology, University of Pennsylvania School of Medicine, Philadelphia, PA 19104, USA
Author for correspondence (e-mail:
kesslerd{at}mail.med.upenn.edu)
Accepted 11 May 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Isthmus, Lmx1b, Mesencephalon, Metencephalon, Pax, Wnt, Zebrafish
| Introduction |
|---|
|
|
|---|
The IsO is positioned at the juxtaposition of the otx2 and
gbx2 expression domains (Simeone
et al., 1992
; Millet et al.,
1996
; Wassarman et al.,
1997
; Niss and Leutz,
1998
; Shamim and Mason,
1998
; Li and Joyner,
2001
). Coincident with this border is the expression boundary of
two major signaling molecules, wnt1 and fgf8. During IsO
maintenance, wnt1 is expressed at the caudal edge of the
mesencephalic vesicle (Wilkinson et al.,
1987
; Bally-Cuif et al.,
1992
; Kelly and Moon,
1995
; Hidalgo-Sanchez et al.,
1999
), and wnt1 mutant mice fail to maintain a number of
mesencephalic and metencephalic structures
(McMahon and Bradley, 1990
;
Thomas and Capecchi, 1990
).
Although Wnt1 signaling is necessary for MMR development, ectopic Wnt1 does
not appear to be sufficient to globally change the fate of MMR cells
(Adams et al., 2000
). By
contrast, isthmic fgf8 expression is refined to the rostral edge of
the metencephalic vesicle (Heikinheimo et
al., 1994
; Crossley and
Martin, 1995
; Riefers et al., 1998), and is necessary and
sufficient to mediate IsO function (Brand
et al., 1996
; Meyers et al.,
1998
; Riefers et al., 1998). In fact, ectopic Fgf8 induces changes
in gene expression and morphology strikingly similar to transplantation of
isthmic tissue (Crossley et al.,
1996
; Funahashi et al.,
1999
; Martinez et al.,
1999
; Shamim et al.,
1999
). IsO regulation also requires a number of transcription
factors that work in a coordinated fashion, including members of the Pax
family (Brand et al., 1996
;
Favor et al., 1996
;
Torres et al., 1996
;
Lun and Brand, 1998
;
Pfeffer et al., 1998
), the
Engrailed family (Millen et al.,
1994
; Wurst et al.,
1994
) and Lmx1b.
Lmx1b is a LIM-homeodomain protein whose role in IsO patterning has only
been addressed in gain-of-function studies. Originally identified as a
regulator in dorsoventral limb patterning
(Riddle et al., 1995
;
Vogel et al., 1995
;
Chen et al., 1998
), Lmx1b has
recently been shown to be required for dopaminergic and serotonergic neuron
development in vertebrates (Smidt et al.,
2000
; Cheng et al.,
2003
). We originally reported that Lmx1b was expressed in the
chick MMR and, using a retroviral approach, demonstrated that it was
sufficient to maintain the expression of Wnt1 in the mesencephalon
(Adams et al., 2000
). More
recently, Matsunaga et al. (Matsunaga et
al., 2002
) used an electroporation approach in the chick to
demonstrate that Lmx1b induced wnt1 cell-autonomously and
fgf8 non-cell-autonomously. However, direct evidence of a requirement
for Lmx1b in IsO function has been lacking.
To further elucidate transcriptional regulation of the IsO, we have
extended these studies to the zebrafish. The zebrafish provides a powerful
means of studying the genetic basis of IsO formation and function. IsO
regulation appears largely conserved among vertebrates, and the relative ease
of gain- and loss-of-function experiments in zebrafish allows for a number of
developmental studies not possible in the chick. Mutants of several major IsO
genes are available in zebrafish, including pax2.1 (no
isthmus) (Lun and Brand,
1998
) and fgf8 (acerebellar) (Riefers et al.,
1998). Study of these mutants and other developmental studies in fish have
contributed to our understanding of a regulatory feedback loop that maintains
IsO patterning function.
We report the isolation and functional analysis of lmx1b.1 and lmx1b.2, two zebrafish orthologs of lmx1b. Loss- and gain-of-function studies indicate that these two closely related transcription factors have redundant functions in maintaining gene expression and cell fate at the IsO, and that these genes are necessary and sufficient for maintenance of wnt1 and fgf8 expression. Pax2.1 is required for maintenance of lmx1b.1 and lmx1b.2 at the IsO, and Lmx1b.1 and Lmx1b.2 are required for pax8 maintenance. We propose a model in which Lmx1b.1 and Lmx1b.2 cooperate with Pax, Wnt and Fgf genes to maintain the IsO.
| Materials and methods |
|---|
|
|
|---|
Isolation of lmx1b.1 and lmx1b.2
Based on the published sequence of hamster
(German et al., 1992
) and
human (German et al., 1994
)
Lmx1a, and human (Iannotti et al.,
1997
), mouse (Chen et al.,
1998
) and chick (Tsuchida et
al., 1994
) Lmx1b, a single pair of degenerate PCR primers was
designed using the amino acid sequences indicated in
Fig. 1A, that was predicted to
amplify both lmx1a and lmx1b orthologs. Fragments resulting
from PCR amplification of 24 hpf zebrafish cDNA were subcloned and two
distinct species were isolated multiple times. Each insert was used to screen
a 22-26 hpf zebrafish lambda zap cDNA library and a total of 38 purified
positives was identified following screening of 1 million plaques. Multiple
isolates of two distinct cDNAs were obtained, each
2 kb in length and
containing 300-500 bp of untranslated sequence (data not shown). Although this
degenerate PCR strategy was predicted to identify zebrafish orthologs of
lmx1a and lmx1b, both cDNAs isolated were closely related to
lmx1b (Fig. 1B,C). The
sequences for Lmx1b.1 (AY894989) and Lmx1b.2 (AY894990) have been submitted to
GenBank. We have subsequently identified a putative lmx1a ortholog in
the zebrafish genome database, so the failure to identify this sequence in our
screen suggests that expression levels at 22-26 hpf were too low. ClustalW
alignments and phylogenetic analyses were performed using MacVector
(Accelrys), and the phylogenetic tree was produced using the Neighbor Joining
Method with bootstrapping (1000 replicates).
Whole-mount in situ hybridization and histology
Digoxigenin- or fluorescein-labeled probes were generated from linearized
templates using an RNA labeling and detection kit (Roche). Hybridization and
detection with alkaline phosphatase-conjugated antibodies is described
elsewhere (Odenthal and
Nüsslein-Vollhard, 1998
). Stained embryos were cleared in
benzyl alcohol:benzyl benzoate (2:1), mounted in Canada balsam, and
photographed using a Magnafire SP digital camera (Optronics). Alternatively,
embryos were photographed in PBS using a Micropublisher digital camera
(Qimaging). To obtain histological sections, embryos were embedded in JB-4
plastic resin (Polysciences). Sections (5 µm) were prepared with glass
knives using a Leica RM2155 microtome. Sections were affixed to glass slides
and stained with Methylene Blue/Azure II.
Morpholinos and microinjections
Antisense morpholino oligonucleotides were obtained from Gene Tools
(Corvallis, OR). Morpholino sequences were CTTCGATTTTTATACCGTCCAACAT for
lmx1b.1-MO (B1-MO) and CCTCAATTTTGATTCCGTCCAGCAT for
lmx1b.2-MO (B2-MO). Mismatch oligonucleotides were designed for use
as negative controls: CGTCTATTTTCATGCCGTCCATCAT for lmx1bN-MO (BN-MO)
and CATCCATTTTAATCCCGTCCACCAT for lmx1bX-MO (BX-MO). An unrelated
control oligonucleotide (CON-MO) was provided by the manufacturer. Morpholino
microinjections were performed on 1- to 4-cell embryos. Morpholino solutions
(4 mg/ml in Danieu buffer) were back-loaded into glass needles before
injection, and 1.5-2.5 nl of morpholino solution were delivered to the yolk of
each embryo. To verify morpholino specificity, in vitro translation analysis
was performed using the TNT Coupled Transcription/Translation System (Ambion)
with 0.5 µg of plasmid DNA and 0.5 µg of morpholino oligonucleotide.
35S-methionine was incorporated and labeled proteins were resolved
by 10% SDS-PAGE and visualized by autoradiography.
Immunohistochemistry and TUNEL staining
For immunohistochemistry, a mixture of two mouse monoclonal anti-GFP
antibodies was used (Roche) and detected with biotinylated anti-mouse
secondary antibody. Phosphohistone H3 protein was detected with a rabbit
polyclonal antibody (Upstate) and biotinylated anti-rabbit antibody. Color
reaction was carried out using Vectastain ABC Kit (Vector) and FAST DAB
(Sigma). For TUNEL staining, the ApopTag Peroxidase Detection Kit (Chemicon)
was used, but anti-digoxigenin-AP was substituted for anti-digoxigenin-HRP.
Color reaction was carried out using NBT/BCIP.
Visualization of cranial motoneurons
A previously described transgenic line allows for the visualization of
cranial motoneurons that express GFP under control of the Islet1 promotor
(Higashijima et al., 2000
).
Transgenic embryos were injected with both morpholino oligos, and expression
of GFP was observed in live embryos at 12-hour intervals beginning at 24 hpf.
For images shown in Fig. 7,
embryos were fixed at 48 hpf and processed for immunohistochemical
visualization of GFP.
Pharmacological inhibition of FGF signaling
To block FGF signaling, tailbud stage embryos were incubated in an 8 µM
solution of SU5402 (Calbiochem) in E3/DMSO for 4 hours. Control embryos were
incubated in E3/DMSO alone.
Hsp 70-driven misexpression of Lmx1b.1 and Lmx1b.2
To misexpress Lmx1b.1 and Lmx1b.2, cDNAs containing the complete coding
regions were cloned into pBluescript SK plasmids downstream
of the hsp70 promoter. Injection solutions were prepared at a
concentration of 10 ng/µl in 0.2 M KCl and Phenol Red, and 1-3 nl of
solution was injected directly into the cytoplasm of one-cell stage embryos.
Embryos were then reared until early somitogenesis (1-5 somites). At that
time, embryos were heat shocked at 37°C for 45 minutes. After heat shock,
embryos were allowed to further develop for 2-29 hours before fixation.
| Results |
|---|
|
|
|---|
Although our cloning strategy did not yield a Lmx1a homolog, we have identified a putative zebrafish Lmx1a by performing a BLAST search of available zebrafish genomic sequences. Phylogenetic analysis supports the grouping of this sequence with other known Lmx1a proteins, while both zebrafish sequences obtained in our screen cluster with Lmx1b proteins (Fig. 1C).
|
|
|
At 24 hpf, lmx1b.1 and lmx1b.2 are expressed at the caudal limit of the mesencephalon that abuts the isthmic constriction in a pattern similar to the wnt1 expression domain (Fig. 3D-F). All three genes are also expressed in the dorsal midline of the mesencephalon and metencephalon. During IsO patterning, the MMR expression of lmx1b.1 and wnt1 is contained within the anterior domain of pax2.1 expression (Fig. 3G,H), as is lmx1b.2 (data not shown).
Lmx1b.1 and Lmx1b.2 are required for maintenance of MMR structure and gene expression
To determine what developmental events require Lmx1b.1 and Lmx1b.2, we
performed a series of morpholino knockdown experiments. Antisense morpholino
oligos were designed to specifically block translation of Lmx1b.1 (B1-MO) or
Lmx1b.2 (B2-MO). An in vitro translation assay to asses oligo efficacy and
specificity demonstrated that B1-MO effectively blocked only Lmx1b.1
translation, and B2-MO blocked only Lmx1b.2 translation. Mismatch control
oligos (see Materials and methods) did not block translation of either
(Fig. 4A). Injection of embryos
with single morpholinos directed against either Lmx1b.1 or Lmx1b.2 does not
produce a discernible morphological phenotype (data not shown), nor does
injection of any of the three control morpholinos, although one control,
BN-MO, causes a small degree of nonspecific toxicity. Embryos injected with
morpholinos targeting both Lmx1b.1 and Lmx1b.2 (B1B2-MO) fail to maintain the
isthmic constriction or cerebellum (Fig.
4). At 24 hpf, experimental and control embryos are
morphologically similar, but the loss of the isthmic constriction and
cerebellum in B1B2-MO-injected embryos is easily observed by 30 hpf (92%,
n=60). The affected embryos subsequently develop circulatory problems
and severe cardiac edema by 48 hpf and die soon thereafter.
|
|
|
|
We next examined the consequences of Lmx1b.1 and Lmx1b.2 loss of function
on neuronal differentiation. Cranial motoneurons (CMNs) III and IV flank the
isthmus, and thus serve as markers of neuronal differentiation at the MMR. A
transgenic islet1-GFP line allows for the visualization of Islet1-expressing
CMNs in the developing zebrafish brain
(Higashijima et al., 2000
).
GFP expression in the cell bodies of these neurons was observed as early as 36
hpf. Live B1B2-MO-injected embryos were examined through 54 hpf, and CMNIII
and CMNIV were never observed. CMNs were also visualized in fixed embryos
using an antibody against GFP, which yielded better images of CMNs, and these
data are presented in Fig.
7E,F. Islet1-GFP embryos were injected with BX-MO or B1B2-MO and
fixed at 36, 48 and 72 hpf. Antibody staining for GFP revealed that while CMNs
developed normally in BX-MO-injected embryos, CMNIII and CMNIV were not
detected in B1B2-MO-injected embryos at any stage examined.
MMR expression of lmx1b.1 and lmx1b.2 requires Pax2.1 and FGF signals
To test the requirement for Pax2.1 in lmx1b.1 and lmx1b.2
expression, we performed whole-mount in situ hybridization on noi
mutant embryos (Table 1). At
the one-somite stage, all embryos expressed lmx1b.1 (n=17)
and lmx1b.2 (n=17) normally. However, at subsequent
developmental stages (5, 7, 12 and 18 somites) lmx1b.1 and
lmx1b.2 expression at the MMR was absent in
25% of embryos
(59/234 and 64/214, respectively). This corresponds to the predicted one
quarter of embryos homozygous for the pax2.1 mutation. Significantly,
this loss of lmx1b.1 and lmx1b.2 expression occurs earlier
than the loss of wnt1 (first affected at six somites) and
fgf8 (first affected at nine somites) in noi mutant embryos
(Lun and Brand, 1998
).
Therefore, Pax2.1 is not required for the initiation of lmx1b.1 or
lmx1b.2 expression, but soon thereafter is required for their
maintenance at the IsO in a manner independent of Wnt1 and Fgf8.
|
Lmx1b.1 and Lmx1b.2 induce expression of wnt1 and fgf8
To determine which IsO genes are regulated by Lmx1b.1 and Lmx1b.2, we
induced ectopic expression using constructs containing the lmx1b.1-
or lmx1b.2-coding sequence under the control of the hsp70
promoter. Embryos were injected with plasmid at the one-cell stage and were
heat-shocked during early somitogenesis to induce expression of
lmx1b.1 (Fig. 9A,B) or
lmx1b.2 (data not shown). Ectopic expression was highly variable, and
the number of expressing clones varied from one to hundreds. The Lmx-positive
clones were distributed randomly throughout most tissues of heat-shocked
embryos, but the cells surrounding the yolk seemed most sensitive to the
treatment. Wild-type embryos were heat-shocked, resulting in no ectopic
induction of lmx1b.1 (n=26) or lmx1b.2
(n=20). Control embryos injected with hsp70-lmx1b.1, but not
heat shocked, did not express ectopic lmx1b.1 (n=13) or
wnt1 (n=12). Embryos injected with lmx1b.2-hsp70
and not heat-shocked did not express ectopic lmx1b.2 (n=10)
or wnt1 (n=19).
|
|
As the Hsp70-Lmx1b.2 construct was more effective, we used it to test Lmx1b regulation of other IsO genes. We injected one-cell stage embryos with hsp70-lmx1b.2, heat shocked during early somitogenesis, and fixed embryos 2, 13 or 29 hours after treatment. Embryos were then examined for wnt1, fgf8, pax2.1 and pax8 expression. At each time point, ectopic expression of wnt1 (9/19, 4/14, 13/33) and fgf8 (8/20, 8/21, 2/29) was observed. Although strong endogenous expression was detected, no ectopic expression of pax2.1 (0/21, 0/20, 0/20) or pax8 (0/20, 0/18, 0/26) was detected. Therefore, whereas Lmx1b.1 and Lmx1b.2 are sufficient to induce wnt1 and fgf8, Lmx1b.2 is not sufficient to induce pax2.1 or pax8.
|
| Discussion |
|---|
|
|
|---|
Lmx1b.1 and Lmx1b.2 are required to maintain the IsO
Loss of Lmx1b.1 and Lmx1b.2 function causes the degeneration of the isthmus
and cerebellum by 30 hpf. This morphological effect is preceded by a
substantial increase in cell death at the MMR between 18 and 24 hpf. It is
possible that the primary role of Lmx1b.1 and Lmx1b.2 at the isthmus is to
maintain cell survival in the isthmocerebellar region. Alternatively, Lmx1b.1
and Lmx1b.2 may play an indirect role in the cell death; loss of Lmx1b.1 and
Lmx1b.2 may result in a failure of IsO autoregulation, which leads to loss of
maintenance of downstream trophic factors necessary for cell survival.
The requirement of Lmx1b.1 and Lmx1b.2 for maintenance of cell survival is
probably tied to their regulation of Wnt1 and Fgf8. Wnt1 has been shown to
have a proliferative role in the CNS
(Dickinson et al., 1994
;
Matsunaga et al., 2002
;
Megason and McMahon, 2002
;
Panhuysen et al., 2004
), and
Wnt1/ mice have ectopic cell death at the
MMR (Serbedzija et al., 1996
;
Chi et al., 2003
). Simultaneous
loss of signaling from Wnt1, Wnt10b and Wnt3a results in increased apoptosis
at the MMR (Buckles et al.,
2004
). Similarly, knockout of MMR fgf8 results in ectopic
apoptosis in mice (Chi et al.,
2003
). In zebrafish, ace mutants lacking functional Fgf8
exhibit increased cell death concentrated above the rostral metencephalon from
midsomitogenesis onwards, and a marked decrease in mitosis at the MMR at 57
hpf (Jászai et al.,
2003
). Cell death observed in the MMR of B1B2-MO-injected embryos
could thus be attributed to the loss of wnt1/wnt3a/wnt10b and
fgf8, and cell death may be initiated when cells fail to receive
these essential proliferative signals.
A close regulatory relationship between Lmx proteins and Wnt1 at the IsO is
conserved among vertebrates. Lmx1b can induce expression of wnt1 in
the chick (Adams et al., 2000
;
Matsunaga et al., 2002
). The
gain-of-function experiments in the present study demonstrate that this
regulatory relation is conserved in zebrafish, with wnt1 being
regulated by both Lmx1b.1 and Lmx1b.2. Morpholino knockdown experiments
demonstrate that Lmx1b.1 and Lmx1b.2 are required for maintenance of
wnt1, but only at the IsO and only after the 18-somite stage. This
function is preserved in the mouse, as Lmx1b-null mice fail to
maintain wnt1 expression at the IsO beyond E9.5, and display a
subsequent failure of MMR development (R. Johnson, personal
communication).
As in the chick, the expression of lmx1b.1 and lmx1b.2 at
the isthmus most closely resembles the expression of wnt1/10b during
IsO development. Combined with our loss- and gain-of-function results, we
conclude that Wnt gene expression at the IsO is fundamentally linked to
Lmx1b.1 and Lmx1b.2 activity during this developmental period. Whether this
transcriptional control is direct requires further study. Interestingly,
knockdown of Wnt1 results in only a slight reduction of gene expression at the
isthmus in zebrafish (Lekven et al., 2001), while simultaneous loss of Wnt1,
Wnt10b and Wnt3a results in a complete loss of the isthmic constriction
(Buckles et al., 2004
).
Consistent with these observations, Lmx1b.1 and Lmx1b.2 are required to
maintain wnt1, wnt3a and wnt10b in the MMR and may regulate
other Wnt genes.
Regulatory interactions between Pax and Lmx genes at the IsO
A clear positive feedback relationship exists between Lmx and Pax genes at
the IsO, but we are only beginning to understand the details of these
interactions. pax2.1, pax2.2, pax5 and pax8 are not
maintained at the isthmus in the absence of functional Lmx1b.1/2 activity, and
early maintenance of lmx1b.1 and lmx1b.2 requires Pax2.1.
The failure of pax2.1, pax2.2 and pax5 maintenance past 24
hpf in B1B2-MO-injected embryos is consistent with the hypothesis that loss of
Lmx1b.1/2 function results in a breakdown of IsO signaling, and precipitates
programmed cell death at the isthmus. By contrast, the loss of pax8
expression by the 15-somite stage may reveal a more direct interaction between
Pax8 and Lmx1b.1/2.
During IsO initiation, Pax, Fgf and Lmx gene expression is not yet
interdependent, but by the mid- to late-somitogenesis stages, the IsO is
regulated by a positive feedback loop in which these genes are mutually
dependent for maintenance of expression. Regulation of pax8 by
Lmx1b.1 and Lmx1b.2 may represent an intermediate stage in IsO development,
between initiation and maintenance. As fgf8 is still expressed at the
19- to 22-somite stage in B1B2-MO-injected embryos, regulation of
pax8 by Lmx1b.1 and Lmx1b.2 must occur via an Fgf8-indepentent
mechanism that is yet to be defined. The early requirement for Pax2.1 in
lmx1b.1/2 expression is further evidence of a Fgf8-independent
regulatory pathway required for IsO development. Further supporting this idea,
in noi mutant embryos lmx1b.1 and lmx1b.2 become
dependent on Pax2.1 by the five-somite stage, while fgf8 is
maintained until the nine-somite stage
(Lun and Brand, 1998
).
Although Lmx1b.1 and Lmx1b.2 are necessary for expression of multiple Pax
genes, they do not appear to be sufficient. Ectopic Lmx1b.2 induced
wnt1 and fgf8, but not pax2.1 or pax8.
This result is surprising given that fgf8 is induced in this assay.
As Fgf8 gain of function was sufficient to induce pax2.1 and other
IsO genes in chick (Crossley et al.,
1996
), we expected that misexpression of Lmx1b.2 would result in
induction of pax2.1, either directly or through Fgf8 induction.
Failure to detect ectopic pax2.1 suggests that either the level of
Fgf8 induced in this experiment was insufficient to subsequently induce
pax2.1, or that, unlike in the chick, Fgf8 is not sufficient to
induce pax2.1 in the zebrafish.
Anteroposterior and dorsoventral patterning of the MMR
The results presented are consistent with a hypothesis that ascribes a
polarizing activity to the IsO (Lee et
al., 1997
; Riefers et al., 1998;
Picker et al., 1999
). We
propose that Lmx1b.1 and Lmx1b.2 participate by maintaining cell survival in
the region just posterior to the lmx1b.1/2 expression zone. During
the maintenance phase of the IsO, MMR gene expression is co-dependent.
Loss-of-function for a number of individual transcription factors and secreted
factors results in loss of expression of the other regulators, increased cell
death and the degeneration of the MMR. However, loss-of-function for
individual IsO regulators has differing consequences for anteroposterior
patterning of the MMR. Although lmx1b.1 and lmx1b.2 are
expressed more rostral to the isthmic constriction, knockdown of Lmx1b.1 and
Lmx1b.2 results in increased apoptosis caudal to the constriction. However,
pax2.1 is expressed in a domain that flanks the isthmus, but
apoptosis in the noi homozygous mutants is concentrated rostrally and
extends well into the midbrain. This indicates that both Lmx1b.1/2 and Pax2.1
have asymmetric, non-cell-autonomous effects on cell survival. This is
probably because of their regulation of trophic factors. Although a number of
factors may be involved, we hypothesize that maintenance of the MMR depends on
asymmetric responses to signaling from the expression boundary of Fgf8 and
Wnt1/3a/10b, and that Lmx1b.1/2 mediate this regulation by maintaining Wnt1.
Electroporation studies in chick suggest that Lmx1b.1/2 may have an additional
role. Matsunaga et al. (Matsunaga et al.,
2002
) have proposed that fgf8 was cell-autonomously
repressed by Lmx1b, but induced non-cell-autonomously by Lmx1b through
Wnt1/3a/10b. However, we have not observed a repressive effect of Lmx1b.1 or
Lmx1b.2 on fgf8 in zebrafish.
Our results also indicate a fine degree of specificity in dorsoventral
patterning at the IsO. Morpholino knockdown of Lmx1b.1 and Lmx1b.2 affects
ventral expression of IsO genes more than dorsal expression. pax2.1,
pax2.2 and fgf8 expression was often lost throughout the MMR,
but in some cases, a variable amount of dorsal expression was retained. The
observed pattern of dorsal retention of IsO gene expression is also seen in
the fgf8 mutant acerebellar
(Pfeffer et al., 1998
), while
ventral retention is seen in the pax2.1 mutant noi
(Lun and Brand, 1998
). These
results indicate that maintenance of the IsO is controlled differently in
dorsal and ventral domains, although there is as yet no known mechanism that
regulates dorsoventral patterning of the MMR. Further studies of Lmx1b.1 and
Lmx1b.2 function at the IsO may help answer this and other questions
concerning patterning and cell fate decisions in the MMR.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
National Institute of Neurological Disorders and Stroke, National
Institutes of Health, Bethesda, MD 20892, USA ![]()
| REFERENCES |
|---|
|
|
|---|
Adams, K. A., Maida, J. M., Golden, J. A. and Riddle, R. D.
(2000). The transcription factor Lmx1b maintains Wnt1
expression within the isthmic organizer. Development
127,1857
-1867.[Abstract]
Alvarado-Mallart, R. M., Martinez, S. and Lance-Jones, C. C.
(1990). Pluripotentiality of the 2-day-old avian germinative
neuroepithelium. Dev. Biol.
139, 75-88.[CrossRef][Medline]
Bally-Cuif, L., Alvarado-Mallart, R. M., Darnell, D. K. and
Wassef, M. (1992). Relationship between
Wnt-1 and En-2 expression domains during early
development of normal and ectopic met-mesencephalon.
Development 115,999
-1009.[Abstract]
Brand, M., Heisenberg, C. P., Jiang, Y. J., Beuchle, D., Lun,
K., Furutani-Seiki, M., Granato, M., Haffter, P., Hammerschmidt, M., Kane, D.
A. et al. (1996). Mutations in zebrafish genes affecting the
formation of the boundary between midbrain and hindbrain.
Development 123,179
-190.[Abstract]
Buckles, G. R., Thorpe, C. J., Ramel, M.-C. and Lekven, A.
C. (2004). Combinatorial Wnt control of zebrafish
midbrain-hindbrain boundary formation. Mech. Dev.
121,437
-447.[CrossRef][Medline]
Chen, H., Lun, Y., Ovchinnikov, D., Kokubo, H., Oberg, K. C.,
Pepicelli, C. V., Gan, L., Lee, B. and Johnson, R. L.
(1998). Limb and kidney defects in Lmx1b mutant mice suggest an
involvement of LMX1B in human nail patella syndrome. Nat.
Genet. 19,51
-55.[CrossRef][Medline]
Cheng, L., Chen, C. L., Luo, P., Tan, M., Qiu, M., Johnson, R.
and Ma, Q. (2003). Lmx1b, Pet-1, and Nkx2.2
coordinately specify serotonergic neurotransmitter phenotype. J.
Neurosci. 23,9961
-9967.
Chi, C. L., Martinez, S., Wurst, W. and Martin, G. R.
(2003). The isthmic organizer signal FGF8 is required for cell
survival in the prospective midbrain and cerebellum.
Development 130,2633
-2644.
Crossley, P. H., Martinez, S. and Martin, G. R.
(1996). Midbrain development induced by FGF8 in the chick embryo.
Nature 380,66
-68.[CrossRef][Medline]
Crossley, P. H. and Martin, G. R. (1995). The
mouse Fgf8 gene encodes a family of polypeptides and is expressed in
regions that direct outgrowth and patterning in the developing embryo.
Development 121,439
-451.[Abstract]
Dickinson, M. E., Krumlauf, R. and McMahon, A. P.
(1994). Evidence for a mitogenic effect of Wnt-1 in the
developing mammalian central nervous system.
Development 120,1453
-1471.[Abstract]
Favor, J., Sandulache, R., Neuhauser-Klaus, A., Pretsch, W.,
Chatterjee, B., Senft, E., Wurst, W., Blanquet, V., Grimes, P., Sporle,
R. and Schughart, K. (1996). The mouse Pax2(1Neu) mutation is
identical to a human PAX2 mutation in a family with renal-coloboma syndrome
and result in developmental defects of the brain, ear, eye, and kidney.
Proc. Natl. Acad. Sci. USA
93,13870
-13875.
Funahashi, J., Okafuji, T., Ohuchi, H., Noji, S., Tanaka, H.
and Nakamura, H. (1999). Role of Pax-5 in the
regulation of a mid-hindbrain organizer's activity. Dev. Growth
Differ. 41,59
-72.[CrossRef][Medline]
Gardner, C. A. and Barald, K. F. (1991). The
cellular environment controls the expression of engrailed-like protein in the
cranial neuroepithelium of quail-chick chimeric embryos.
Development 113,1037
-1048.[Abstract]
German, M. S., Wang, J., Chadwick, R. B. and Rutter, W. J.
(1992). Synergistic activation of the insulin gene by a LIM-homeo
domain protein and a basic helix-loop-helix protein: building a functional
insulin minienhancer complex. Genes Dev.
6,2165
-2176.
German, M. S., Wang, J., Fernald, A. A., Espinosa, R., 3rd, Le
Beau, M. M. and Bell, G. I. (1994). Localization of
the genes encoding two transcription factors, LMX1 and CDX3, regulating
insulin gene expression to human chromosomes 1 and 13.
Genomics 24,403
-404.[CrossRef][Medline]
Heikinheimo, M., Lawshe, A., Shackleford, G. M., Wilson, D. B.
and MacArthur, C. A. (1994). Fgf-8 expression in the
post-gastrulation mouse suggests roles in the development of the face, limbs
and central nervous system. Mech. Dev.
48,129
-138.[CrossRef][Medline]
Hidalgo-Sanchez, M., Millet, S., Simeone, A. and
Alvarado-Mallart, R. M. (1999). Comparative analysis of
Otx2, Gbx2, Pax2, Fgf8 and Wnt1 gene expressions during the
formation of the chick midbrain/hindbrain domain. Mech.
Dev. 81,175
-178.[CrossRef][Medline]
Higashijima, S., Hotta, Y. and Okamoto, H.
(2000). Visualization of cranial motor neurons in live transgenic
zebrafish expressing green fluorescent protein under the control of the
islet-1 promoter/enhancer. J. Neurosci.
20,206
-218.
Iannotti, C. A., Inoue, H., Bernal, E., Aoki, M., Liu, L.,
Donis-Keller, H., German, M. S. and Permutt, M. A.
(1997). Identification of a human LMX1 (LMX1.1)-related gene,
LMX1.2: tissue-specific expression and linkage mapping on chromosome 9.
Genomics 46,520
-524.[CrossRef][Medline]
Itasaki, N., Ichijo, H., Hama, C., Matsuno, T. and Nakamura,
H. (1991). Establishment of rostrocaudal polarity in tectal
primordium: engrailed expression and subsequent tectal polarity.
Development 113,1133
-1144.[Abstract]
Jászai, J., Reifers, F., Picker, A., Langenberg, T. and
Brand, M. (2003). Isthmus-to-midbrain transformation in the
absence of midbrain-hindbrain organizer activity.
Development 130,6611
-6623.
Joyner, A. L. (1996). Engrailed, Wnt and Pax
genes regulate midbrainhindbrain development. Trends
Genet. 12,15
-20.[CrossRef][Medline]
Kelly, G. M. and Moon, R. T. (1995).
Involvement of wnt1 and pax2 in the formation of the
midbrain-hindbrain boundary in the zebrafish gastrula. Dev.
Genet. 17,129
-140.[CrossRef][Medline]
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and
Schilling, T. F. (1995). Stages of embryonic
development of the zebrafish. Dev. Dyn.
203,253
-310.[Medline]
Lee, S. M., Danielian, P. S., Fritzsch, B. and McMahon, A.
P. (1997). Evidence that FGF8 signalling from the
midbrain-hindbrain junction regulates growth and polarity in the developing
midbrain. Development
124,959
-969.[Abstract]
Lekven, A. C., Buckles, G. R., Kostakis, N. and Moon, R. T.
(2003). Wnt1 and wnt10b function redundantly at the zebrafish
midbrain-hindbrain boundary. Dev. Biol.
254,172
-187.[CrossRef][Medline]
Li, J. Y. and Joyner, A. L. (2001).
Otx2 and Gbx2 are required for refinement and not induction
of mid-hindbrain gene expression. Development
128,4979
-4991.
Liu, A. and Joyner, A. L. (2001). Early
anterior/posterior patterning of the midbrain and cerebellum. Annu.
Rev. Neurosci. 24,869
-896.[CrossRef][Medline]
Lun, K. and Brand, M. (1998). A series of no
isthmus (noi) alleles of the zebrafish pax2.1 gene reveals multiple signaling
events in development of the midbrain-hindbrain boundary.
Development 125,3049
-3062.[Abstract]
Marin, F. and Puelles, L. (1994). Patterning of
the embryonic avian midbrain after experimental inversions: a polarizing
activity from the isthmus. Dev. Biol.
163, 19-37.[CrossRef][Medline]
Martinez, S., Wassef, M. and Alvarado-Mallart, R. M.
(1991). Induction of a mesencephalic phenotype in the 2-day-old
chick prosencephalon is preceded by the early expression of the homeobox gene
En. Neuron 6,971
-981.[CrossRef][Medline]
Martinez, S., Marin, F., Nieto, M. A. and Puelles, L.
(1995). Induction of ectopic engrailed expression and fate change
in avian rhombomeres: intersegmental boundaries as barriers. Mech.
Dev. 51,289
-303.[CrossRef][Medline]
Martinez, S., Crossley, P. H., Cobos, I., Rubenstein, J. L. and
Martin, G. R. (1999). FGF8 induces formation of an
ectopic isthmic organizer and isthmocerebellar development via a
repressive effect on Otx2 expression.
Development 126,1189
-1200.[Abstract]
Matsunaga, E., Katahira, T. and Nakamura, H.
(2002). Role of Lmx1b and Wnt1 in mesencephalon
and metencephalon development. Development
129,5269
-5277.
McMahon, A. P. and Bradley, A. (1990). The
Wnt-1 (int-1) proto-oncogene is required for development of a large region of
the mouse brain. Cell
62,1073
-1085.[CrossRef][Medline]
Megason, S. G. and McMahon, A. P. (2002). A
mitogen gradient of dorsal midline Wnts organizes growth in the CNS.
Development 129,2087
-2098.
Meyers, E. N., Lewandoski, M. and Martin, G. R.
(1998). An Fgf8 mutant allelic series generated by Cre-
and Flp-mediated recombination. Nat. Genet.
18,136
-141.[CrossRef][Medline]
Millen, K. J., Wurst, W., Herrup, K. and Joyner, A. L.
(1994). Abnormal embryonic cerebellar development and patterning
of postnatal foliation in two mouse Engrailed-2 mutants.
Development 120,695
-706.[Abstract]
Millet, S., Bloch-Gallego, E., Simeone, A. and Alvarado-Mallart,
R. M. (1996). The caudal limit of Otx2 gene
expression as a marker of the midbrain/hindbrain boundary: a study using in
situ hybridisation and chick/quail homotopic grafts.
Development 122,3785
-3797.[Abstract]
Mohammadi, M., McMahon, G., Sun, L., Tang, C., Hirth, P., Yeh,
B. K., Hubbard, S. R. and Schlessinger, J. (1997).
Structures of the tyrosine kinase domain of fibroblast growth factor receptor
in complex with inhibitors. Science
276,955
-960.
Mullins, M. C., Hammerschmidt, M., Haffter, P. and
Nusslein-Volhard, C. (1994). Large-scale mutagenesis in the
zebrafish: in search of genes controlling development in a vertebrate.
Curr. Biol. 4,189
-202.[CrossRef][Medline]
Nakamura, H., Nakano, K. E., Igawa, H. H., Takagi, S. and
Fujisawa, H. (1986). Plasticity and rigidity of
differentiation of brain vesicles studied in quail-chick chimeras.
Cell Differ. 19,187
-193.[CrossRef][Medline]
Niss, K. and Leutz, A. (1998). Expression of
the homeobox gene GBX2 during chicken development. Mech.
Dev. 76,151
-155.[CrossRef][Medline]
Odenthal, J. and Nusslein-Volhard, C. (1998).
fork head domain genes in zebrafish. Dev. Genes
Evol. 208,245
-258.[CrossRef][Medline]
Panhuysen, M., Vogt Weisenhorn, D. M., Blanquet, V., Brodski,
C., Heinzmann, U., Beisker, W. and Wurst, W. (2004).
Effects of Wnt1 signaling on proliferation in the developing
mid-/hindbrain region. Mol. Cell. Neurosci.
26,101
-111.[CrossRef][Medline]
Pfeffer, P. L., Gerster, T., Lun, K., Brand, M. and Busslinger,
M. (1998). Characterization of three novel members of the
zebrafish Pax2/5/8 family: dependency of Pax5 and Pax8
expression on the Pax2.1 (noi) function. Development
125,3063
-3074.[Abstract]
Picker, A., Brennan, C., Reifers, F., Clarke, J. D., Holder, N.
and Brand, M. (1999). Requirement for the zebrafish
mid-hindbrain boundary in midbrain polarisation, mapping and confinement of
the retinotectal projection. Development
126,2967
-2978.[Abstract]
Puelles, L., Martin, F., Martinez de la Torre, M. and Martinez,
S. (1996). The midbrain-hindbrain junction: a model system
for brain regionalization through morphogenetic and neuroepithelial
interactions. In Mammalian Development, pp.173
-197. Newark, NJ: Gordon & Breach/Harwood
Academic Publishing.
Reifers, F., Bohli, H., Walsh, E. C., Crossley, P. H., Stainier,
D. Y. and Brand, M. (1998). Fgf8 is mutated in
zebrafish acerebellar (ace) mutants and is required for maintenance of
midbrain-hindbrain boundary development and somitogenesis.
Development 125,2381
-2395.[Abstract]
Riddle, R. D., Ensini, M., Nelson, C., Tsuchida, T., Jessell, T.
M. and Tabin, C. (1995). Induction of the LIM homeobox
gene Lmx1 by WNT7a establishes dorsoventral pattern in the vertebrate
limb. Cell 83,631
-640.[CrossRef][Medline]
Serbedzija, G. N., Dickinson, M. and McMahon, A. P.
(1996). Cell death in the CNS of the Wnt-1 mutant mouse.
J. Neurobiol. 31,275
-282.[CrossRef][Medline]
Shamim, H. and Mason, I. (1998). Expression of
Gbx-2 during early development of the chick embryo. Mech.
Dev. 76,157
-159.[CrossRef][Medline]
Shamim, H., Mahmood, R., Logan, C., Doherty, P., Lumsden, A.
and Mason, I. (1999). Sequential roles for Fgf4,
En1 and Fgf8 in specification and regionalisation of the
midbrain. Development
126,945
-959.[Abstract]
Simeone, A., Acampora, D., Massino, G., Stornaiuolo, A. and
Boncinelli, E. (1992). Nested expression domains of
four homeobox genes in the developing rostral brain.
Nature 358,687
-690.[CrossRef][Medline]
Smidt, M. P., Asbreuk, C. H., Cox, J. J., Chen, H., Johnson, R.
L. and Burbach, J. P. (2000). A second independent
pathway for development of mesencephalic dopaminergic neurons requires Lmx1b.
Nat. Neurosci. 3,337
-341.[CrossRef][Medline]
Torres, M., Gomez-Pardo, E. and Gruss, P.
(1996). Pax2 contributes to inner ear patterning and
optic nerve trajectory. Development
122,3381
-3391.[Abstract]
Thomas, K. R. and Capecchi, M. R. (1990).
Targeted disruption of the murine int-1 proto-oncogene resulting in severe
abnormalities in midbrain and cerebellar development.
Nature 346,847
-850.[CrossRef][Medline]
Tsuchida, T., Ensini, M., Morton, S. B., Baldassare, M., Edlund,
T., Jessell, T. M. and Pfaff, S. L. (1994).
Topographic organization of embryonic motor neurons defined by expression of
LIM homeobox genes. Cell
79,957
-970.[CrossRef][Medline]
Vogel, A., Rodriguez, C., Warnken, W. and Izpisua Belmonte, J.
C. (1995). Dorsal cell fate specified by chick Lmx1 during
vertebrate limb development. Nature
378,716
-720.[CrossRef][Medline]
Wassarman, K. M., Lewandoski, M., Campbell, K., Joyner, A.
L., Rubenstein, J. L., Martinez, S. and Martin, G. R.
(1997). Specification of the anterior hindbrain and establishment
of a normal mid/hindbrain organizer is dependent on Gbx2 gene
function. Development
124,2923
-2934.[Abstract]
Wassef, M. and Joyner, A. L. (1997). Early
mesencephalon/metencephalon patterning and development of the cerebellum.
Persp. Dev. Neuro. 5,3
-16.
Wilkinson, D. G., Bailes, J. A. and McMahon, A. P.
(1987). Expression of the proto-oncogene int-1 is restricted to
specific neural cells in the developing mouse embryo.
Cell 50,79
-88.[CrossRef][Medline]
Wurst, W., Auerbach, A. B. and Joyner, A. L.
(1994). Multiple developmental defects in Engrailed-1 mutant
mice: an early mid-hindbrain deletion and patterning defects in forelimbs and
sternum. Development
120,2065
-2075.[Abstract]
This article has been cited by other articles:
![]() |
Y. Mishima, A. G. Lindgren, V. V. Chizhikov, R. L. Johnson, and K. J. Millen Overlapping Function of Lmx1a and Lmx1b in Anterior Hindbrain Roof Plate Formation and Cerebellar Growth J. Neurosci., September 9, 2009; 29(36): 11377 - 11384. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Badde and D. Schulte A Role for Receptor Protein Tyrosine Phosphatase {lambda} in Midbrain Development J. Neurosci., June 11, 2008; 28(24): 6152 - 6164. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. V. Sillitoe and M. W. Vogel Desire, Disease, and the Origins of the Dopaminergic System Schizophr Bull, March 1, 2008; 34(2): 212 - 219. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Guo, H.-Y. Qiu, Y. Huang, H. Chen, R.-Q. Yang, S.-D. Chen, R. L. Johnson, Z.-F. Chen, and Y.-Q. Ding Lmx1b is essential for Fgf8 and Wnt1 expression in the isthmic organizer during tectum and cerebellum development in mice Development, January 15, 2007; 134(2): 317 - 325. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-L. Ang Transcriptional control of midbrain dopaminergic neuron development Development, September 15, 2006; 133(18): 3499 - 3506. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Alexandre, I. Bachy, M. Marcou, and M. Wassef Positive and negative regulations by FGF8 contribute to midbrain roof plate developmental plasticity Development, August 1, 2006; 133(15): 2905 - 2913. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||