|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 8 June 2005
doi: 10.1242/dev.01895
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1 Department of Biology, Faculty of Sciences, Kyushu University Graduate School,
Hakozaki, Fukuoka 812-8581, Japan
2 Department of Physiology, Tokyo Women's Medical University School of Medicine,
Kawada-cho, Shinjuku-ku, Tokyo 162-8666, Japan
Author for correspondence (e-mail:
ohshima{at}life.sojo-u.ac.jp)
Accepted 9 May 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Body size, MAP kinase, C. elegans, SMA-5
| Introduction |
|---|
|
|
|---|
C. elegans is an excellent model animal for studies on body size
control. The number of somatic nuclei is fixed at 959 in an adult
hermaphorodite, and their entire cell lineages were elucidated
(Sulston and Horvitz, 1977
).
There are many mutants with an abnormal body size or shape. For example,
several mutants in TGFß signaling factors such as DBL-1/CET-1 (ligand),
DAF-4 and SMA-6 (receptor), SMA-2, SMA-3 and SMA-4 (Smad transcriptional
factors) are small (Estevez et al.,
1993
; Savage et al.,
1996
; Krishna et al.,
1999
; Suzuki et al.,
1999
; Morita et al.,
1999
). We and others have shown that egl-4 mutants have a
larger body size (Daniels et al.,
2000
; Fujiwara et al.,
2002
; Hirose et al.,
2003
), and that the egl-4 gene encodes cyclic
GMP-dependent protein kinases (L'Etoile et
al., 2002
; Fujiwara et al.,
2002
; Hirose et al.,
2003
). We have developed methods to measure body volume, and to
analyze morphology and volume of major organs using a confocal microscope:
cell size in the major organs is increased in the egl-4 mutants,
while cell numbers are not. Genetic interaction studies strongly suggest that
the DBL-1/TGFß pathway functions downstream of EGL-4 for body size
control as the body size of a double mutant carrying egl-4 and
sma-6 or dbl-1 mutations is close to that of the single
small mutant (Hirose et al.,
2003
). In contrast to the egl-4 mutants, three small
mutants in the DBL-1 pathway have much smaller cell size and indistinguishable
cell numbers in major organs (Nagamatsu
and Ohshima, 2004
). We have also shown that cGMP downregulates
body size through EGL-4 (Nakano et al.,
2004
).
Here, we present studies on the sma-5 gene. Its mutant is very small, and has additional phenotypes that are not seen in the mutants of the DBL-1/TGFß signaling factors. Our findings, based on the identification of the sma-5 gene encoding a MAP kinase homolog, provide novel and interesting insights into the mechanisms that control body size.
| Materials and methods |
|---|
|
|
|---|
Measurement of body sizes
Total body volume, body length and diameters of a worm were measured as
described (Hirose et al.,
2003
), but only body volume is shown here.
Transgenic animals
Microinjection of DNA was carried out as described
(Mello et al., 1991
). Total
concentration of the DNA at injection was adjusted to 100 µg/ml. A
pPDW06-1a, pPDW06-9 or pPDW06-c GFP reporter construct was injected alone at
100 µg/ml into sma-5 mutant animals, and at 50 µg/ml with 50
µg/ml of Bluescript SK+ into N2. Plasmid DNAs or PCR fragments for organ
size analysis or rescue were injected at 50 µg/ml together with 50 µg/ml
of kin-8::gfp (Koga et al.,
1999
) as a marker, at 50 µg/ml of dss-1p::gfp or 20
µg/ml of col-19p::gfp (Hirose
et al., 2003
) with 30 µg/ml of Bluescript SK+.
PCR fragments and plasmid construction
W06B3.2 PCR fragments of 6.7 kb used for rescue were amplified with
pfu-turbo polymerase kit (Stratagene) with the primers W06B3.2-sense
(AACGTGTACGGAACCGGAAA) and W06B3.2-3'UTR4 (TCTGAGTTCACTACGTCTGC) from
the wild-type genome. The PCR fragments contain the entire coding region of
W06B3.2, a promoter region of 1.6 kb for W06B3.2c and a 3' untranslated
region of 1.8 kb. They were purified by QIAquick PCR Purification Kit
(Qiagen).
We prepared three types of gene fusions of GFP and W06B3.2. pPDW06-1a, which is practically a promoter fusion, was prepared by amplifying 1.6 kb sequence upstream of the predicted initiation codon and 14 bp of coding sequence of W06B3.2c. For pPDW06-9, 1.6 kb upstream sequence and the entire coding region of W06B3.2a/c were amplified as above. A PstI site and a SalI site engineered into PCR primers were used to insert the amplified products into the GFP vector pPD95.77 (A. Fire). pPDW06-c was prepared by amplifying 4.9 kb sequence upstream of the 5' UTR region of W06B3.2a (exon-1). A PstI site engineered into PCR primers were used to insert the amplified products into the GFP vector pPD95.75.
The promoters used in tissue-specific expression of sma-5 cDNA
included dss-1p (for intestine)
(Hirose et al., 2003
),
vha-1p (for excretory cell) (Oka
et al., 1997
), vha-7p (for hypodermis)
(Oka et al., 2001
) and 1.6 kb
sma-5 promoter for W06B3.2c as a control. The entire coding region
except for termination codon of a sma-5 cDNA corresponding to
W06B3.2c was amplified by PCR with yk506c3 clone (Y. Kohara) as the template.
The cDNA and each of the promoters were inserted into vector pPD49.26 (A.
Fire) with one of the following primer sets: dss-1p-f,
5'-TTCTGCAGGCTCCGAGGACGAGGAGAAA-3'; dss-1p-b,
5'-TTCTGCAGTTCGACTGGAAATAGGCTGA-3'; vha-1p-f,
5'-TTCTGCAGCGAAGAGGATCCGTTT-3'; vha-1p-b,
5'-TTCTGCAGACCTGAAACATCTGAGTG-3'; vha-7p-f,
5'-AAAACTGCAGCGACAGGAAATTGTGAGAAG-3'; vha-7p-b,
5'-AAAACTGCAGCAGATTACGTCGTTGGTGGA-3'; sma-5p-f,
5'-AAAACTGCAGCCAAGTTGGCGGAAAGAGC-3'; sma-5p-b,
5'-AAAACTGCAGTGATGTGATGGGATCCTTTG-3'.
For amplification by PCR, an ExTaq kit (Takara) was used. A PstI site and a SalI site engineered into PCR primers were used to insert the amplified products into the GFP vector pPD95.77.
Alignment of SMA-5
A homology search was carried out at
http://blast.genome.ad.jp/,
and alignment was done on the web site
http://npsa-pbil.ibcp.fr/cgibin/npsa_automat.pl?page=npsa_clustalw.html.
Measurement of organ sizes
Volumes of hypodermis, intestine or muscles of worms shown in
Table 1 were obtained by YN
with analysis of transgenic worms expressing GFP specifically in each organ
with Zeiss LSM-410 confocal microscope, as described
(Hirose et al., 2003
). To
express GFP in hypodermis, intestine and muscles, col-19p::gfp,
dss-1p::gfp and myo-3p::gfp, respectively, were introduced to
sma-5(n678) mutant in this study, as carried out for N2 and
egl-4 mutants previously (Hirose
et al., 2003
). Intestinal or hypodermal volume measurement shown
in Fig. 7 was carried out
essentially as described previously
(Hirose et al., 2003
), but
using Zeiss LSM-510 (NLO) laser-scanning fluorescent microscope equipped with
Zeiss Axiovert 200M microscope using 488 nm Ar laser with 50-60% output and
10-50% transmission depending on fluorescent intensity of the sample.
PlanApochromat 20x/0.75 objective lens was used. Detector gain values
used for the measurement were adjusted by adding 100-140 to, and depending on,
the values indicated by Find menu so as to get consistent volumes obtained by
LSM-410 or body volumes obtained as described before. Amplitude offset
parameter was chosen so as to remove the black image background completely
using Range indicator. Images of 512x512 pixels were obtained at 1 µm
intervals. Other procedures were as described previously. Transgenic lines
used for measurement were obtained as described by Nakano et al.
(Nakano et al., 2004
).
|
Analysis of protein contents
Total protein contents of 2-day-old animals of the wild type and the
sma-5 mutant were measured as described
(Nagamatsu and Ohshima,
2004
).
|
| Results |
|---|
|
|
|---|
Identification of the sma-5 gene
sma-5(n678) had been mapped to a region of 0.6 map unit on
chromosome X, right of mes-1 and left of or near nuc-1
(http://www.wormbase.org/
and Fig. 3A). Based on this
information, we injected YAC and cosmid DNA clones, and found that YAC Y75H1
and cosmid R03B7 (Fig. 3A) could rescue its abnormal phenotypes of the sma-5 mutant
(Fig. 1C; data not shown).
R03B7 contains four genes (Fig.
3). Among them, only W06B3.2 (PCR fragments of 6.7 kb) rescued the
abnormal phenotypes of sma-5 (Fig.
2).
|
|
|
Expression patterns of the sma-5 gene
To examine the expression pattern of the sma-5 gene, we prepared
three GFP reporter constructs. pPDW06-1a expresses a GFP fusion with
N-terminal five amino acids of W06B3.2a/c under a control of promoter for
W06B3.2c of 1.6 kb. GFP expression was found in intestine
(Fig. 5A,C,E,F) and excretory
cell (Fig. 5E,F), in all stages
of a transgenic line carrying extrachromosomal arrays of pPDW06-1a. In the
intestine, the four most anterior cells show stronger GFP expression, although
entire intestine is fluorescent. The expression in the excretory cell
(White, 1988
) was confirmed by
comparison with the expression pattern of vha-1p::gfp that is
predominantly expressed in the excretory cell
(Oka et al., 1997
). GFP in the
excretory cell is seen continuously along the lateral lines for most of the
length of the worm (data not shown). Weak expression in hypodermis is also
seen (Fig. 5F). A second GFP
fusion construct pPDW06-9, which contains the same promoter for W06B3.2c and
the entire genomic region of W06B3.2a/c except for the termination codon,
rescued the phenotypes of the sma-5 mutant, and looks to be expressed
in the same regions as was pPDW06-1a (Fig.
5D for intestinal expression). This fusion protein is localized
throughout the intestine. The third construct pPDW06-c carries the 4.9 kb
sequence upstream of exon 1 and a GFP gene. GFP in this promoter fusion is
expressed in hypodermis and pharynx (Fig.
5G,H).
Sizes of major organs and their cells of the sma-5 (n678) mutant
Because the sma-5 mutant has a markedly reduced body size in
adults, the number or the size of cells in major organs is probably decreased.
We analyzed morphology of three major organs in the adults. To do this, a
whole transgeneic animal expressing GFP specifically in intestine, hypodermis
or muscles was examined using a confocal laser-scanning microscope. Based on a
series of sectional fluorescent images, a 3D image was reconstructed and its
volume was calculated with an image-processing system, as described in the
Materials and methods. Fig. 6
shows examples of 3D images of these organs in the sma-5(n678)
mutant. The morphology of hypodermis, intestine and muscles in 2-day-old
adults of the sma-5 mutant looked normal when compared with those of
the wild type that were described earlier
(Hirose et al., 2003
).
Results of volume measurement are presented in
Table 1. The numbers of cells
or nuclei in these organs were also measured
(Table 2). The volume of whole
intestine decreased to 23% of the wild-type value in the sma-5
mutant. Although the average number of intestinal nuclei slightly decreased in
the mutant, the number of intestinal cells was the same as that of the wild
type (Table 2). Therefore,
intestinal cells in the sma-5 mutant must be much smaller than those
in the wild type. The number of intestinal nuclei was recovered to nearly the
same as that of the wild type by introduction of the sma-5 gene
(Table 2). The volume of
hypodermis decreased to 46% in the mutant. Most of the hypodermis is occupied
by a single, giant syncytium hyp7 that covers the nearly entire body and
contains 133 nuclei out of the 188 hypodermal nuclei in total
(White, 1988
). In the
sma-5 mutant, therefore, the volume of this hyp7 syncytium should be
decreased approximately to half. Although the number of hypodermal seam cells
in the sma-5 mutant is very close to that in the wild type, the
number of total hypodermal nuclei in the mutant is decreased to 76% of that of
the wild type (Table 2). Volume
of the muscles expressing myo-3p::gfp (body wall muscles, vulval,
uterine and intestine-associated muscles)
(Okkema et al., 1993
) was
decreased to 43% of that of the wild type
(Table 1). A great majority of
those muscle cells consist of body wall muscle cells, and their number was not
changed in the mutant (Table
2). These results suggest that the sma-5 mutant has the
same number of cells, and that the cell size is much smaller.
|
|
|
Analysis of DNA content and total protein content
To elucidate the mechanisms of cell size decrease in the sma-5
mutant, we have analyzed chromosomal ploidies and total protein content in the
wild type and the mutant. Chromosomal ploidy is a well known, universal
control factor for cell size (Conlon and
Raff, 1999
). For analysis of chromosomal ploidy, we examined
intestinal and neuronal nuclei of worms stained with
4',6-diamidino-2-phenylindole (DAPl) as described in the Materials and
methods. Intestinal nuclei in the wild-type C. elegans become 32C by
the adult stage, which is the highest ploidy in the wild type, while neuronal
nuclei remain diploid (Hedgecock and
White, 1985
). In addition, intestinal cells show the greatest
volume reduction in the sma-5 mutant. Thus, chromosomal ploidy in
intestine of the sma-5 mutant could possibly be less in the
sma-5 mutant than those in the wild type. Average intestinal
chromosomal ploidy of the sma-5 mutant adult was estimated to be 34,
assuming that neuronal nuclei are diploid (as in the wild type) and the value
in the wild type was 35. Because these values are very close, we conclude that
intestinal chromosomal ploidy is not changed in the sma-5 mutant.
We were also interested to know whether the level of general gene expression is altered in this mutant. Total protein content of a worm should be a good measure of the level of general gene expression. Indeed, the protein content of the sma-5 mutant was only 18% of that of the wild type (0.16 compared with 0.88 µg/worm).
| Discussion |
|---|
|
|
|---|
|
sma-5 functions in post-embryonic development
We measured the volume of eggs (embryos) laid by wild-type and the
sma-5(n678) mutant. There was little difference between them (both
were
0.03 nl). In addition, there was little difference in morphology and
volume of L1 larvae about 2 hours after hatch between them.
sma-5::gfp was expressed in some embryos, but it is not clear whether
sma-5 expression is necessary for embryonic development.
sma-5::gfp expression is seen in all larval stages, which suggests
that it is required for normal larval development from L1 stage.
The sma-5 gene regulates body size mainly through control of cell growth
BMK1/ERK5/MAPK7 is the newest subfamily of the MAP kinase family in
mammals, and it has some characteristic features: a large C-terminus and a
unique loop 12 sequence (Lee et al.,
1995
). Mammalian BMK1/ERK5 was shown to be activated by oxidative
stress, hyperosmolarity and several growth factors, including epidermal growth
factor and nerve growth factor (Abe et al.,
1996
; Chao et al.,
1999
; Lee et al.,
1995
; Zhou et al.,
1995
; Kato et al.,
1998
; Kamakura et al.,
1999
). It has also been reported that BMK1/ERK5 regulates cell
proliferation and cell cycle in cultured cells
(Kato et al., 1998
;
Chao et al., 1999
). Recent
reports have demonstrated that the homozygous deletion of BMK1/ERK5 results in
embryonic lethality in mice with extra-embryonic vascular and embryonic
cardiovascular defects (Regan et al.,
2002
; Sohn et al.,
2002
).
As the sma-5 mutant has significantly smaller but
indistinguishable numbers of cells, we propose that SMA-5 regulates body size
mainly through control of cell growth. Measurement of embryonic size described
in the Results and growth curves shown in
Fig. 2 for larvae and adults
suggest that embryonic cell sizes in the sma-5 mutant are similar to
those of the wild type. They also suggest that cell growth in the mutant is
much slower in larval development so that cell proliferation is slower and
that final cell sizes are smaller. The results of measurement of hypodermal
and intestinal nuclear numbers suggest that SMA-5 also has a limited function
in nuclear proliferation in these organs. As postembryonic hypodermal nuclei
in the large hyp7 syncytium are born by fusion with postembryonic hypodermal
cells, SMA-5 has also a function in cell proliferation. Thus, the function of
SMA-5 in C. elegans seems to be somewhat different from that of
BMK1/ERK5 in mammalian cells, but has a common function in cell proliferation.
It is not clear whether BMK1/ERK5 controls body size in mammals because the
knockout mice are lethal (Regan et al.,
2002
; Sohn et al.,
2002
). By contrast, the tm448 mutant carrying a large deletion in
the sma-5 gene should be a null mutant, but it is viable and has
quite similar characteristics as the sma-5(n678) mutant. Thus, our
results indicating the function of SMA-5 in body size control are novel and
interesting.
Site and mode of action of the sma-5 gene
Based on the results presented in Fig.
7, the hypodermis seems to be the most important site of
sma-5 gene expression for the control of body and organ size.
Although promoter for W06B3.2c drives only weakly visible expression in
hypodermis, the far upstream promoter for W06B3.2a probably makes the
expression stronger for the endogenous sma-5 gene. The importance of
hypodermal expression for body size control was also reported previously for
sma-6 (Yoshida et al.,
2001
), sma-3 (Wang et
al., 2002
) and egl-4
(Nakano et al., 2004
).
Although expression of sma-5 in the excretory cell may be
interesting, we do not have any evidence to see whether the same mechanism
works there as in hypodermis. Because the expression in hypodermis increases
hypodermal volume, and both expression in hypodermis and that in excretory
cell increase intestinal volume, the sma-5 gene can function both
organ- or cell-autonomously and non-autonomously, as has been shown for the
egl-4 gene (Nakano et al.,
2004
). The reason why intestinal expression of the cDNA failed to
increase intestinal volume is not clear.
Conserved features of body size control in C. elegans
We notice two conserved characteristics in the body size mutants in C.
elegans so far analyzed. First, little or no changes in cell numbers from
those in the wild type are seen in the sma-5 mutant analyzed here
the three small mutants of the DBL-1/TGFß pathway and a
sma-1 mutant (Nagamatsu and
Ohshima, 2004
), as well as egl-4 large mutants
(Hirose et al., 2003
). These
results may be related to the small number of somatic cells and rather rigid
cell lineages in C. elegans
(Sulston and Horvitz, 1977
),
and may suggest that a mutation leading to a significant change in the overall
cell number is hard to obtain or is lethal. Although extra cell divisions were
observed in cul-1/lin-19 or lin-23 mutants, they are lethal
or sterile (Kipreos et al.,
1996
; Kipreos et al.,
2000
). To examine these ideas, further efforts will be required to
obtain body size mutants in which cell number is significantly altered.
Second, protein contents are decreased in all the small mutants analyzed
roughly in proportion to their reduced body size (this report)
(Nagamatsu and Ohshima, 2004
).
We propose that the level of general protein expression has an important
relation to the cell size in C. elegans. A close link between cell
size and protein and ribosome synthesis has been suggested in yeast and other
organisms (Jorgensen et al.,
2002
; Saucedo and Edgar,
2002
).
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Abe, J., Kusuhara, M., Ulevitch, R. J., Berk, B. C. and Lee, J.
D. (1996). Big mitogen-activated protein kinase 1 (BMK1) is a
redox-sensitive kinase. J. Biol. Chem.
271,16586
-16590.
Bevington, P. R. and Robinson, D. K. (2003). In Data Reduction and Error Analysis for Physical Sciences, 3rd edn, Chapter 3, p. 41. New York: McGraw-Hill.
Böhni, R., Riesgo-Escovar, J., Oldham, S., Brogiolo, W., Stocker, H., Andruss, B. F., Beckingham, K. and Hafen, E. (1999). Autonomous control of cell and organ size by CHICO, a Drosophila homolog of vertebrate IRS1-4, Cell 97,865 -875.[CrossRef][Medline]
Brenner, S. (1974). The genetics of
Caenorhabditis elegans. Genetics
77, 71-94.
Brock, D. A. and Gomer, R. H. (1999). A
cell-counting factor regulating structure size in Dictyostelium.Genes Dev. 13,1960
-1969.
Chao, T. H., Hayashi, M., Tapping, R. I., Kato, Y. and Lee, J.
D. (1999). MEKK3 directly regulates MEK5 activity as part of
the big mitogen-activated protein kinase 1 (BMK1) signaling pathway.
J. Biol. Chem. 274,36035
-36038.
Conlon, I. and Raff, M. (1999). Size control in animal development. Cell 96,235 -244.[CrossRef][Medline]
Daniels, S. A., Ailion, M., Thomas, J. H. and Sengupta, P.
(2000). egl-4 acts through a transforming growth
factor-ß/SMAD pathway in Caenorhabditis elegans to regulate
multiple neuronal circuits in response to sensory cues.
Genetics 156,123
-141.
Estevez, M., Attisano, L., Wrana, J. L., Albert, P. S., Massague, J. and Riddle, D. L. (1993). The daf-4 gene encodes a bone morphogenetic protein receptor controlling C. elegans dauer larva development. Nature 365,644 -649.[CrossRef][Medline]
Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E. and Mello, C. C. (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.Nature 391,806 -811.[CrossRef][Medline]
Fujiwara, M., Sengupta, P. and McIntire, S. L. (2002). Regulation of body size and behavioral state of C. elegans by sensory perception and EGL-4 cGMP-dependent protein kinase. Neuron 36,1091 -1102.[CrossRef][Medline]
Gengyo-Ando, K. and Mitani, S. (2000). Characterization of mutations induced by ethyl methanesulfonate, UV, and trimethylpsoralen in the nematode Caenorhabditis elegans. Biochem. Biophys. Res. Commun. 269,64 -69.[CrossRef][Medline]
Hedgecock, E. M. and White, J. G. (1985). Polyploid tissues in the nematode Caenorhabditis elegans. Dev. Biol. 107,128 -133.[CrossRef][Medline]
Hirose, T., Nakano, Y., Nagamatsu, Y., Misumi, T., Ohta, H. and
Ohshima, Y. (2003). Cyclic GMP-dependent protein
kinase EGL-4 controls body size and lifespan in C. elegans.Development 130,1089
-1099.
Jorgensen, P., Nishikawa, J. L., Breitkreutz, B. J. and Tyers, M. (2002). Systematic identification of pathways that couple cell growth and division in yeast. Science 294,395 -400.[CrossRef]
Kamakura, S., Moriguchi, T. and Nishida, E.
(1999). Activation of the protein kinase ERK5/BMK1 by receptor
tyrosine kinases. J. Biol. Chem.
274,26563
-26571.
Kato, Y., Tapping, R. I., Huang, S., Watson, M. H., Ulevitch, R. J. and Lee, J. D. (1998). Bmk1/Erk5 is required for cell proliferation induced by epidermal growth factor. Nature 395,713 -716.[CrossRef][Medline]
Kipreos, E. T., Lander, L. E., Wing, J. P., He, W. W. and Hedgecock, E. M. (1996). cul-1 is Required for cell cycle exit in C. elegans and identifies a novel gene family. Cell 85,829 -839.[CrossRef][Medline]
Kipreos, E. T., Gohel, S. P. and Hedgecock, E. M. (2000). The C. elegans F-box/WD-repeat protein LIN-23 functions to limit cell division. Development 127,5071 -5082.[Abstract]
Koga, M., Take-uchi, M., Tameishi, T. and Ohshima, Y. (1999). Control of DAF-7 TGF-ß expression and neuronal process development by a receptor tyrosine kinase KIN-8 in Caenorhabditis elegans. Development 126,5387 -5398.[Abstract]
Krishna, S., Maduzia, L. L. and Padgett, R. W. (1999). Specificity of TGFß signaling is conferred by distinct type I receptors and their associated SMAD proteins in Caenorhabditis elegans. Development 126,251 -260.[Abstract]
Lee, J. D., Ulevitch, R. J. and Han, J. (1995). Primary structure of BMK1: a new mammalian map kinase. Biochem. Biophys. Res. Commun. 213,715 -724.[CrossRef][Medline]
Leevers, S. J., Weinkove, D., MacDougall, L. K., Hafen, E. and Waterfield, M. D. (1996). The Drosophila phosphoinositide 3-kinase Dp110 promotes cell growth. EMBO J. 15,6584 -6594.[Medline]
L'Etoile, N. D., Coburn, C. M., Eastham, J., Kistler, A., Gallegos, G. and Bargmann, C. I. (2002). The cyclic GMP-dependent protein kinase EGL-4 directs olfactory adaptation in C. elegans. Neuron 36,1079 -1089.[CrossRef][Medline]
Massague, J. (2000). How cells read TGF-ß signals. Nat. Rev. Mol. Cell. Biol. 1, 169-178.[CrossRef][Medline]
Mello, C. C., Kramer, J. M., Stinchcomb, D. and Ambros, V. (1991). Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10,3959 -3970.[Medline]
Mitani, S. (1995). Genetic regulation of mec-3 gene expression implicated in the specification of the mechanosensory neuron cell types in Caenorhabditis elegans. Dev. Growth Diff. 37,551 -557.[CrossRef]
Morita, K., Chow, K. L. and Ueno, N. (1999). Regulation of body length and male tail ray pattern formation of Caenorhabditis elegans by a member of TGF-ß family. Development 126,1337 -1347.[Abstract]
Nagamatsu, Y. and Ohshima, Y. (2004).
Mechanisms for the control of body size by a G-kinase and a downstream
TGFß signal pathway in Caenorhabditis elegans. Genes
Cells 9,39
-47.
Nakano, Y., Nagamatsu, Y. and Ohshima, Y.
(2004). cGMP and a germ-line signal control body size in C.
elegans through cGMP-dependent protein kinase EGL-4. Genes
Cells 9,773
-779.
Oka, T., Yamamoto, R. and Futai, M. (1997).
Three vha genes encode proteolipids of Caenorhabditis
elegans vacuolar-type ATPase. J. Biol. Chem.
272,24387
-24392.
Oka, T., Toyomura, T., Honjo, K., Wada, Y. and Futai, M.
(2001). Four subunit a isoforms of Caenorhabditis
elegans vacuolar H+-ATPase. Cell-specific expression during development.
J. Biol. Chem. 276,33079
-33085.
Okkema, P. G., Harrison, S. W., Plunger, V., Aryana, A. and Fire, A. (1993). Sequence requirements for myosin gene expression and regulation in Caenorhabditis elegans.Genetics 135,385 -404.[Abstract]
Palmiter, R. D., Brinster, R. L., Hammer, R. E., Trumbauer, M. E., Rosenfeld, M. G., Birnberg, N. C. and Evans, R. M. (1982). Dramatic growth of mice that develop from eggs microinjected with metallothionein-growth hormone fusion genes. Nature 300,611 -615.[CrossRef][Medline]
Patterson, G. I. and Padgett, R. W. (2000). TGF ß-related pathways. Roles in Caenorhabditis elegans development. Trends Genet. 16,27 -33.[CrossRef][Medline]
Regan, C. P., Li, W., Boucher, D. M., Spatz, S., Su, M. S. and
Kuida, K. (2002). Erk5 null mice display multiple
extraembryonic vascular and embryonic cardiovascular defects. Proc.
Natl. Acad. Sci. USA 99,9248
-9253.
Saucedo, L. J. and Edgar, B. A. (2002). Why size matters: altering cell size. Curr. Opin. Genet. Dev. 12,565 -571.[CrossRef][Medline]
Savage, C., Das, P., Finelli, A. L., Townsend, S. R., Sun, C.
Y., Baird, S. E. and Padgett, R. W. (1996).
Caenorhabditis elegans genes sma-2, sma-3, and
sma-4 define a conserved family of transforming growth factor ß
pathway components. Proc. Natl. Acad. Sci. USA
93,790
-794.
Sohn, S. J., Sarvis, B. K., Cado, D. and Winoto, A.
(2002). ERK5 MAPK regulates embryonic angiogenesis and acts as a
hypoxia-sensitive repressor of vascular endothelial growth factor expression.
J. Biol. Chem. 277,43344
-43351.
Sulston, J. E. and Horvitz, H. R. (1977). Post-embryonic cell lineages of the nematode, Caenorhabditis elegans.Dev. Biol. 56,110 -156.[CrossRef][Medline]
Sulston, J. and Hodgkin, J. (1988). Methods. In The Nematode Caenorhabditis elegans (ed. W. B. Wood and the Community of C. elegans Researchers), pp.587 -606. Cold Spring Harbor: Cold Spring Harbor Laboratory.
Suzuki, Y., Yandell, M. D., Roy, P. J., Krishna, S., Savage-Dunn, C., Ross, R. M., Padgett, R. W. and Wood, W. B. (1999). A BMP homolog acts as a dose-dependent regulator of body size and male tail patterning in Caenorhabditis elegans.Development 126,241 -250.[Abstract]
Take-uchi, M., Kawakami, M., Ishihara, T., Amano, T., Kondo, K.
and Katsura, I. (1998). An ion channel of the
degenerin/epithelial sodium channel superfamily controls defecation rhythm in
Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA
95,11775
-11780.
Wang, J., Tokarz, R. and Savage-Dunn, C.
(2002). The expression of TGFß signal transducers in the
hypodermis regulates body size in C. elegans.Development 129,4989
-4998.
White, J. (1988). The anatomy. In The Nematode Caenorhabditis elegans (ed. W. B. Wood and the Community of C. elegans Researchers), pp.81 -122. Cold Spring Harbor: Cold Spring Harbor Laboratory.
Yoshida, S., Morita, K., Mochii, M. and Ueno, N. (2001). Hypodermal expression of Caenorhabditis elegans TGF-ß type I receptor SMA-6 is essential for the growth and maintenance of body length. Dev. Biol 240, 32-45.[CrossRef][Medline]
Zhou, G., Bao, Z. Q. and Dixon, J. E. (1995).
Components of a new human protein kinase signal transduction pathway.
J. Biol. Chem. 270,12665
-12669.
This article has been cited by other articles:
![]() |
C. Mulder, J. Hendriks, R. Baerselman, and L. Posthuma Age Structure and Senescence in Long-Term Cohorts of Eisenia andrei (Oligochaeta: Lumbricidae) J. Gerontol. A Biol. Sci. Med. Sci., December 1, 2007; 62(12): 1361 - 1363. [Full Text] [PDF] |
||||
![]() |
N. Watanabe, T. Ishihara, and Y. Ohshima Mutants carrying two sma mutations are super small in the nematode C. elegans Genes Cells, May 1, 2007; 12(5): 603 - 609. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Aberg, M. Perander, B. Johansen, C. Julien, S. Meloche, S. M. Keyse, and O.-M. Seternes Regulation of MAPK-activated Protein Kinase 5 Activity and Subcellular Localization by the Atypical MAPK ERK4/MAPK4 J. Biol. Chem., November 17, 2006; 281(46): 35499 - 35510. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||