|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 15 June 2005
doi: 10.1242/dev.01892
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1 Department of Biological Science and Technology, Faculty of Engineering,
University of Tokushima, 2-1 Minami-Jyosanjima, Tokushima 770-8506,
Japan
2 Division of Neurobiology and Bioinformatics, National Institute for
Physiological Sciences, Okazaki 444-8787, Japan
Author for correspondence (e-mail:
hohuchi{at}bio.tokushima-u.ac.jp)
Accepted 9 May 2005
| SUMMARY |
|---|
|
|
|---|
(Tgfa), previously reported to be crucial for eyelid development, is
down-regulated in the mutant leading edge, while the onset of sonic hedgehog
(Shh) expression is delayed on the mutant eyelid margin. Explant
cultures of mouse eyelid primordia shows that the open-eyelid phenotype of the
mutant is reduced by exogenous FGF10 protein, and that the expression of
ActßB and Tgfa is ectopically induced in the
thickened eyelid epithelium by the FGF10 protein. These results indicate a
dual role of FGF10 in mouse eyelid development, for both proliferation and
coordinated migration of eyelid epithelial cells by reorganization of the
cytoskeleton, through the regulation of activin, TGF
and SHH
signaling.
Key words: Fgf10, Shh, activin ßB, Tgfa, periderm, mesenchyme, epidermis, mouse, eyelid development, leading edge, cell migration
| Introduction |
|---|
|
|
|---|
The developing eyelids are composed of loose mesenchyme covered by an
epithelial sheet, the epidermis (outer surface) and conjunctiva (inner
surface) and the periderm, which covers the epidermis
(Weiss and Zelickson, 1975
).
Only the peridermal and epidermal layers are involved in eyelid fusion; the
mesenchymal layers of the upper and lower eyelids remain separate
(Pei and Rhodin, 1970
). A
profusion of rounded periderm cells appears, and they pile up at the leading
edges of the advancing eyelids during eyelid growth
(Harris and McLeod, 1982
;
Harris and Juriloff, 1986
;
Juriloff and Harris, 1989
).
Once contact is made between the apposed eyelids, these cells flatten and form
a strip along the fusion line, until they slough off with the rest of the
periderm on day 17 of gestation (Harris and
Juriloff, 1986
; Juriloff and
Harris, 1989
; Findlater et al.,
1993
).
Failure of the eyelids to grow across the eye and fuse during the fetal
stage in mice leads to a birth defect of open-eyelids at birth. Mutations at
several distinct loci have been found to cause such open-eyelids, often as
part of a syndrome with other defects. For example, open-eyelids results from
spontaneous or gene-knockout mutation at the loci of transforming growth
factor
(Tgfa), its receptor epidermal growth factor receptor
(Egfr), activin/inhibin ßB (Inhbb Mouse Genome
Informatics) fibroblast growth factor receptor type 2b (Fgfr2b),
Jun, MEK kinase 1 and some forkhead genes
(Luetteke et al., 1993
;
Mann et al., 1993
; Miettinen
et al., 1999; Thereadgill et al., 1995;
Vassalli et al., 1994
;
Celli et al., 1998
;
De Moerlooze et al., 2000
;
Li et al., 2001
;
Li et al., 2003
;
Zenz et al., 2003
;
Zhang et al., 2003
;
Kume et al., 1998
;
Uda et al., 2004
). However,
the molecular and cellular events occurring during eyelid development and the
interactions among the signaling molecules have not been fully elucidated. We
previously reported briefly that Fgf10-null mice exhibit open-eyelids
at birth with multi-organ developmental defects
(Sekine et al., 1999
;
Ohuchi et al., 2000
). Here, we
report the expression pattern of Fgf10 during eyelid formation and
the phenotype of Fgf10-null eyelids in detail. We found that FGF10 is
dually required for proliferation and coordinated migration of epithelial
cells during mouse eyelid development by reorganization of the cytoskeleton,
through the regulation of activin, TGF
and SHH signaling.
| Materials and methods |
|---|
|
|
|---|
5
for each genotype and stage). For analysis of the normal expression patterns
of Fgf10 and other genes, the heads of Slc:ddy mice (no
pigment in the eye) (Japan SLC, Inc.) were used at the desired stages
(n=3 for each stage).
Histology and electron microscopy
For histological analysis, Hematoxylin and Eosin (HE) staining was
performed according to the standard procedure.
The Fgf10+/+, Fgf10+/ and
Fgf10/ embryos at around E15 and E16
(n=3
6 for each genotype and stage) were fixed in 4%
paraformaldehyde (PFA)/5% glutaraldehyde/PBS (10 mM phosphate-buffered saline)
overnight and processed for scanning or transmission electron microscopy
observation according to standard procedures.
In situ hybridization
Normal and Fgf10/ mutant embryos at the
desired stages were fixed in 4% PFA in PBS overnight and used for in situ
hybridization. Digoxigenin-labeled riboprobes for mouse Fgf10, Shh
(Sekine et al., 1999
), Patched
(Ptch1), Ptch2 (Motoyama
et al., 1998
) and activin ßB (provided by Dr Tsuchida,
University of Tokushima, Japan) were prepared as described. The mouse
Tgfa cDNA (Tgfa; 2578 bp) was isolated by RT-PCR using E18.5
mouse whisker mRNA. The PCR primers were as follows: the sense primer was
5'-tgtgtctgccactctgggtacgtg-3' and the antisense primer was
5'-aacgcagcagggctgtcatacgtc-3'. Sense probes were used as a
control and produced virtually no signals. Whole-mount in situ hybridization
was performed as previously described (Tao
et al., 2002
). Section in situ hybridization was performed on
18-µm thick frozen sections according to standard procedures, or by using a
tyramide signal amplification method on 7-µm thick paraffin sections
(Yang et al., 1999
). The gene
expression patterns were compared between littermates, and the in situ
hybridization experiment was repeated at least three times for each gene.
RT-PCR
Total RNA was isolated from the back skin (of normal E18.5 mice), wild-type
and Fgf10-null keratinocytes (at E18.5) and eyelid mesenchyme [of
normal mice at E15, treated with Dispase II (Roche) to remove epithelial
tissues] by using an RNAqueous Kit (Ambion). To prevent contamination of the
genomic DNA, the samples were treated with RNase-free DNase (Promega). The
DNase was subsequently inactivated at 70°C for 5 minutes, and the samples
were subjected to chloroform/phenol extraction and ethanol precipitation.
Reverse transcription (RT) was carried out using 1 µg of total RNA,
Superscript II reverse transcriptase (Invitrogen), and gene-specific primers
as follows: MA-5' primer (ATGACCCAGATCATGTTTGAGACC) and MA-3'
primer (AGGAGGAGCAATGATCTTGATCTT) for ß-actin (645 bp); Fgf10-Se
primer (AAGCTCTTGGTCAGGACATGG) and Fgf10-An primer
(ATGGGGAGGAAGTGAGCAGA) for Fgf10 (506 bp); and Fgfr2b-Se
primer (ACACCGAGAAGATGGAGAAG) and Fgfr2b-An primer
(GTTTGGGCAGGACAGTGAG) for Fgfr2b (609 bp). PCR was performed using Ex
Taq polymerase HS (Takara Bio, Japan) and 1/10 of the volume of the cDNA
reaction mix. In total, 35 cycles were performed at annealing temperatures of
60°C for Fgf10 and 65°C for Fgfr2b. The analysis was
repeated twice with samples from two different fetuses for each genotype, and
all gave the same results.
BrdU incorporation, quantitative histomorphometry and TUNEL assay
To analyze BrdU uptake in embryos, pregnant mice were injected
intraperitoneally with BrdU (Roche) at a dose of 100 µg/g body weight and
were sacrificed 1 hour later. Immunohistochemical staining for BrdU was
performed using a monoclonal antibody (G3G4, 1:100) from Developmental Studies
Hybridoma Bank, a M.O.M. kit (Vector) and a NovaRed substrate (Vector)
according to the manufacturers' instructions. At E11.5, the BrdU-positive
cells were counted in the epithelium (along the line shown in
Fig. 4A,B, approximately 200
µm long in each eyelid) and in three serial sections (21 µm) for each
embryo (wild type, n=5; Fgf10/,
n=4). Since the total number of cells was not found to differ between
genotypes, the number of BrdU-positive cells did not reflect varying cell
density. The epithelial areas counted for BrdU-positive cells at E13.5 are
indicated in Fig. 4D,E. The
percentage of BrdU-positive cells was calculated (wild type, n=3;
Fgf10/, n=3). The epithelial areas
counted for BrdU-positive cells at E15 are indicated in
Fig. 4I,J. The percentage of
BrdU-positive cells was again calculated (wild type, n=4;
Fgf10/, n=3). The means and
standard errors of the means (s.e.m.) were calculated from the pooled data.
Differences were judged significant if P<0.05 (as shown by the
asterisks in Fig. 4), as
determined by Student's t-test.
A TUNEL assay of apoptotic cells on tissue sections was carried out as recommended by the manufacturer (ApopTag, Intergen). The sections were pretreated with 0.5% Triton X-100, and diaminobenzidine was used as a substrate for horseradish peroxidase.
Immunofluorescence
Immunostaining for
-tubulin was performed essentially according to
the procedure of Thompson et al. (Thompson
et al., 2004
). Briefly, heads from wild-type and
Fgf10-deficient embryos at around E15 were cut at the midline and
fixed overnight in 3% formaldehyde in PBS after Triton X-100/PEG treatment
(Libusova et al., 2004
).
Cryosections with a thickness of 18 µm were prepared and processed for
immunofluorescence. The anti-
-tubulin (Clone GTU-88; Sigma, diluted at
1:1000) and anti-vimentin (Clone Vim3B4; Dako, diluted at 1:200) monoclonal
antibodies were visualized by using Cy3-conjugated goat anti-mouse IgG
(Jackson, diluted at 1:1000). To illuminate the cell boundaries,
Bodipy-ceramide (FLC5; Molecular Probes) was used, according to Lele et al.
(Lele et al., 2002
), at a
concentration of 10 µM. The number of
-tubulin-expressing cells in
the basal epidermis of the eyelid tip (approximately 17 cells along the broken
line shown in Fig. 7J,K) was
calculated.
Staining for F-actin of flat mounts and frozen sections (18 µm) was carried out using eye samples from E15 embryos fixed in 4% paraformaldehyde. The tissues were incubated with Rhodamine-phalloidin (Molecular Probes) and observed with a fluorescence stereomicroscope (Leica) or by laser scanning confocal microscopy (BioRad) according to standard procedures.
Isolation and culturing of primary keratinocytes and in vitro scratch assay
Isolation and culturing of primary keratinocytes were performed basically
according to Li et al. (Li et al.,
2003
) with minor modifications. Briefly, E18 embryos were
collected, and their skin removed, washed and incubated in Dispase medium
[defined keratinocyte-serum free medium (DK-SFM; Invitrogen), 5 U/ml Dispase
II, 100 µg/ml streptomycin, 0.25 µg/ml fungizone, 50 µg/ml
gentamicin] at 4°C for 18 hours. The dermis was separated from the
epidermis, and the epidermis was minced and digested in 0.05% trypsin-EDTA for
10 minutes. A mouse keratinocyte culture medium containing DK-SFM, 10 ng/ml
EGF (Sigma) and 10 ng/ml choleratoxin (Wako, Japan) was used. In the case of
the E18 embryonic keratinocytes, we did not observe a distinct difference in
motility with or without EGF.
To determine the cell motility, wild-type and mutant keratinocytes were seeded onto 6-well culture dishes or chamber slides (Nalge Nunc), grown to confluence and transferred to a growth factor-free medium plus mitomycin C (Sigma) for 2 days. The confluent monolayers were wounded using a disposable Pasteur pipette tip (Iwaki, Japan) and EGF was added again. For immunostaining, the cells were washed twice with PBS and fixed in 3.7% formaldehyde solution in PBS for 10 minutes at room temperature.
Explant cultures of mouse eyelid primordia
Eyelids (with the anterior segment of the eye) at E15 were cultured at the
air-fluid interface by placing them on 0.4-µm Milli Cell-CM (PICM 03050,
Millipore, Bedford, MA, USA) in 6-well plates containing DK-SFM. The organ
cultures were maintained at 37°C under 100% humidity and 95% air-5% carbon
dioxide for 1 day. Heparin-coated acrylic beads (H5263, Sigma), 250-300 µm
in diameter, were incubated in 0.5 mg/ml recombinant human FGF10 (Peprotech)
at 37°C or 40 minutes and then stored at 4°C before being placed on
the explant. For control experiments, beads were soaked in PBS according the
same protocol. An FGF10-soaked bead or PBS-bead was inserted into the eyelid
mesenchyme. The distance between the eyelid margin and the bead was estimated,
from microscope observation, to be approximately 300 µm.
The eyelid closure percentage was calculated by measuring the area of the epithelium covering the cornea (Fig. 9M) at the beginning of the culture and after 8 hours, using the NIH Image program (http://rsb.info.nih.gov/nih-image/). The means and s.e.m. values were calculated from the pooled data (FGF10-bead, n=3; PBS-bead, n=2).
| Results |
|---|
|
|
|---|
16) and mesenchymal cells later
(E16.5
17.5) (Li et al.,
2001
To specify the role of FGF10 in eyelid development, we sought to determine
its expression pattern in mouse eyelid primordia. It has been reported that
Fgf10 is expressed in the mesenchyme of developing eyelids at E12.5
(Li et al., 2001
). Its
expression domain and profile, however, have not been fully described.
Therefore, we re-examined the expression pattern of Fgf10 until
eyelid fusion. At E11.5, Fgf10 was expressed in the mesenchyme
underneath the epithelium of the emerging eyelid groove
(Fig. 2A,B). By E13.5,
Fgf10 was expressed in the eyelid mesenchyme just beneath the
epithelial tip and in the developing corneal stroma
(Fig. 2D-F). At E15, it was
expressed around the eye (Fig.
2G), in the eyelid mesenchyme
(Fig. 2H,I). By contrast, the
major receptor for FGF10 during organogenesis, Fgfr2b, was expressed
in the eyelid epithelium (Fig.
2J-L). RT-PCR analysis using E18.5 keratinocyte RNA verified that
Fgf10 was not expressed in the epithelium but Fgfr2b was
expressed there (Fig. 2M).
These expression patterns suggest that Fgf10 may be involved in
eyelid development from a very early stage, and that in the absence of FGF10
primary defects may be found in the eyelid epithelium.
|
To determine which processes require FGF10 during eyelid development, we examined the developmental processes of mutant eyelid primordia by comparing them with normal ones. The initiation stages of eyelid development include ectoderm morphogenesis and groove formation. The ectoderm morphogenesis initiates at E11.5 when the flat ectoderm cells above and below the optic vesicle undergo morphogenetic changes to form cube-shaped epithelial cells. The epithelium also starts to form small eyelid grooves above and below the eye, which were obvious at E11.5 in the wild type (Fig. 3E,F). In the mutant embryos, however, the initial morphogenetic change from flat ectoderm cells to cuboid epithelial cells was not observed, as the mutant cells maintained a flat appearance (Fig. 3G,H). As the eyelid grooves deepened by E13.5 in the wild type, mesenchymal cells nearby started proliferating to form primitive eyelids with protruding ridges of epithelium (Fig. 3I-K). However, the mutant eyelid anlagen appeared much smaller, the groove was shallower and the epithelium overlying the eyelid mesenchyme remained flat (n=3; Fig. 3L-N).
|
|
Scanning electron microscopy (SEM) observation of E15 normal eyes showed that rounded periderm cells were present in clumps all around the eyelid margin (Fig. 5A; B for Fgf10/ mutant). In Fgf10-null eyelids, however, typical peridermal clumps were merely seen at the inner canthus (Fig. 5D; C for comparison). The periderm cells were rather scattered on the upper and lower eyelid margins of the mutant (Fig. 5F; E for comparison), and they were hardly seen at the outer canthus (Fig. 5H; G for comparison). Transmission electron microscopy further revealed the formation of filopodia in the leading edge periderm cells (Fig. 5I). It is known that filopodia are pivotal for epithelial fusion: they scan the opposing leading edge, playing an integral role in finally knitting the epithelial hole closed. In the Fgf10/ mutant leading edge, epidermal cells still developed filopodia, although these were distinctly fewer and shorter (Fig. 5J) (n=3). Thus, FGF10 is not required for the formation of filopodia per se during eyelid fusion, but seems necessary for their growth and maturity. At E16, SEM observation verified that the normal eyelids were fused with the epidermis that was streaming towards the point of fusion, where periderm cells accumulated along the junctional region (Fig. 5K). In contrast, wide-open, Fgf10-null eyelid rudiments had an epithelial ridge on their margin, whose subsequent growth collapsed (Fig. 5L).
A decrease in proliferating cells of the epithelium was not detected in the Fgf10-null epithelium at E15 (Fig. 4I-M), although it was detected at E13.5 (P=0.03) (Fig. 4D-H). The TUNEL assay did not show any differences in the numbers of apoptotic cells between the mutant and normal eyelid territories at either E13.5 or E15 (data not shown). Thus, Fgf10-null eyelids fail to maintain peridermal clumps on the lid margin at around E15, which may results from cellular events independent of cell proliferation and apoptosis.
|
and/or activin-Jun cascades are
involved (Li et al., 2003
|
|
Accumulation of actin fibers is not observed in epithelial leading edge cells
To test whether FGF10 also regulates actin polymerization in the developing
eyelid epithelium, we examined the formation of actin filaments in the eyelid
tissues of E15 fetuses. In both wild-type and
Fgf10+/ fetuses, the eyelid epithelial cells
developed prominent F-actin networks as demonstrated by whole-mount phalloidin
staining (Fig. 7A,D-F). By
contrast, in the homozygous mutant, only a few cells that were mostly confined
to a single cell layer at the eyelid tip, formed actin cables
(Fig. 7G). Histological
sections revealed that F-actin accumulated in the leading edge cells of the
wild type (Fig. 7B,C), but not
of the mutant (Fig. 7H,I).
These results demonstrate that FGF10 regulates actin stress fiber formation in
epithelial leading edge cells of the developing eyelid, which is probably
associated with epithelial movement and eyelid closure.
Since cell polarization is used to mediate physical fates, as in orientated
cell migration (for review, see Macara,
2004
), we further examined the polarity of the eyelid epithelial
cells in Fgf10-null eyelid tips. We performed immunostaining of
-tubulin to reveal a centrosome: a microtubule-organizing center
(MTOC), localized apically in the epithelial cell
(Rizzolo and Joshi, 1993
). The
initial stratification of the single-layer ectoderm during embryonic
development gives rise to an outer periderm layer and an inner basal layer. In
the wild type,
-tubulin was localized in the apical side of the
epidermal cells in the basal layer (Fig.
7J). It is known that migrating sheets of cells recognize the
direction of migration and polarize so that protrusive activity is restricted
to the front, and that the MTOC re-orients itself in front of the nucleus to
face the direction of migration
(Etienne-Manneville and Hall,
2002
). Notably, under the experimental conditions employed here,
-tubulin expression was not observed in the leading edge cells, the
periderm cells, but rather in the inner basal layer of the epidermis
(Fig. 7J,J'). This
finding might be related to the fact that the eyelid epithelial cells lose
their typical apicobasal polarity by degrees in migration, as is found in the
epithelial-mesenchymal transition, or that the expression was just obscured by
unknown factors. Even in the Fgf10/ mutant
eyelid, the inner basal layer exhibited
-tubulin expression apically in
the cell (Fig. 7K,K');
however, one row of basal cells appeared wavy, and the number of
-tubulin-expressing cells seemed to decrease (n=4). Although
we found some variability in the expression pattern of
-tubulin,
depending on the developmental stages of eyelid extension and/or the embryos,
these results suggest that polarity of the epidermal cells is initially
established but later impaired to some extent without FGF10.
|
|
We then examined the expression patterns of Shh, Ptch1 and Ptch2 in Fgf10-null eyelid primordia. As expression of the three genes was similar only Shh is shown. At E13.5, expression of Shh, Ptch1 and Ptch2 was observed on the mutant eyelid margin at a very low level (n=3 for each gene) (Fig. 8E; D, control; data not shown for Ptch1, Ptch2). Around E15, however, these genes became expressed along the eyelid margin in the mutant (Fig. 8G; F, control). The expression levels of all three genes appeared to increase on the mutant eyelid margin as compared with the wild type (Fig. 8I; H, control) (n=3). Furthermore, in the wild-type eyelid the Shh-expressing cells were kept compact on the lower margin (Fig. 8J), whereas the cells were scattered on the mutant eyelid margin (Fig. 8K). In a later stage at E16.5, however, the expression patterns of Shh, Ptch1 and Ptch2 were not dotted, as the eyelid remained wide open and eyelash primordia did not develop (not shown). Thus, in the absence of FGF10, the onset of gene expression for Shh, Ptch1 and Ptch2 is delayed. In addition to impaired growth of the eyelid protrusion, the impaired expression of SHH signaling molecules supports the notion that Fgf10-null eyelid primordia have defects by E13.5.
The expression of activin ßB and Tgfa is not concentrated in the epithelial leading edge cells
Since morphological analysis indicated that the integrity of epithelial
leading edge cells of the eyelid primordia was disrupted in the absence of
FGF10, we examined the expression of such peridermally expressed genes as
activin ßB and Tgfa. We chose activin ßB and Tgfa
as the mice deficient in these genes exhibit open eyelids at birth
(Vassalli et al., 1994
;
Matzuk et al., 1995
;
Luetteke et al., 1993
;
Mann et al., 1993
). In normal
embryos at around E15, activin ßB expression was detected on the eyelid
margin (Fig. 8L). Section in
situ hybridization indicated that activin ßB was expressed in the leading
edge of the eyelid epithelium (Fig.
8P). At around E16, the expression of activin ßB was observed
in the periderm of the fusion line (Fig.
8M). In the Fgf10-null eyelid at E15, however, activin
ßB expression was down-regulated (Fig.
8O; N for comparison). Section in situ hybridization indicated
that activin ßB was diffusely expressed in the eyelid epithelium at a
very low level (Fig. 8Q).
We next examined the expression of Tgfa and Egfr; mice
lacking these genes have no eyelids (Miettinen et al., 1999;
Threadgill et al., 1995
).
Tgfa was expressed in the leading edge epithelial cells of normal
eyelids (Fig. 8R) and later in
the fusion line and the adjacent periderm
(Fig. 8S)
(Berkowitz et al., 1996
). Since
Egfr was diffusely expressed in the epithelium (data not shown)
(Berkowitz et al., 1996
), we
examined the expression of Tgfa as a peridermal marker gene rather
than Egfr. Tgfa expression was down-regulated in the mutant periderm
and was not concentrated in the leading edge cells
(Fig. 8U,W; T,V, control).
FGF10 protein can up-regulate the expression of activin ßB and Tgfa in the normal eyelid epithelium and retrieve the eyelid epithelial extension in the Fgf10/ eyelid anlagen
To determine whether the absence of FGF10 protein is directly involved in
eyelid defects in Fgf10-null mice, we carried out an explant culture
of normal eyelid anlagen and implanted an FGF10-soaked bead in the mesenchyme
of the lower eyelid. We examined whether activin ßB and Tgfa
were up-regulated or ectopically induced after FGF10-bead application in
normal eyelid anlagen. We found that within 12 hours, activin ßB
(Fig. 9B,C; A,E for comparison)
and Tgfa (Fig. 9H,I;
G,J for comparison) were ectopically induced in the thickened
epidermis of the FGF10-bead-implanted eyelid
(Fig. 9D; F for comparison).
Furthermore, the area showing accumulation of F-actin in the leading edge
appeared enlarged after FGF10 application, although no ectopic accumulation
was observed near the bead (n=4)
(Fig. 9K; L for comparison). By
contrast, Shh was not ectopically induced by FGF10 protein in the
eyelid explants derived from E15 mice (data not shown).
We next assessed whether FGF10 beads could promote epithelial extension in cultured Fgf10-null eyelids by applying quantitative morphometry. We measured the area of the eyelid epithelium covering the cornea before and after FGF10-soaked or PBS-soaked bead application, as shown in Fig. 9M. Although FGF10 did not notably promote epithelial extension in the wild-type eyelid anlagen (data not shown), the area of epithelial extension after FGF10 application was considerably wider than that for the PBS-soaked bead on the mutant eyelid anlagen (Fig. 9N). These results indicate that FGF10 can up-regulate the expression of activin ßB and Tgfa in the normal eyelid epithelium and retrieve the eyelid epithelial extension in the Fgf10/ eyelid anlagen.
| Discussion |
|---|
|
|
|---|
Phenotypic differences in eyelids among Fgfr2 IgIII-deleted, Egfr-null, Tgfa-null and Fgf10-null mice
Here, we compare the phenotype of open eyelids at birth found in
representative mutants with that of Fgf10-null mice. First, the
failure of eyelid induction in Fgfr2 IgIII-deleted embryos initiates
much earlier and more severely than in
Fgf10/ mutants; no grooves are formed above
or below the eye, indicating that the loss of all FGFs-FGFR2 signaling blocks
eyelid formation at its earliest stages
(Li et al., 2001
). By
contrast, in Fgf10/ mutants, shallow but
distinct eyelid grooves are formed and epithelial ridge formation is initially
observed, although the eyelid protrusion is smaller and the integrity of
peridermal clumps is disrupted. Thus, it is conceivable that multiple ligands
of FGFR2 must be involved in eyelid development, among which FGF10 is critical
for proliferation and maintenance of peridermal clumps at the leading edge of
the developing eyelid margin. The residual signaling by FGFR2 via
FGF10-related molecules such as FGF7 is likely to function in the absence of
FGF10 and thus the phenotype of Fgf10-null eyelids must be milder
than that in FGFR2b-null eyelids.
|
, amphiregulin, heparin-binding EGF,
betacellulin and epiregulin. Egfr-null mice have open eyelids at
birth (Miettinen et al.,
1995
-EGFR signaling in prenatal eyelid
development and that other ligands of EGFR could also elaborate eyelid
development. The eyelids of Tgfa null embryos exhibit variable
extension across the cornea but no contact with the opposing epithelia
(Berkowitz et al., 1996
The expression analysis of Tgfa and Egfr revealed that
both genes are expressed in the developing eyelid epithelium: Tgfa
mRNA is concentrated in the distal tips of the eyelids, whereas Egfr
mRNA is prevalent throughout the epithelia on the eyelids and the cornea
(Berkowitz et al., 1996
). This
implies that the TGF
-EGFR signaling may be involved in eyelid
development in an autocrine or juxtacrine mode. By contrast, Fgf10 is
expressed in the eyelid mesenchyme, while its receptor gene Fgfr2b is
expressed in the epithelium (Li et al.,
2001
) (Fig. 2J-M),
indicating that FGF10-FGFR2b acts in a paracrine manner between the epithelium
and the mesenchyme. This suggests that there are two important tissue
interactions during eyelid formation: intra-epithelial and
epithelial-mesenchymal, mediated by TGF
-EGFR and FGF10-FGFR2b
signaling, respectively. Since it has been shown that TGF
stimulates
keratinocyte proliferation and migration
(Barrandon and Green, 1987
), it
is possible that some functions of FGF10 in eyelid formation, such as eyelid
epithelial proliferation and migration could be mediated by TGF
signaling.
|
FGF10 signaling links to activin and TGF
signaling
The activin ßB gene encodes the activin/inhibin ßB subunit,
constituting the dimeric growth factors of activin B, activin AB and inhibin
B, which belong to the TGFß family. Mice deficient in activin ßB are
viable but have defective eyelid development
(Vassalli et al., 1994
;
Matzuk et al., 1995
). This
study showed peridermal expression of activin ßB and Tgfa, their
down-regulation in Fgf10-null eyelid primordia and up-regulation of
expression by the FGF10 protein. Thus, it is likely that activin ßB is a
downstream component of FGF10 signaling during embryonic eyelid development.
Given that activin and basic FGF have been shown to control cell migration in
the Xenopus gastrula (Wacker et
al., 1998
), FGF10 might be involved in cell migration by
interacting with activin signaling during mouse eyelid development.
Studies of mice with open eyelids at birth have shown that embryonic eyelid
closure requires at least two signaling pathways, involving
activin-MEKK1-JNK/p38 and TGF
/EGFR-ERK
(Zhang et al., 2003
;
Xia and Kao, 2004
). The known
end point of the former pathway is actin stress fiber formation and
phosphorylation of the nuclear factor Jun, the expression or activity of which
might be of importance for the induction of EGFR and the activation of the
second pathway. Although expression of activin ßB and Tgfa is
found in Fgf10-null eyelid epithelia at a low level, their mRNAs are
not accumulated in leading edge cells without FGF10. Thus, this study further
supports the notion that FGF10 positively regulates these signaling pathways
during mouse eyelid closure. It is not known whether the control of mRNA
distribution of activin ßB and Tgfa and the accumulation of F-actin
through FGF10 signaling are correlated or parallel pathways.
Cellular events mediated by FGF10 during eyelid closure
Recently, it has been thought that mammalian eyelid fusion is one of the
developmental models for epidermal hole/wound closure, re-epithelialization
and even wound healing to some extent, as is the case for dorsal closure in
Drosophila embryos. There are two modes of epidermal hole/wound
closure: actin purse-string mode and lamellipodial crawling mode
(Martin and Parkhurst, 2004
).
In the actin purse-string mode, during the phase of epithelial sweeping, the
leading edge cells accumulate actin and myosin just beneath the cell membrane
at their apical edge. This F-actin accumulation forms a contractile cable,
which pulls the leading edges (LEs) of the epithelial sheets taut
(Jacinto et al., 2002
) and
drives LE cell apical constriction before further elongation and migration of
the LE cells (Martin and Parkhurst,
2004
). Since accumulation of actin fibers in LE cells was not
observed in Fgf10-null eyelids, while the scratch assay of cultured
mutant keratinocytes showed the formation of lamellipodia, FGF10 may be
required for a kind of wound-healing process by the actin purse-string mode
rather than by the lamellipodial crawling mode. Furthermore, FGF10 signaling
appears to have a role in maturation of filopodia in migrating eyelid
epithelial cells.
The epithelial cells of Fgf10/ mutant
eyelids exhibit a polarity (shown by
-tubulin expression) and form
prospective periderm cells, suggesting that even in the absence of FGF10
signaling the polarization signal is received by the eyelid LE cells, but that
there is a collapse in its integrity without FGF10. This suggests that FGF10
makes the eyelid LE cells competent to maintain a pre-existing polarization
signal.
Concluding remarks
The permissive function of FGF10 signaling translates into the correct
coordination of different events in eyelid development, i.e. cell shape
changes and proliferation in the early phase
(Fig. 10A), and cell migration
and polarity in the late phase, by regulating the activity of cytoskeleton and
gene transcription (Fig. 10B).
In the absence of FGF10, the leading edge cells cannot elongate centripetally,
and these defects may well be responsible for the failure of
Fgf10/ eyelid epidermis to spread over the
developing cornea. This study also suggests mouse eyelid epithelial fusion as
a new paradigm to elucidate the mechanisms of EMT. It has been reported that
several members of the Wnt family are expressed in the developing eyelid
primordia of the mouse (Liu et al.,
2003
). Although the phenotype of open eyelids at birth has not so
far been reported for any Wnt mutants, a Wnt pathway was shown to be involved
in Drosophila dorsal closure
(Morel and Arias, 2004
). It is
therefore tempting to speculate that a Wnt pathway might be related to FGF10
signaling in mouse eyelid development.
Embryonic wound healing is a rapid process (taking place within 1 day in
the case of eyelid closure) involving actin cable formation but no apparent
hemostatic or inflammatory response
(Martin and Lewis, 1992
).
Therefore, further elucidation of the mechanisms of eyelid closure will be
useful in guiding us to better control the cell behaviors of repair in a
clinical scenario.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Barrandon, Y. and Green, H. (1987). Cell migration is essential for sustained growth of keratinocyte colonies: the roles of transforming growth factor-alpha and epidermal growth factor. Cell 50,1131 -1137.[CrossRef][Medline]
Berkowitz, E. A., Seroogy, K. B., Schroeder, J. A., Russell, W. E., Evans, E. P., Riedel, R. F., Phillips, H. K., Harrison, C. A., Lee, D. C. and Luetteke, N. C. (1996). Characterization of the mouse transforming growth factor alpha gene: its expression during eyelid development and in waved 1 tissues. Cell Growth Differ. 7,1271 -1282.[Abstract]
Celli, G., LaRochelle, W. J., Mackem, S., Sharp, R. and Merlino, G. (1998). Soluble dominant-negative receptor uncovers essential roles for fibroblast growth factors in multi-organ induction and patterning. EMBO J. 17,1642 -1655.[CrossRef][Medline]
De Moerlooze, L., Spencer-Dene, B., Revest, J., Hajihosseini, M., Rosewell, I. and Dickson, C. (2000). An important role for the IIIb isoform of fibroblast growth factor receptor 2 (FGFR2) in mesenchymal-epithelial signalling during mouse organogenesis. Development 127,483 -492.[Abstract]
Etienne-Manneville, S. and Hall, A. (2002). Rho GTPases in cell biology. Nature 420,629 -635.[CrossRef][Medline]
Findlater, G. S., McDougall, R. D. and Kaufman, M. H. (1993). Eyelid development, fusion and subsequent reopening in the mouse. J. Anat. 183,121 -129.
Goodrich, L. V., Johnson, R. L., Milenkovic, L., McMahon, J. A.
and Scott, M. P. (1996). Conservation of the
hedgehog/patched signaling pathway from flies to mice: induction of a mouse
patched gene by Hedgehog. Genes Dev.
10,301
-312.
Harris, M. J. and McLeod, M. J. (1982). Eyelid growth and fusion in fetal mice. A scanning electron microscope study. Anat. Embryol. (Berl) 164,207 -220.[CrossRef][Medline]
Harris, M. J. and Juriloff, D. M. (1986). Eyelid development and fusion induced by cortisone treatment in mutant, lidgap-Miller, foetal mice. A scanning electron microscope study. J. Embryol. Exp. Morphol. 91, 1-18.[Medline]
Jacinto, A., Wood, W., Woolner, S., Hiley, C., Turner, L., Wilson, C., Martinez-Arias, A. and Martin, P. (2002). Dynamic analysis of actin cable function during Drosophila dorsal closure. Curr. Biol. 12,1245 -1250.[CrossRef][Medline]
Juriloff, D. M. and Harris, M. J. (1989). A scanning electron microscope study of fetal eyelid closure accelerated by cortisone in SWV/Bc mice. Teratology 40, 59-66.[CrossRef][Medline]
Kume, T., Deng, K. Y., Winfrey, V., Gould, D. B., Walter, M. A. and Hogan, B. L. (1998). The forkhead/winged helix gene Mf1 is disrupted in the pleiotropic mouse mutation congenital hydrocephalus. Cell 93,985 -996.[CrossRef][Medline]
Lele, Z., Folchert, A., Concha, M., Rauch, G. J., Geisler, R., Rosa, F., Wilson, S. W., Hammerschmidt, M. and Bally-Cuif, L. (2002). parachute/n-cadherin is required for morphogenesis and maintained integrity of the zebrafish neural tube. Development 129,3281 -3294.
Li, C., Guo, H., Xu, X., Weinberg, W. and Deng, C. X. (2001). Fibroblast growth factor receptor 2 (Fgfr2) plays an important role in eyelid and skin formation and patterning. Dev. Dyn. 222,471 -483.[CrossRef][Medline]