|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online June 27, 2005
doi: 10.1242/10.1242/dev.01904
1 Max-Planck Institut für Entwicklungsbiologie, Department of Genetics,
Spemannstrasse 35, Tuebingen, D-72076, Germany
2 Centre for Genetic Engineering and Biotechnology, Animal Biotechnology
Department, La Habana, CP 10 600, Cuba
* Author for correspondence (e-mail: mahendra.sonawane{at}tuebingen.mpg.de)
Accepted 13 May 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Epidermis, Hemidesmosomes, penner/lgl2, Cell proliferation, Zebrafish
| Introduction |
|---|
|
|
|---|
6ß4 integrins as the transmembrane
core components, which interact with laminin 5 in the basement membrane
(reviewed by Fuchs and Raghavan,
2002
How polarised distribution of various cellular junctions occurs during
development is one of the most fundamental questions in cell biology. In the
embryonic epidermis of Drosophila, the zonula adherens demarcates the
boundaries of the apical domain, whereas septate junctions are formed in the
basolateral domain. Genetic analysis of zonula adherens and septate junction
formation in the Drosophila embryonic ectoderm (epidermis) has
revealed genes and pathways that are involved in polarisation of epithelia.
The competitive interaction between crumbs, lethal giant larvae and
bazooka/par3 pathways have been shown to be crucial for the apical
localisation of zonula adherens in the embryonic epidermis
(Bilder et al., 2003
;
Tanentzapf and Tepass, 2003
).
In absence of a functional lgl pathway, which along with lgl
also comprises scribble and discs large, the apical domain
expands at the expense the basolateral domain, indicating essential function
of this pathway in the maintenance of the basolateral domain
(Bilder et al., 2000
;
Bilder et al., 2003
;
Tanentzapf and Tepass, 2003
).
Consistent with this, the function of scribble and discs
large is also necessary for the formation of septate junctions
(Bilder and Perrimon, 2000
;
Woods et al., 1996
;
Woods et al., 1997
).
The polarised distribution of phosphorylated Drosophila Lgl has
been suggested to be necessary for the basal targeting of proteins such as
Miranda, which determine the fate of ganglion mother cells
(Betschinger et al., 2003
;
Ohshiro et al., 2000
;
Peng et al., 2000
).
Vertebrates have two Drosophila lgl orthologues, lgl1 and
lgl2. Similar to Drosophila Lgl, both Lgl1 and Lgl2 interact
with the Par3/Bazooka pathway and are phosphorylated at conserved serine
residues by aPKC (Betschinger et al.,
2003
; Plant et al.,
2003
; Yamanaka et al.,
2003
). The phosphorylation of Lgl1 and Lgl2 is also necessary for
their localisation exclusively at the basolateral membrane, as
nonphosphorylatable Lgl1 and Lgl2 also localise to the apical domain
(Musch et al., 2002
;
Yamanaka et al., 2003
). At the
basolateral membrane, Lgl1 binds to syntaxin 4, a t-SNARE that is involved in
the fusion of post-Golgi transport vesicles to the target membranes, and has
been proposed to link the establishment of cell polarity to the polarised
exocytosis (Musch et al.,
2002
).
In addition to defects in cell polarity, lgl mutant larvae exhibit
neoplastic growth of neuroblasts as well as imaginal disc epithelium in
Drosophila, and in the absence of lgl function, non-invasive
tumours expressing activated Ras develop into aggressive cancers (reviewed by
Bilder, 2004
;
Gateff, 1978
;
Pagliarini and Xu, 2003
). In
mouse, lgl1 is expressed almost ubiquitously in adults and during
embryogenesis (Klezovitch et al.,
2004
). The lgl1 knockout mouse exhibits disorganisation
of the apical junctional complex and disruption of apicobasal polarity in
neuroepithelium, resulting in hyper-proliferation of neuroblasts and brain
dysplasia (Klezovitch et al.,
2004
). Consistent with its role in regulating proliferation,
transcripts of lgl1 have been shown to be absent in various human
carcinomas (Grifoni et al.,
2004
). At present, it is not clear whether lgl2 has any
functions in regulating growth during development or organ formation.
Owing to the unavailability of an appropriate model system, a forward
genetic analysis of hemidesmosome formation has never been performed. We
envisage that a forward genetic analysis of hemidesmosome formation in the
zebrafish would uncover developmental cues regulating the assembly of these
robust structures, pathways involved in establishing the basal domain of
epidermal cells and targeting hemidesmosomal components to the basal cortex,
as well as novel components of hemidesmosomes. Here, we confirm the
feasibility of using zebrafish as a model system to perform a forward genetic
analysis of hemidesmosome formation. We screened an existing collection of
zebrafish skin mutants (van Eeden et al.,
1996
) and show that penner (pen) function is
necessary for hemidesmosome formation in basal epidermal cells. Genetic
mapping and molecular cloning reveals that penner is zebrafish
lgl2, and functions in hemidesmosome formation and maintenance of the
basal domain in basal epidermal cells. We further show that in penner
mutant larvae basal epidermal cells migrate to ectopic places, and
hyper-proliferate, indicating that lgl2 is also involved in
regulating growth of the basal epidermis. Thus, our approach has unravelled a
previously unknown function of lgl2 during development of the basal
epidermis of vertebrates.
| Materials and methods |
|---|
|
|
|---|
Histology: light and electron microscopy
Wild-type and mutant larvae were fixed overnight in 4% PFA in PBS at
4°C, washed in PBS, upgraded in ethanol series (30% to absolute) and
embedded in Technovit 7100. Blocks were sectioned (3 µm) using an automated
Leica RM 2165 microtome, stained using Giemsa
(Kiernan, 2001
) and embedded
in permount. For electron microscopy (EM), after fixation in 4% PFA, specimens
were post-fixed with 1% OsO4 in H2O for 10 minutes on
ice, followed by fixation and contrast with 1% uranyl acetate for 1 hour on
ice, then dehydrated by increasing concentrations of ethanol and embedded in
Epon. Ultrathin sections made from the head, trunk and tail region (60-90 nm)
were stained with lead citrate and uranyl acetate.
BrdU labelling
For labelling, 5-day-old wild-type and penner mutant larvae were
incubated with 10 mM BrdU solution in 2% DMSO in embryonic medium (E3) for 2
hours. After treatment, larvae were washed several times. Fixation and
staining was carried out as follows.
Immunohistochemistry
Three- to five-day-old wild-type and mutant larvae were fixed overnight in
4% PFA in PBS at 4°C followed by permeabilisation in absolute methanol at
20°C, to stain for actin using C4 mouse anti actin (Cedarlane),
ß-catenin using P14L antibody, BrdU using ab6326 (abcam) antibody. For
staining cytokeratin using Ks pan 1-8 (Progen Biotechnik) antibody, larvae
were fixed in Dent's fixative at 20°C. For staining GFP using
anti-GFP antibody (Torrey Pines), embryos were either fixed in 4% PFA or in
Dent's fixative. After downgrading the larvae to 0.1 M phosphate buffer (PB),
they were washed with PBT (PB+0.8% Triton X-100) five times and blocked in 10%
normal goat serum. For BrdU staining, larvae were treated with 4 N HCl for 20
minutes, washed extensively in PB and blocked in 1% BSA for 1-3 hours.
Antibodies were diluted as: anti actin, ab 6326 (1:100); Ks pan 1-8 (1:10);
P14L (1:50); anti GFP (1:200). Samples were incubated at room temperature for
4 hours or overnight at 6-8°C. Afterwards, larvae were washed five times
in PBT and incubated with Cy3-, Alexa 488- and alkaline phosphatase
(AP)-conjugated or biotinylated anti-mouse, anti-rat or anti-rabbit
antibodies. Larvae were washed, developed in NBT-BCIP or using ABC elite kit
(Vectastain) along with DAB (for AP conjugated and biotinylated secondary
antibodies only), post fixed in 4% PFA and either upgraded in glycerol for
fluorescence/light microscopy or embedded in technovit for sectioning or
processed for EM analysis. For fluorescence microscopy, sections were
counterstained using DAPI and mounted in 70% glycerol.
Genetic mapping, mutation analysis and analysis of conserved domains
Heterozygous fish (Tü background) carrying mutation in penner
(pent06) were crossed with wild-type WIK fish. F2 mutant
larvae were used for meiotic mapping using SSLP markers, as described
previously (Geisler, 2002
;
Shimoda et al., 1999
).
Subsequent fine mapping was carried out using SNP markers identified in the
BAC ends. The sequence of zC148E17 was analysed for ORFs using GENSCAN at:
http://genes.mit.edu/GENESCAN.html
For mutational analysis, cDNA was prepared using AMV Reverse Transcriptase (Invitrogen) from mRNA isolated from 5-day-old Tü, WIK and penner mutant larvae using Oligotex spin columns. For sequencing, cDNA was amplified using gene-specific primers (designed using accession number BC052919) and Pfu DNA polymerase (MBI Fermentas), purified over QIAquick coloumns (Qiagen) and directly sequenced or cloned in PCR4-TOPO vector (Invitrogen). To detect mutations, sequence analysis was performed using Lasergene software from DNASTAR. The sequences from two different amplification reactions were examined to confirm the mutation.
|
In situ hybridisation
In situ hybridisation was performed as described
(Schulte-Merker, 2002
) using a
lgl2 probe from nucleotides 1621-2615 of BC052919. lgl1
probe was derived from a partial zebrafish cDNA clone equivalent to amino
acids 7-334 of Xenopus Lgl1.
BAC rescue, morpholino injections and cell transplantations
BAC zC242O14 was injected in embryos obtained from
pen+/ parents (with WIK background) at the one-cell
stage at a concentration of 10 ng/µl. Embryos showing deformities were
removed on d1. After 5 dpf, larvae were fixed in Dent's fix and processed for
keratin staining.
Antisense morpholino oligos 5'GCCCATGACGCCTGAACCTCTTCAT3' directed against translational start site and a five-base mismatch (underline) control morpholino 5'GCACATAACGCCTCAACCTGTTAAT3' (Gene Tools, Corvallis) were dissolved in sterile water to obtain 4 mM stocks. These stocks were diluted to 200 µM with sterile water for injections at the one- to four-cell stage. For transplantations, morpholino oligos were injected in donor embryos obtained from actin-GFP transgenic line, embryos were grown up to the 1000-cell stage at which cells from these were transplanted to albino embryos that were at the same stage. Recipient larvae with epidermal clones (usually 20-25% of total transplanted) were fixed after 3.5 or 5.5-6.0 days post fertilisation (dpf) in 4% PFA or in Dent's fixative for further immunohistological analysis. For electron microscopic analysis of clones, GFP was detected using anti GFP antibody (rabbit) and biotinylated anti-rabbit antibody along with elite ABC system (Vectastain) and DAB.
| Results |
|---|
|
|
|---|
The penner function is essential for hemidesmosome formation and maintenance of the tissue integrity as well as cellular morphology in the basal epidermis
We screened an existing collection of zebrafish larval skin mutants
(van Eeden et al., 1996
) to
identify genes involved in the process of hemidesmosome formation. Among these
mutants, pen exhibits a late phenotype that is apparent by 4.5 to 5
dpf, coinciding with the time of hemidesmosome formation. The phenotype is
marked by an overgrowth in the ventral epidermis and rounded up cells in fin
folds (Fig. 2A,B)
(van Eeden et al., 1996
) and
most of the larvae die on the 6th developmental day. Histological analyses of
5-day-old pen mutant larvae revealed that the epidermis of these
larvae detaches from the underlying tissues
(Fig. 2C,D). We have analysed
ultra-structural details of the basal epidermis and the underlying basement
membrane zone (BMZ) using electron microscopy. We found that in an undetached
dorsal and lateral mutant epidermis, hemidesmosomes were missing, basal lamina
appeared normal and, although formed, collagen lamella underlying the basal
lamina appeared disorganised (Fig.
2E). The formation of collagen lamella indicated that dorsal and
lateral epidermis differentiated normally in the mutant. Other junctions, such
as desmosomes and tight junctions, were present and showed normal
ultra-structural appearance in the mutant epidermis
(Fig. 2F-H). We then performed
immunohistological analysis using anti ß-catenin antibody on mutant and
wild-type larvae (Fig. 2I,J). A
weak but significant ß-catenin staining was observed in the mutant
epidermis (Fig. 2J), indicating
the presence of adherens junctions. Clearly, the pen function is
essential only for the process of hemidesmosome formation and maintenance of
the epidermal integrity.
In whole mounts of 5-day-old pen mutant larvae, stained for keratin, basal epidermal cells also appeared spindle shaped or round in contrast to polygonal in wild type (Fig. 3A,B). Further immunohistological analysis showed that keratin is not localised to the basal cortex as in wild-type larvae (Fig. 3C,D). We then asked if organisation of the actin cytoskeleton is also affected in pen mutant larvae. Our analysis revealed that, in contrast to the basal localisation of keratin, f-actin is localised in a punctate manner at the apical and lateral border in wild-type basal epidermal cells (Fig. 3C,E). Thus, domains of keratin and actin localisation are mutually exclusive in the wild-type basal epidermis. Interestingly, in pen mutant larvae, we often observed f-actin in the basal domain of basal epidermal cells but punctate staining at the apical and lateral borders remained unaffected (Fig. 3F). Thus, in the basal epidermis of the pen mutant, changes in the cellular morphology are coupled to the changes in the localisation of cytoskeletal elements.
|
|
To conclude, the pen function is specifically required for the process of hemidesmosome formation and maintenance of the organisation of cytoskeletal elements, as well as cellular morphology in the basal epidermis.
penner is zebrafish lethal giant larvae2 and is expressed in the developing basal epidermis
We mapped (1872 meioses) pen on linkage group 12 (49.1 cM from the
top) between two simple sequence length polymorphic (SSLP) markers
(Fig. 4A). An EST cluster (wz
5928) maps to this region and allowed us to screen libraries in order to find
BACs representing this region. The end of one of these BACs (zC209I1) was used
as a length polymorphic marker and also mapped on the distal end of the
sequence contig ctg10155(zebrafish assembly zV2,
Fig. 4A). We placed
pen between this marker and a single nucleotide polymorphic (SNP)
marker identified at the proximal end (Fig.
4A) of the sequence contig. A third SNP marker in between these
two, showed very close linkage (0 recombinants) with pen. This region
harbours sequences that show homology to the second zebrafish orthologue of
the Drosophila gene lethal giant larvae
(Fig. 4A). We then examined the
sequence of a BAC (zC148E17) spanning this region to find that it harbours
lgl2 sequence along with myosin XV and an unknown ORF
(Fig. 4A). We reconfirmed the
linkage of these three genes with the mutation using SNP markers at both the
ends of this BAC (0 recombinants). Previously, it has been shown that the
Drosophila lethal giant larvae gene is involved in maintaining cell
polarity in epithelia (Bilder et al.,
2000
; Manfruelli et al.,
1996
; Tanentzapf and Tepass,
2003
). Therefore, we sequenced lgl2 cDNA from 5-day-old
mutant and wild-type (tü and WIK) larvae. Our sequencing analysis
demonstrated that lgl2 bears a nonsense mutation (Trp 399 to stop)
eliminating
60% of the C terminal part of the protein in mutants, which
harbours a part of putative syntaxin binding domain (KOG1983) and conserved
serine residues (Fig.
4B,B',D) that have been shown to be phosphorylated by aPKC
(Betschinger et al., 2003
;
Plant et al., 2003
;
Yamanaka et al., 2003
). To
confirm that the mutation in lgl2 is responsible for the phenotype
observed in pen, we asked whether a BAC carrying a wild-type copy of
lgl2 and upstream regulatory sequences could complement the mutation
and rescue the pen mutant phenotype. We selected zC242O14 for
injections as it harboured lgl2 (confirmed by PCR using gene specific
primers; data not shown) and possibly contained upstream regulatory sequences.
Moreover, one of the end of this BAC falls in the middle of zC148E17
suggesting only partial presence of Myosin XV ORF. In uninjected
5-day-old pen mutant larvae in WIK background (n=63), all
the basal epidermal cells, stained for keratin, exhibited spindle or round
shapes (data not shown). After BAC injections in zygotes, around 7% mutant
larvae (n=42) showed clones of compactly arranged wild-type polygonal
epidermal cells, indicating partial rescue
(Fig. 4C).
The pen/lgl2 gene is expressed in the entire epidermis of 24-hour-old zebrafish larvae and the expression declines thereafter (Fig. 5A; data not shown). Using cell size as a criterion, we confirmed that lgl2 transcripts are indeed present in the basal cells of the epidermis, including fin fold epidermis (Fig. 5B-E). Developing nasal placodes, otic vesicles and presumptive gut also exhibited strong expression of lgl2 (Fig. 5A; data not shown). Although it declined during the larval development, we could detect lgl2 expression in 5-day-old larvae using RT-PCR (data not shown). Our in situ expression analysis of embryos undergoing early cleavages also revealed the maternal contribution of lgl2 transcripts (see Fig. S1A,B in the supplementary material). We further asked if lgl1 is expressed in the epidermis and other epithelia. Interestingly, no lgl1 transcripts were detected in the epidermis as well as in the gut and epithelia of otic vesicles and nasal placodes (see Fig. S1C in the supplementary material; data not shown).
|
85% clones carrying lgl2MO showed
flattened polygonal cells, characteristic of the wild-type basal epidermis
(Fig. 6C,J).
|
Basal epidermal cells become migratory and hyperproliferate in the pen/lgl2 mutant larvae
The loss of hemidesmosomes has been correlated with metastasis
(Bergstraesser et al., 1995
;
Herold-Mende et al., 2001
;
Schenk, 1979
). Moreover, loss
of lgl function leads to the disruption of cell polarity and
neoplastic growth in the brain and imaginal discs of Drosophila
larvae (reviewed by Bilder,
2004
). In pen mutant larvae, basal epidermal cells
undergo shape changes that are indicative of epithelial to mesenchymal
transition, which is a characteristic of invasive or migrating cells
(Fig. 3A,B). Therefore, we
asked whether basal epidermal cells become migratory in pen/lgl2
mutants. The keratin antibody we used (Ks pan1-8) labels basal cells in dorsal
and lateral epidermis in wild-type larvae
(Fig. 1G,H;
Fig. 7A). However, in 97%
pen mutant larvae (n=65) we observed labelled cells in
either the fin fold epidermis and/or ventral epidermis covering lower jaw
(Fig. 7B; data not shown),
suggesting that basal cells in the epidermis become migratory in the absence
of lgl2 function. As the loss of stable adhesion to the basal lamina
is a pre-requisite for basal epithelial cells to acquire migratory behaviour,
it is possible that lgl2 may be suppressing migratory behaviour by
exerting its effect through the formation and maintenance of hemidesmosomes in
the basal epidermis.
To further investigate whether basal epidermal cells also hyperproliferate, we performed a bromo-deoxyuridine (BrdU) incorporation assay on 5-day-old wild type and pen mutant larvae. Although in wild-type larvae, proliferating cells were mainly restricted to the epidermis covering lower jaw, pectoral fins, swim bladder and surrounding neuromasts (Fig. 7C), we observed variation in the distribution of proliferating cells in the mutant epidermis (data not shown). Nevertheless, relatively consistent hyper-proliferation in the epidermis covering yolk/gut/swim bladder and/or around the base of the pectoral fin was observed in mutant larvae when compared with wild-type larvae (Fig. 7D). The quantification of proliferating epidermal cells in a specified area of 0.06 mm2 in this region (Fig. 7C,D) revealed an almost fourfold increase (t-test, P<0.01) in mutant larvae (42±21, n=11) when compared with wild-type larvae (11±4, n=10). Furthermore, histological analysis of these larvae showed that BrdU mainly labelled the basal cells of the epidermis in wild-type and pen mutant larvae (data not shown). Thus, the presence of overgrowth in the ventral epidermis (Fig. 2B) could be the effect of the increase in the cell number either because of hyper-proliferation or the migration of epidermal cells from dorsal/lateral epidermis into this region, or both. We conclude that the loss of pen/lgl2 function leads to the acquisition of migratory behaviour and hyper-proliferation of the basal epidermis.
| Discussion |
|---|
|
|
|---|
In an attempt to understand when hemidesmosomes develop in the zebrafish larval epidermis, we analysed electron microscopic changes occurring during development of the epidermis. In the larval epidermis, hemidesmosomes begin to appear at 4 to 4.5 dpf and develop in size and shape by 5.5 dpf (Fig. 1C-E). During epidermal development, keratin is expressed and localised in the basal cortex in 3-day-old larvae (Fig. 1B) and remains localised at the basal cortex thereafter (Fig. 3C; data not shown). Furthermore, hemidesmosomes and keratin are absent in the ventral and fin fold epidermis (Fig. 1F-I). At present, it is not clear how cells of the ventral or fin fold epidermis adhere to the basement membrane. The alternative mechanisms of cell to basement membrane adhesion may exist and develop in these parts of the epidermis, while hemidesmosomes are developing in the dorsal and lateral epidermis.
|
Vertebrates have two orthologues of the Drosophila gene lethal
giant larvae. Of these, lgl1 knockout mice exhibit brain
dysplasia without any defects in any other tissues
(Klezovitch et al., 2004
). In
these mice, components of the apical junctional complex such as
ß-catenin, myosin II-B and f-actin are disorganised, indicating loss of
polarity in the neuroepithelium
(Klezovitch et al., 2004
).
Here, our analyses have revealed that pen/lgl2 functions in
the formation of basally localised hemidesmosomes and maintenance of the basal
localisation of keratin cytoskeleton. The localisation of actin and
ß-catenin at lateral and apical borders of basal cells remains unaffected
before and after the onset of hemidesmosomal phenotype
(Fig. 2J,
Fig. 3F; data not shown). We do
observe some decrease in the intensity of ß-catenin staining as cells
express hemidesmosomal phenotype but it does not seem to be the primary effect
of the mutation because even clones carrying lgl2MO, which would also
knockdown maternal lgl2 expression, did not show any phenotype on 3.5
dpf that was indicative of loss of ß-catenin at the apical or lateral
borders. Thus, lgl2 is primarily involved in hemidesmosome formation,
a process that is involved in the maturation of the basal domain during
epidermal development. Involvement of lgl1 in maintenance of apical
junctional complex in the brain
(Klezovitch et al., 2004
) and
that of lgl2 in the formation of hemidesmosomes and maintenance of
the cellular morphology in basal epidermal cells (Figs
2,
3 and
6) indicate that these two
Drosophila lgl orthologues may have evolved tissue specific functions
during vertebrate development. This statement is further supported by the fact
that lgl1 transcripts are absent in developing epithelia wherein
lgl2 transcripts are abundant (see Fig. S1C-E in the supplementary
material).
In Drosophila, a pathway comprising lgl, scribble
(scrib) and discs large (dlg) has been shown to
mediate its function at septate junctions to establish the basal domain in
epithelial cells (Bilder et al.,
2000
) (reviewed by Humbert et
al., 2003
; Tanentzapf and
Tepass, 2003
). Septate junctions are located basolaterally in
epithelial cells in Drosophila and are functionally analogous to the
apically localised tight junctions in vertebrate epithelia. The loss of
scrib and dlg function leads to the disruption of septate
junctions (Bilder and Perrimon,
2000
; Woods et al.,
1996
; Woods et al.,
1997
). However, Drosophila embryos lacking lgl
activity exhibit only a transient loss of cell polarity without affecting the
formation of septate junctions in the embryonic epidermis
(Tanentzapf and Tepass, 2003
).
This suggests that the function of lgl alone is not essential for
establishment or maintenance of the basal domain in the embryonic epidermis of
Drosophila. In vertebrates, Lgl2 localise basolaterally and involved
in defining the basolateral domain in epithelial cells of the frog blastula
(Chalmers et al., 2005
).
Furthermore, overexpression of lgl2 in these cells has been shown to
result in the loss of tight junctions
(Chalmers et al., 2005
).
Similarly, in MDCK cells, an in vitro model to study apicobasal polarity in
vertebrate epithelia, overexpression of lgl2 inhibits tight junction
formation through enhanced colocalisation of Lgl2 with apical Par 6ß
(Yamanaka et al., 2003
).
However, this effect of lgl2 overexpression on tight junctions has
been proposed to be secondary to the expansion of basolateral domain and loss
of the apical membrane domain (Chalmers et
al., 2005
). Our loss-of-function analysis has now clearly revealed
that in vertebrate epidermis, lgl2 has evolved an essential function
specifically in the formation of basally localised hemidesmosomes
(Fig. 2).
|
The loss of lgl function results in neoplastic growth of the brain
as well as imaginal discs in Drosophila larvae and also promotes
invasiveness (reviewed by Bilder,
2004
; Gateff,
1978
; Pagliarini and Xu,
2003
). These studies have led to the proposal that lgl
function would be essential in preventing cancer (reviewed by
Humbert et al., 2003
).
Consistent with this proposal, lgl1 knockout mice exhibit
hyper-proliferation of neuroblasts and the expression of lgl1 is
downregulated in various human carcinomas
(Grifoni et al., 2004
). The
function of lgl2 in tumour suppression or tissue growth regulation
has remained unknown. Our analysis has revealed that basal epidermal cells
hyperproliferate and seem to acquire migratory potential in the absence of
lgl2 function (Fig.
7). It is not clear whether epidermal cells migrate as a sheet in
pen mutant or whether they detach from each other and migrate.
However, the presence of desmosomes and adherens junctions in the mutant
epidermis favours the former possibility. Further in vivo imaging studies
would shed more light on the migratory behaviour and whether the migration is
directional or random. As pen phenotype is lethal, we could not test
whether the mutation in lgl2 would lead to tumour formation in the
epidermis or any other tissues. Interestingly, pen mutant larvae
exhibit overgrowth of the ventral jaw epidermis along with rounded up cells in
the fin fold (Fig. 2B). The
reason for this phenotype is not yet clear. It may be a consequence of
infiltration of the ventral jaw region by keratin containing
hyperproliferating basal epidermal cells of the dorsal and lateral epidermis.
Alternatively, this overgrowth may be a result of the hyper-proliferation of
ventral epidermal cells (Fig.
7D) or it could also be a combined effect of these two processes.
Indeed, lgl2 is expressed in the ventral epidermis as well as in the
fin fold epidermis (Fig. 5C;
data not shown), leading to the possibility that pen/lgl2 could also
be involved in maturation of the basal domain in basal cells of the ventral
epidermis and its loss may trigger the proliferative response. However, owing
to the unavailability of basally localised ultra-structural and/or protein
markers, we could not test this possibility. In any case, the pen
mutant would be an excellent model to analyse how and why the loss of
lgl2 function leads to hyper-proliferation and acquisition of
migratory potential, displayed by cancer cells.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/132/14/3255/DC1
| REFERENCES |
|---|
|
|
|---|
Bergstraesser, L. M., Srinivasan, G., Jones, J. C., Stahl, S. and Weitzman, S. A. (1995). Expression of hemidesmosomes and component proteins is lost by invasive breast cancer cells. Am. J. Pathol. 147,1823 -1839.[Abstract]
Betschinger, J., Mechtler, K. and Knoblich, J. A. (2003). The Par complex directs asymmetric cell division by phosphorylating the cytoskeletal protein Lgl. Nature 422,326 -330.[CrossRef][Medline]
Bilder, D. (2004). Epithelial polarity and
proliferation control: links from the Drosophila neoplastic tumor
suppressors. Genes Dev.
18,1909
-1925.
Bilder, D. and Perrimon, N. (2000). Localisation of apical epithelial determinants by the basolateral PDZ protein Scribble. Nature 403,676 -680.[CrossRef][Medline]
Bilder, D., Li, M. and Perrimon, N. (2000).
Cooperative regulation of cell polarity and growth by Drosophila tumor
suppressors. Science
289,113
-116.
Bilder, D., Schober, M. and Perrimon, N. (2003). Integrated activity of PDZ protein complexes regulates epithelial polarity. Nat. Cell Biol. 5, 53-58.[CrossRef][Medline]
Borradori, L. and Sonnenberg, A. (1996). Hemidesmosomes: roles in adhesion, signaling and human diseases. Curr. Opin. Cell Biol. 8, 647-656.[CrossRef][Medline]
Chalmers, A. D., Pambos, M., Mason, J., Lang, S., Wylie, C.
and Papalopulu, N. (2005). aPKC, Crumbs3 and Lgl2
control apicobasal polarity in early vertebrate development.
Development 132,977
-986.
Fuchs, E. and Raghavan, S. (2002). Getting under the skin of epidermal morphogenesis. Nat. Rev. Genet. 3,199 -209.[CrossRef][Medline]
Gateff, E. (1978). Malignant neoplasms of genetic origin in Drosophila melanogaster. Science 200,1448 -1459.
Geisler, R. (2002). Zebrafish: A practical approach. Oxford: Oxford University Press.
Grifoni, D., Garoia, F., Schimanski, C. C., Schmitz, G., Laurenti, E., Galle, P. R., Pession, A., Cavicchi, S. and Strand, D. (2004). The human protein Hugl-1 substitutes for Drosophila Lethal giant larvae tumour suppressor function in vivo. Oncogene 23,8688 -8694.[CrossRef][Medline]
Herold-Mende, C., Kartenbeck, J., Tomakidi, P. and Bosch, F. X. (2001). Metastatic growth of squamous cell carcinomas is correlated with upregulation and redistribution of hemidesmosomal components. Cell Tissue Res. 306,399 -408.[CrossRef][Medline]
Humbert, P., Russell, S. and Richardson, H. (2003). Dlg, Scribble and Lgl in cell polarity, cell proliferation and cancer. BioEssays 25,542 -553.[CrossRef][Medline]
Kagami, M., Toh-e, A. and Matsui, Y. (1998).
Sro7p, a Saccharomyces cerevisiae counterpart of the tumor suppressor l(2)gl
protein, is related to myosins in function. Genetics
149,1717
-1727.
Kiernan, J. A. (2001). Histological and Histochemical Methods: Theory and Practice. London: Arnold.
Klezovitch, O., Fernandez, T. E., Tapscott, S. J. and
Vasioukhin, V. (2004). Loss of cell polarity causes severe
brain dysplasia in Lgl1 knockout mice. Genes Dev.
18,559
-571.
Manfruelli, P., Arquier, N., Hanratty, W. P. and Semeriva, M. (1996). The tumor suppressor gene, lethal(2)giant larvae (1(2)g1), is required for cell shape change of epithelial cells during Drosophila development. Development 122,2283 -2294.[Abstract]
Mariotti, A., Kedeshian, P. A., Dans, M., Curatola, A. M.,
Gagnoux-Palacios, L. and Giancotti, F. G. (2001). EGF-R
signaling through Fyn kinase disrupts the function of integrin alpha6beta4 at
hemidesmosomes: role in epithelial cell migration and carcinoma invasion.
J. Cell Biol. 155,447
-458.
Musch, A., Cohen, D., Yeaman, C., Nelson, W. J.,
Rodriguez-Boulan, E. and Brennwald, P. J. (2002). Mammalian
homolog of Drosophila tumor suppressor lethal (2) giant larvae interacts with
basolateral exocytic machinery in Madin-Darby canine kidney cells.
Mol. Biol. Cell 13,158
-168.
Ohshiro, T., Yagami, T., Zhang, C. and Matsuzaki, F. (2000). Role of cortical tumour-suppressor proteins in asymmetric division of Drosophila neuroblast. Nature 408,593 -596.[CrossRef][Medline]
Pagliarini, R. A. and Xu, T. (2003). A genetic
screen in Drosophila for metastatic behaviour.
Science 302,1227
-1231.
Peng, C. Y., Manning, L., Albertson, R. and Doe, C. Q. (2000). The tumour-suppressor genes lgl and dlg regulate basal protein targeting in Drosophila neuroblasts. Nature 408,596 -600.[CrossRef][Medline]
Plant, P. J., Fawcett, J. P., Lin, D. C., Holdorf, A. D., Binns, K., Kulkarni, S. and Pawson, T. (2003). A polarity complex of mPar-6 and atypical PKC binds, phosphorylates and regulates mammalian Lgl. Nat. Cell Biol. 5, 301-308.[CrossRef][Medline]
Pulkkinen, L. and Uitto, J. (1999). Mutation analysis and molecular genetics of epidermolysis bullosa. Matrix Biol. 18,29 -42.[CrossRef][Medline]
Rabinovitz, I., Toker, A. and Mercurio, A. M.
(1999). Protein kinase C-dependent mobilization of the
alpha6beta4 integrin from hemidesmosomes and its association with actin-rich
cell protrusions drive the chemotactic migration of carcinoma cells.
J. Cell Biol. 146,1147
-1160.
Schenk, P. (1979). The fate of hemidesmosomes in laryngeal carcinoma. Arch. Otorhinolaryngol. 222,187 -198.[CrossRef][Medline]
Schulte-Merker, S. (2002). Zebrafish: A Practical Approach. Oxford, UK: Oxford University Press.
Shimoda, N., Knapik, E. W., Ziniti, J., Sim, C., Yamada, E., Kaplan, S., Jackson, D., de Sauvage, F., Jacob, H. and Fishman, M. C. (1999). Zebrafish genetic map with 2000 microsatellite markers. Genomics 58,219 -232.[CrossRef][Medline]
Strand, D., Raska, I. and Mechler, B. M.
(1994). The Drosophila lethal(2)giant larvae tumor suppressor
protein is a component of the cytoskeleton. J. Cell
Biol. 127,1345
-1360.
Strand, D., Unger, S., Corvi, R., Hartenstein, K., Schenkel, H., Kalmes, A., Merdes, G., Neumann, B., Krieg-Schneider, F., Coy, J. F. et al. (1995). A human homologue of the Drosophila tumour suppressor gene l(2)gl maps to 17p11.2-12 and codes for a cytoskeletal protein that associates with nonmuscle myosin II heavy chain. Oncogene 11,291 -301.[Medline]
Tanentzapf, G. and Tepass, U. (2003). Interactions between the crumbs, lethal giant larvae and bazooka pathways in epithelial polarization. Nat. Cell Biol. 5, 46-52.[CrossRef][Medline]
van Eeden, F. J., Granato, M., Schach, U., Brand, M., Furutani-Seiki, M., Haffter, P., Hammerschmidt, M., Heisenberg, C. P., Jiang, Y. J., Kane, D. A. et al. (1996). Genetic analysis of fin formation in the zebrafish, Danio rerio. Development 123,255 -262.[Abstract]
Woods, D. F., Hough, C., Peel, D., Callaini, G. and Bryant, P.
J. (1996). Dlg protein is required for junction structure,
cell polarity, and proliferation control in Drosophila epithelia.
J. Cell Biol. 134,1469
-1482.
Woods, D. F., Wu, J. W. and Bryant, P. J. (1997). Localization of proteins to the apico-lateral junctions of Drosophila epithelia. Dev. Genet. 20,111 -118.[CrossRef][Medline]
Yamanaka, T., Horikoshi, Y., Sugiyama, Y., Ishiyama, C., Suzuki, A., Hirose, T., Iwamatsu, A., Shinohara, A. and Ohno, S. (2003). Mammalian Lgl forms a protein complex with PAR-6 and aPKC independently of PAR-3 to regulate epithelial cell polarity. Curr. Biol. 13,734 -743.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
J. R. Mathias, M. E. Dodd, K. B. Walters, J. Rhodes, J. P. Kanki, A. T. Look, and A. Huttenlocher Live imaging of chronic inflammation caused by mutation of zebrafish Hai1 J. Cell Sci., October 1, 2007; 120(19): 3372 - 3383. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Carney, S. von der Hardt, C. Sonntag, A. Amsterdam, J. Topczewski, N. Hopkins, and M. Hammerschmidt Inactivation of serine protease Matriptase1a by its inhibitor Hai1 is required for epithelial integrity of the zebrafish epidermis Development, October 1, 2007; 134(19): 3461 - 3471. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Wilhelmsen, S. H.M. Litjens, and A. Sonnenberg Multiple Functions of the Integrin {alpha}6{beta}4 in Epidermal Homeostasis and Tumorigenesis Mol. Cell. Biol., April 15, 2006; 26(8): 2877 - 2886. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||