|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 29 June 2005
doi: 10.1242/dev.01903
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Program in Molecular Medicine, University of Massachusetts Medical School,
Worcester, MA 01605, USA
2 Department of Molecular Genetics and Microbiology, University of Massachusetts
Medical School, Worcester, MA 01605, USA
3 Department of Cell Biology, University of Massachusetts Medical School,
Worcester, MA 01605, USA
4 Program in Cell Dynamics, University of Massachusetts Medical School,
Worcester, MA 01605, USA
5 Center for Developmental Biology, University of Texas Southwestern Medical
Center, Dallas, TX 75390, USA
* Author for correspondence (e-mail: tony.ip{at}umassmed.edu)
Accepted 12 May 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Dorsal, Drosophila, Gastrulation, Snail, Toll, WntD
| Introduction |
|---|
|
|
|---|
Toll is a single-pass transmembrane receptor and is activated by a series
of upstream serine proteases that processes the ligand Spätzle
(Hashimoto et al., 1988
;
Hu et al., 2004
;
LeMosy et al., 1999
;
Morisato, 2001
;
Weber et al., 2003
). The
activated Toll recruits the cytoplasmic components MyD88, Tube and Pelle to
regulate the nuclear transport of the transcription factor Dorsal
(Charatsi et al., 2003
;
Kambris et al., 2003
;
Sun et al., 2004
). Dorsal, a
NF-
B homolog, is normally retained in the cytoplasm by Cactus, an
I
B homolog. Toll signaling causes the phosphorylation and degradation
of Cactus, thereby allowing Dorsal to enter the nucleus and regulate gene
expression (Belvin et al.,
1995
; Bergmann et al.,
1996
; Fernandez et al.,
2001
; Reach et al.,
1996
). These signaling components are ubiquitously distributed,
but the pathway is activated only in the ventral side of the embryo
(LeMosy et al., 1999
;
Roth, 2003
). Thus, activation
of Toll by the diffusible Spätzle leads to the formation of a nuclear
gradient of Dorsal, with the highest concentration in ventral nuclei
(Anderson, 1998
;
Roth, 2003
;
Roth et al., 1989
;
Rushlow et al., 1989
;
Stathopoulos and Levine, 2002
;
Steward, 1989
;
Wasserman, 2000
).
A single gradient of nuclear Dorsal can generate multiple patterns of
zygotic gene expression along the dorsoventral axis
(Jiang and Levine, 1993
;
Stathopoulos et al., 2002
).
Dorsal acts as both a transcriptional repressor and activator. For example,
zerknüllt and decapentaplegic are repressed by Dorsal
and therefore can be expressed only in the dorsal side of the embryo where the
dorsal ectoderm is formed (Huang et al.,
1993
; Ip et al.,
1991
; Jiang et al.,
1992
; Pan and Courey,
1992
). Meanwhile, Dorsal activates other zygotic genes, such as
twist, snail, rhomboid, short gastrulation, lethal of scute and
single-minded (sim). Depending on the affinity of the
Dorsal-binding sites and on the presence of co-activator sites on their
promoters, these target genes are activated by different thresholds of the
Dorsal gradient, and thus have ventral expression with variable lateral limits
(Stathopoulos and Levine,
2002
).
High levels of nuclear Dorsal activate the expression of twist and
snail, and the Dorsal/Twist/Snail network regulates ventral cell
invagination to form the mesoderm (Ip and
Gridley, 2002
; Leptin,
1999
; Stathopoulos and Levine,
2002
). In dorsal, twist or snail mutants, no
ventral invagination occurs and no mesodermal tissues are formed. Twist is a
basic helix-loop-helix transcription factor and acts as a co-activator for
Dorsal to optimally activate other zygotic target genes, including
snail. Snail contains five zinc fingers and functions as a
transcriptional repressor (Hemavathy et
al., 2000
; Nieto,
2002
). A model for this gene regulatory network in promoting
mesoderm formation is that Dorsal/Twist activates multiple zygotic genes that
are expressed in the ventral region with different lateral limits. These
target genes may promote the ventral (mesodermal) cell fate or the lateral
(neuroectodermal) cell fate. Snail specifically represses those genes that are
not compatible with mesoderm formation. Consistent with this model, many
genes, including rhomboid, sim, lethal of scute, short gastrulation,
crumbs, Delta and Enhancer of split, are repressed by Snail in
the ventral region and their expression is, therefore, restricted to the
lateral regions. In snail mutant embryos, these genes are
de-repressed into the ventral region. However, it has not been demonstrated
that any of these Snail target genes can directly inhibit ventral invagination
and mesoderm formation (Hemavathy et al.,
1997
).
To identify novel components in the dorsoventral pathway, we carried out a
microarray assay using embryos derived from gain-of-function and
loss-of-function mutants of the Toll pathway. Among the novel genes
identified, we analyzed the expression and function of wntD because
the Wnt family of secreted proteins regulates patterning, cell polarity and
cell movements (Nelson and Nusse,
2004
; Veeman et al.,
2003
). Our results show that wntD is activated by Dorsal
and Twist but repressed by Snail. Increased expression of WntD in wild-type
early embryos inhibits ventral invagination. Thus, wntD is the first
Snail target gene shown to have an interfering function in mesoderm
invagination. We also demonstrate that the overexpressed WntD blocks
invagination by inhibiting Dorsal nuclear localization. Loss-of-function
analyses also show that physiological levels of WntD can attenuate Dorsal
nuclear localization and function. Therefore, wntD is a novel
downstream gene of the Dorsal/Twist/Snail network and can feed back to inhibit
Dorsal.
| Materials and methods |
|---|
|
|
|---|
2-3 transposase helper plasmid into y w embryos. The
UAS-wntD flies used for most of the experiments were homozygous for
the transgenes on both second and third chromosomes. The pCaSpeR-wntD
transgenic flies and the Df(3R)l26c flies were mated with a double
balancer chromosome strain, and then mated together to establish a stable line
containing the homozygous rescue construct on the second chromosome and
Df(3R)l26c on the third chromosome, with a balancer. The
snailHG31, twistID96, dorsalH,
Df(2L)TW119, Toll10b, twistIIH snailIIG
double mutant, DeltaB2 and nanos-Gal4 stocks were
used.
Plasmids and cloning
OregonR genomic DNA was used as the template for PCR amplification of the
wntD ORF. To generate the pUAST-wntD for embryonic
expression experiments, the primers GATCGCGGCCGCTCAGTCGATCTAACGACATCGCAG and
GATCGGTACCGTTGTGGTAATAAATTAGAGGTGG were used to amplify the wntD ORF
together with 58 bp 5' and 117 bp 3' of the ORF. This fragment was
subcloned into the NotI and Asp718 sites of pBluescript
KS(+). This entire fragment was then excised with NotI and
Asp718, and subcloned into the NotI and Asp718
sites of pUAST. To generate the pCaSpeR-wntD genomic rescue
construct, a 5 kb genomic DNA region was amplified in two fragments using PCR.
The 5' fragment of 3184 bp was amplified using the primers
GATCGGTACCGATCTGGTCGGTGGCCTCTTCAAC and GATCGGTACCGTTGTGGTAATAAATTAGAGGTGG, and
then digested with Asp718 and NcoI. The 3' fragment of
2842 bp was amplified using the primers GATCGCGGCCGCTCAGTCGATCTAACGACATCGCAG
and GATCGCGGCCGCCAGACATCGACTTGTGCGACTGGC, and then digested with NcoI
and NotI. The fragments were then ligated into the Asp718
and NotI sites of pBluescript KS(+). The 5 kb genomic clone was then
digested with ApaI and AgeI and blunted with Klenow
polymerase. This yielded a 2721 bp fragment that included the wntD
ORF plus 1558 bp of 5' flanking sequence and 233 bp 3' flanking
sequence. This region does not contain any other annotated ORF. This 2721 bp
fragment was blunt-end ligated into the XbaI site of the pCaSpeR
vector.
Embryo in situ and antibody staining
Embryo in situ hybridization using digoxigenin-labeled probes was carried
out as previously described (Hemavathy et
al., 2004
; Hemavathy et al.,
1997
). Double in situ hybridization for the simultaneous detection
of snail and wntD transcripts was performed using
digoxigenin-labeled snail (diluted 1:200) and biotin-labeled
wntD (diluted 1:100) probes together during hybridization. After
washing with buffers, embryos were incubated overnight at 4°C with sheep
anti-digoxigenin Fab fragments conjugated to peroxidase (Roche, 1:1200
dilution). The peroxidase stain was developed using 0.5 mg/ml DAB in
1xPBS and 0.006% H2O2. Embryos were then washed
five times in 1xPBT to remove the DAB/H2O2. They
were incubated overnight with anti-Biotin Fab fragments conjugated to alkaline
phosphatase (Roche, 1:2000 dilution) at 4°C. The alkaline phosphatase
staining was developed with NBT/BCIP. Embryos were mounted in Permount and
visualized under Nomarski optics. The monoclonal antibody 7A4 was used to
stain for Dorsal, using the procedure as described
(Hemavathy et al., 2004
;
Hemavathy et al., 1997
). Goat
anti-mouse IgG (Fab fragments) conjugated with the Alexa 488 fluorochrome
(Molecular Probes) was used and the samples were mounted in Vectashield with
DAPI (Vector Laboratories).
| Results |
|---|
|
|
|---|
The predicted amino acid sequence of CG8458 has the closest homology to
cephalochordate Wnt8, chicken Wnt8C, and zebrafish Wnt8. Sequence alignment
and pair-wise comparison show that CG8458 is a distal member of this subfamily
(Fig. 1A,B). The average
identity between CG8458 and other Wnt8 molecules is approximately 27%, while
the identity among other members is higher than 50%. Nonetheless, 20 out of
the 22 characteristic cysteine residues of Wnt proteins are conserved in
CG8458 (Fig. 1A, asterisks).
FlyBase
(http://flybase.bio.indiana.edu/)
has named this gene Drosophila Wnt8. However, a recent report
suggests that this gene may not be an ortholog of vertebrate Wnt8 but
instead an orphan Wnt gene (Kusserow et
al., 2005
). Based on our functional analysis, we elected to use
the name Drosophila wntD for the annotated gene CG8458, and the
encoded protein WntD (Wnt inhibitor of Dorsal). A similar microarray analysis
was reported, but Drosophila wntD was not included probably because
of the different criteria used for selection
(Stathopoulos et al.,
2002
).
|
|
To understand the regulation of wntD, we analyzed its expression in various genetic mutants. No signal was observed in embryos derived from dorsal/ mothers (Fig. 2G), demonstrating that the expression in both the trunk and the poles is absolutely dependent on Dorsal. In embryos derived from Toll10b mothers, the expression of wntD was expanded into the dorsal side but the overall staining was not stronger than wild type (Fig. 2H), probably as a result of both activation by Dorsal and repression by Snail (see below). In conclusion, the mRNA staining in dorsal/ and Toll10b embryos corroborates the results of the microarray analysis.
In snail homozygous mutant embryos, a higher level of
wntD expression was present throughout the ventral region but
mesectodermal expression was not obvious
(Fig. 2J). We also observed
that in some heterozygous embryos there was normal mesectodermal staining but
higher ventral expression of wntD
(Fig. 2I). Gene expression in
the mesectoderm is regulated by a complex interaction between the Notch
pathway and Snail, such that the mesectodermal expression of sim also
requires the positive input of Snail
(Cowden and Levine, 2002
;
Morel et al., 2003
;
Morel and Schweisguth, 2000
).
The mesectodermal expression of wntD in both wild-type and
snail mutant embryos is similar to that of sim, suggesting
that wntD and sim are regulated by a similar mechanism. More
importantly, the results demonstrate that Snail also represses wntD
expression in the ventral cells.
In twist mutant embryos, wntD showed a narrower version
of the wild-type pattern, centered on the ventral midline
(Fig. 2K). The Snail pattern is
significantly reduced in twist mutant embryos
(Kosman et al., 1991
;
Leptin, 1991
;
Ray et al., 1991
). Therefore,
the narrower Wnt8 pattern in twist mutants can be explained
by the reduced expression of the repressor Snail. In twist snail
double-mutant embryos, the expression of wntD was weak and only
present in the ventral-most cells (Fig.
2L). We speculate that high levels of Dorsal are sufficient to
activate this weak expression of wntD in the ventral nuclei. However,
the overall ventral staining of wntD in the double mutant was much
weaker than that in snail mutants (compare with
Fig. 2J), suggesting that
wntD is weakly activated by Dorsal and strongly activated by
Dorsal/Twist cooperation, as has been shown for other target genes of the
dorsoventral pathway (Ip et al.,
1992b
; Jiang and Levine,
1993
; Shirokawa and Courey,
1997
). A stronger activation by the Dorsal/Twist combination may
also explain the detectable expression of wntD in the ventral cells
of wild-type embryos despite the repression by Snail. Within 1.6 kb of the
5' flanking sequence of wntD, there are seven sites that are
similar to the Snail-binding consensus and five sites that are similar to
Dorsal-binding consensus (data not shown). However, the demonstration of
whether wntD is a direct target requires further evidence.
wntD expression in the neuroectoderm depends on Delta. In zygotic
Delta mutant embryos, the early wntD pattern was largely
unaffected but the late pattern during germ-band extension was reduced and
subsequently lost (Fig. 2M,N).
Early embryos contain a significant maternal load of Delta gene
products. As a result, the expression of target genes such as sim
remains unaffected until later stages
(Martin-Bermudo et al., 1995
).
The regulation of wntD by Delta in the neuroectoderm may depend on a
similar mechanism.
Increased expression of WntD blocks presumptive mesoderm invagination
An essential biological function of the Dorsal/Twist/Snail network is to
promote invagination of the ventral cells to form the mesoderm
(Ip and Gridley, 2002
;
Leptin, 1999
;
Stathopoulos and Levine,
2002
). Although the repressor function of Snail is required for
ventral invagination, none of the known target genes normally repressed by
Snail has been directly implicated in disrupting ventral invagination
(Hemavathy et al., 2004
;
Hemavathy et al., 1997
).
Because wntD is repressed by Snail, we increased wntD
expression in wild-type embryos in an attempt to phenocopy the defects in
snail mutant embryos. The maternal nanos-Gal4 line was used
to direct the ubiquitous expression of UAS-wntD in early embryos. We
found that approximately 50% of these embryos at the gastrulation stage had
observable defects in ventral invagination. Approximately one quarter of these
defective embryos had completely lost the ventral furrow
(Fig. 3B), and the others
showed varying degrees of invagination with the anterior regions always being
worse than the posterior regions. The ventral invagination defect is not a
result of general problems in cell shape changes or cell movements because
cephalic furrow formation and germ-band extension occurred normally in these
embryos. Tissue sectioning confirmed the phenotype that the mesoderm was
largely missing in gastrulating embryos
(Fig. 3D).
The nanos-Gal4 female flies deposit maternally the Gal4
gene products, which direct the UAS-dependent WntD expression ubiquitously in
pre-blastoderm stage embryos. We also tested the
rhomboid-Gal4 driver; this rhomboid promoter
contains mutations in its Snail-binding sites and directs zygotic
Gal4 expression in the ventral half of the blastoderm
(Ip et al., 1992a
). In these
experiments, approximately 5% of embryos at gastrulation stage showed slightly
defective invagination (data not shown). The rhomboid promoter, as
well as other ventral zygotic promoters, is activated by Dorsal. Thus, the
expression of WntD by zygotic promoters may be too late to induce a
substantial phenotype. This speculation is consistent with the mechanism of
feedback inhibition of Dorsal by WntD as shown below.
|
|
|
Specific mutants of wntD are not yet available. Therefore, we
examined a few deficiency strains by staining for wntD mRNA
expression in the embryo and confirmed that Df(3R)l26c, which has the
87E1-87F11 region deleted, has uncovered wntD. We used this
deficiency to assess whether endogenous WntD regulates Dorsal. In wild-type
blastoderm, the Dorsal nuclear gradient extends into the neuroectoderm and the
posterior end (Stathopoulos and Levine,
2002
). Before the onset of gastrulation, the posterior Dorsal
staining is normally retracted (Fig.
4M-O). However, in embryos derived from the Df(3R)l26c
strain, Dorsal nuclear staining expanded in the posterior region
(Fig. 4P-R). Because the
earliest wntD expression is at the anterior and posterior regions
(Fig. 1C), the loss of
wntD in the deficiency could be the underlying reason for the
posterior expansion of Dorsal in these embryos.
WntD attenuates the function of Dorsal
The posterior expression of snail in wild-type embryos is
retracted and shows a sharp pattern before the onset of gastrulation
(Fig. 5A,B). snail
expression in Df(3R)l26c mutant embryos, however, expanded into the
posterior region (Fig. 5C,D).
Double staining shows that, in wild-type embryos, the posterior gene
huckebein is complementary to the snail pattern
(Fig. 5F). Moreover, we did not
detect a change in the huckebein pattern in the Df(3R)l26c
mutant embryos (data not shown). Using huckebein expression as a
position marker, we found that the snail pattern expanded into the
posterior region so that it overlapped with that of huckebein in the
deficiency mutant embryo (Fig.
5E). Quantitation by using the snail pattern revealed
that 24% (n=55) of all gastrulating embryos from Df(3R)l26c
heterozygous parents showed the posterior expansion. Based on Mendelian
ratios, this result represents an almost full penetrance. Thus, there is a
posterior expansion of snail expression that correlates with the
posterior expansion of nuclear Dorsal shown in
Fig. 4. Subtle broadening of
the snail pattern was also observed in the anterior region
(Fig. 5C,D), suggesting that
there is an increase of nuclear Dorsal in the anterior region, but the
increase was not detectable by immunofluorescence staining.
Because Df(3R)l26c removes a number of genes in addition to wntD, we performed a genetic rescue experiment to confirm the involvement of wntD. We generated a transgenic line that contained a wntD genomic fragment, which showed all the normal expression patterns of wntD in the early embryo (data not shown). When we crossed this genomic construct into the Df(3R)l26c mutant, the posterior and anterior expansion phenotype of snail was completely rescued (Fig. 5G). We also did not observe posterior Dorsal expansion in any of the embryos derived from the wntD-rescued Df(3R)l26c strain (data not shown). The rescue experiment demonstrates that the deletion of wntD in the deficiency strain is responsible for the observed Dorsal and snail expression phenotypes. We also performed RNA interference of wntD by injecting double-stranded RNA into wild-type pre-blastoderm stage embryos. Approximately 10% of these injected embryos at late blastoderm stage had a mild posterior expansion of snail (Fig. 5I,J), and none of the embryos injected with buffer alone showed such a phenotype. This result further supports the idea that loss of WntD causes posterior expansion of snail expression.
|
|
| Discussion |
|---|
|
|
|---|
The wntD loss-of-function phenotype correlates with the expression
of wntD at the poles of pre-cellular blastoderms
(Fig. 1C). wntD is
also expressed a bit later in the mesectoderm, and weakly in the mesoderm.
Because WntD can inhibit Dorsal, one speculation is that WntD in the early
mesectoderm may help to establish the sharp snail expression at the
mesectoderm-neuroectoderm boundary (Kosman
et al., 1991
). However, we did not detect any changes in the
Dorsal protein gradient or snail pattern in the trunk regions of the
Df(3R)l26c embryos. We speculate that the timing of early expression
of wntD, which may have additional input from the Torso pathway at
the poles, is important for the feedback inhibition of Dorsal. By the time of
cellularization, the Dorsal protein gradient is well established. This
well-established Dorsal gradient activates the wntD gene in the trunk
regions, but the subsequently translated WntD protein may not be capable of
exerting a strong negative-feedback effect on the already formed Dorsal
gradient. This timing argument is supported by the results of
WntD-overexpression experiments. The use of maternal nanos-Gal4
caused a strong inhibition of Dorsal nuclear localization and of ventral
invagination, whereas the use of zygotic promoters did not result in a
significant phenotype.
Snail acts as a transcriptional repressor for at least 10 genes in the
ventral region where mesoderm arises
(Hemavathy et al., 2000
;
Kosman et al., 1991
;
Leptin, 1991
;
Ray et al., 1991
). In
snail mutant embryos, all of these target genes are de-repressed in
the ventral cells, concomitant with severe ventral invagination defects.
However, no direct evidence has been reported on whether these de-repressed
genes interfere with invagination
(Hemavathy et al., 2004
;
Hemavathy et al., 1997
). We
show here for the first time that a target gene of Snail, namely
wntD, can block ventral invagination when overexpressed. If
de-repressed WntD is solely responsible for inhibiting ventral invagination,
we would expect that, in the snail;Df(3R)l26c double-mutant embryos,
ventral invagination will appear again. We did not observe a rescue of ventral
invagination in the double-mutant embryos
(Fig. 6), suggesting that
wntD is not the only de-repressed target gene that inhibits
invagination. Nonetheless, the de-repressed WntD can attenuate Dorsal function
(Fig. 6), and may contribute to
the ventral invagination defect.
Previous reports have shown that overexpression of String/Cdc25 leads to
early mitosis in the ventral cells and a block in ventral invagination
(Grosshans and Wieschaus, 2000
;
Mata et al., 2000
;
Seher and Leptin, 2000
). The
zygotic transcription of string in the ventral region is activated by
the Dorsal/Twist/Snail network. Meanwhile, the String protein is kept at a low
level in the ventral cells by Tribbles through protein degradation, and this
process requires the positive input of Snail
(Grosshans and Wieschaus, 2000
;
Mata et al., 2000
;
Seher and Leptin, 2000
).
Therefore, in the snail;Df(3R)l26c double-mutant embryos, the ventral
cells should have increased String protein, as well as many other de-repressed
gene products (Fig. 7). Perhaps
the cumulative effect contributed by many of these snail target genes
causes the severe invagination defect observed in the snail mutant
embryo (Hemavathy et al.,
2004
); the simultaneous deletion of wntD and other
interfering genes may be required to suppress the ventral invagination
phenotype in snail mutants.
WntD may inhibit a component in the Toll pathway, or a component in the
nuclear import/export pathway, leading to the cytoplasmic localization of
Dorsal. However, the downstream mediators of Drosophila WntD
signaling are not known. Being the closest homologs of Drosophila
WntD, vertebrate Wnt8 proteins regulate mesoderm patterning, neural crest cell
induction, neuroectoderm patterning, and axis formation
(Hoppler and Moon, 1998
;
Lekven et al., 2001
;
Lewis et al., 2004
;
Popperl et al., 1997
). These
vertebrate Wnt8 proteins may transmit the signal through the canonical
pathway, but the exact mechanism remains unclear
(Lekven et al., 2001
;
Lewis et al., 2004
;
Momoi et al., 2003
). We
examined Drosophila embryos that lacked maternal and zygotic
functions of both Frizzled 1 and Frizzled 2 but did not observe any obvious
defects in Dorsal or snail expression. A similar experiment using a
dishevelled null mutant also did not reveal any such defects (data
not shown). Furthermore, overexpression of Dishevelled or dominant-negative
Gsk3 did not cause a detectable change of dorsoventral patterning (data not
shown). These results suggest that Drosophila WntD may use other
components for signaling. Wnt molecules employ multiple receptors and pathways
to regulate various processes (Nelson and
Nusse, 2004
; Veeman et al.,
2003
). For example, Drosophila Wnt5 interacts with the
receptor tyrosine kinase Derailed to regulate axon guidance
(Yoshikawa et al., 2003
).
There are seven Wnt proteins and five Frizzled receptors in
Drosophila, and WntD showed detectable affinity towards Frizzled 4 in
cell culture assays (Wu and Nusse,
2002
), but the in vivo relevance of this interaction is not clear.
It is important to elucidate how Drosophila WntD transmits its
signal. Equally important is to find out whether WntD interacts with the Toll
pathway, and whether the interaction also occurs in processes such as the
immune response and cancer progression in other organisms.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Anderson, K. V. (1998). Pinning down positional information: dorsal-ventral polarity in the Drosophila embryo. Cell 95,439 -442.[CrossRef][Medline]
Belvin, M. P., Jin, Y. and Anderson, K. V.
(1995). Cactus protein degradation mediates Drosophila
dorsal-ventral signaling. Genes Dev.
9, 783-793.
Bergmann, A., Stein, D., Geisler, R., Hagenmaier, S., Schmid, B., Fernandez, N., Schnell, B. and Nusslein-Volhard, C. (1996). A gradient of cytoplasmic Cactus degradation establishes the nuclear localization gradient of the dorsal morphogen in Drosophila. Mech. Dev. 60,109 -123.[CrossRef][Medline]
Charatsi, I., Luschnig, S., Bartoszewski, S., Nusslein-Volhard, C. and Moussian, B. (2003). Krapfen/dMyd88 is required for the establishment of dorsoventral pattern in the Drosophila embryo. Mech. Dev. 120,219 -226.[CrossRef][Medline]
Cowden, J. and Levine, M. (2002). The Snail
repressor positions Notch signaling in the Drosophila embryo.
Development 129,1785
-1793.
Eisenberg, L. M., Ingham, P. W. and Brown, A. M. (1992). Cloning and characterization of a novel Drosophila Wnt gene, Dwnt-5, a putative downstream target of the homeobox gene distal-less. Dev. Biol. 154, 73-83.[CrossRef][Medline]
Fernandez, N. Q., Grosshans, J., Goltz, J. S. and Stein, D.
(2001). Separable and redundant regulatory determinants in Cactus
mediate its dorsal group dependent degradation.
Development 128,2963
-2974.
Graba, Y., Gieseler, K., Aragnol, D., Laurenti, P., Mariol, M. C., Berenger, H., Sagnier, T. and Pradel, J. (1995). DWnt-4, a novel Drosophila Wnt gene acts downstream of homeotic complex genes in the visceral mesoderm. Development 121,209 -218.[Abstract]
Grosshans, J. and Wieschaus, E. (2000). A genetic link between morphogenesis and cell division during formation of the ventral furrow in Drosophila. Cell 101,523 -531.[CrossRef][Medline]
Hashimoto, C., Hudson, K. L. and Anderson, K. V. (1988). The Toll gene of Drosophila, required for dorsal-ventral embryonic polarity, appears to encode a transmembrane protein. Cell 52,269 -279.[CrossRef][Medline]
Hemavathy, K., Meng, X. and Ip, Y. T. (1997). Differential regulation of gastrulation and neuroectodermal gene expression by Snail in the Drosophila embryo. Development 124,3683 -3691.[Abstract]
Hemavathy, K., Ashraf, S. I. and Ip, Y. T. (2000). Snail/slug family of repressors: slowly going into the fast lane of development and cancer. Gene 257, 1-12.[CrossRef][Medline]
Hemavathy, K., Hu, X., Ashraf, S. I., Small, S. J. and Ip, Y. T. (2004). The repressor function of Snail is required for Drosophila gastrulation and is not replaceable by Escargot or Worniu. Dev. Biol. 269,411 -420.[CrossRef][Medline]
Hoppler, S. and Moon, R. T. (1998). BMP-2/-4 and Wnt-8 cooperatively pattern the Xenopus mesoderm. Mech. Dev. 71,119 -129.[CrossRef][Medline]
Hu, X., Yagi, Y., Tanji, T., Zhou, S. and Ip, Y. T.
(2004). Multimerization and interaction of Toll and Spatzle in
Drosophila. Proc. Natl. Acad. Sci. USA.
101,9369
-9374.
Huang, J. D., Schwyster, D. H., Shirokawa, J. M. and Courey, A.
J. (1993). The interplay between multiple enhancer and
silencer elements defines the pattern of decapentaplegic expression.
Genes Dev. 7,694
-704.
Ip, Y. T. and Gridley, T. (2002). Cell movements during gastrulation: snail dependent and independent pathways. Curr. Opin. Genet. Dev. 12,423 -429.[CrossRef][Medline]
Ip, Y. T., Kraut, R., Rushlow, C. A. and Levine, M. (1991). The dorsal morphogen is a sequence-specific DNA-binding protein that interacts with a long-range repression element in Drosophila. Cell 64,439 -446.[CrossRef][Medline]
Ip, Y. T., Park, R. E., Kosman, D., Bier, E. and Levine, M.
(1992a). The dorsal gradient morphogen regulates stripes
of rhomboid expression in the presumptive neuroectoderm of the
Drosophila embryo. Genes Dev.
6,1728
-1739.
Ip, Y. T., Park, R. E., Kosman, D., Yazdanbakhsh, K. and Levine,
M. (1992b). dorsal-twist interactions establish
snail expression in the presumptive mesoderm of the
Drosophila embryo. Genes Dev.
6,1518
-1530.
Janson, K., Cohen, E. D. and Wilder, E. L. (2001). Expression of DWnt6, DWnt10, and DFz4 during Drosophila development. Mech. Dev. 103,117 -120.[CrossRef][Medline]
Jiang, J. and Levine, M. (1993). Binding affinities and cooperative interactions with bHLH activators delimit threshold responses to the dorsal gradient morphogen. Cell 72,741 -752.[CrossRef][Medline]
Jiang, J., Kosman, D., Ip, Y. T. and Levine, M.
(1991). The dorsal morphogen gradient regulates the
mesoderm determinant twist in early Drosophila embryos.
Genes Dev. 5,1881
-1891.
Jiang, J., Rushlow, C. A., Zhou, Q., Small, S. and Levine, M. (1992). Individual dorsal morphogen binding sites mediate activation and repression in the Drosophila embryo. EMBO J. 11,3147 -3154.[Medline]
Kambris, Z., Bilak, H., D'Alessandro, R., Belvin, M., Imler, J. L. and Capovilla, M. (2003). DmMyD88 controls dorsoventral patterning of the Drosophila embryo. EMBO Rep. 4,64 -69.[CrossRef][Medline]
Kasai, Y., Nambu, J. R., Lieberman, P. M. and Crews, S. T.
(1992). Dorsal-ventral patterning in Drosophila: DNA
binding of Snail protein to the single-minded gene. Proc.
Natl. Acad. Sci. USA 89,3414
-3418.
Kosman, D., Ip, Y. T., Levine, M. and Arora, K.
(1991). Establishment of the mesoderm-neuroectoderm boundary in
the Drosophila embryo. Science
254,118
-122.
Kusserow, A., Pang, K., Sturm, C., Hrouda, M., Lentfer, J., Schmidt, H. A., Technau, U., von Haesler, A., Hobmayer, B., Martindale, M. Q. and Holstein, T. W. (2005). Unexpected complexity of the Wnt gene family in a sea anemone. Nature 433,156 -160.[CrossRef][Medline]
Lekven, A. C., Thorpe, C. J., Waxman, J. S. and Moon, R. T. (2001). Zebrafish wnt8 encodes two wnt8 proteins on a bicistronic transcript and is required for mesoderm and neurectoderm patterning. Dev. Cell. 1,103 -114.[CrossRef][Medline]
LeMosy, E. K., Hong, C. C. and Hashimoto, C. (1999). Signal transduction by a protease cascade. Trends Cell Biol. 9,102 -107.[CrossRef][Medline]
Leptin, M. (1991). twist and
snail as positive and negative regulators during Drosophila
mesoderm development. Genes Dev.
5,1568
-1576.
Leptin, M. (1999). Gastrulation in Drosophila: the logic and the cellular mechanisms. EMBO J. 18,3187 -3192.[CrossRef][Medline]
Lewis, J. L., Bonner, J., Modrell, M., Ragland, J. W., Moon, R.
T., Dorsky, R. I. and Raible, D. W. (2004). Reiterated
Wnt signaling during zebrafish neural crest development.
Development 131,1299
-1308.
Martin-Bermudo, M. D., Carmena, A. and Jimenez, F. (1995). Neurogenic genes control gene expression at the transcriptional level in early neurogenesis and in mesectoderm specification. Development 121,219 -224.[Abstract]
Mata, J., Curado, S., Ephrussi, A. and Rorth, P. (2000). Tribbles coordinates mitosis and morphogenesis in Drosophila by regulating string/CDC25 proteolysis. Cell 101,511 -522.[CrossRef][Medline]
Momoi, A., Yoda, H., Steinbeisser, H., Fagotto, F., Kondoh, H., Kudo, A., Driever, W. and Furutani-Seiki, M. (2003). Analysis of Wnt8 for neural posteriorizing factor by identifying Frizzled 8c and Frizzled 9 as functional receptors for Wnt8. Mech. Dev. 120,477 -489.[CrossRef][Medline]
Morel, V. and Schweisguth, F. (2000).
Repression by suppressor of hairless and activation by Notch are required to
define a single row of single-minded expressing cells in the
Drosophila embryo. Genes Dev.
14,377
-388.
Morel, V., Le Borgne, R. and Schweisguth, F. (2003). Snail is required for Delta endocytosis and Notch-dependent activation of single-minded expression. Dev. Genes Evol. 213,65 -72.[Medline]
Morisato, D. (2001). Spatzle regulates the shape of the Dorsal gradient in the Drosophila embryo. Development 128,2309 -2319.
Nelson, W. J. and Nusse, R. (2004). Convergence
of Wnt, beta-catenin, and cadherin pathways. Science
303,1483
-1487.
Nieto, M. A. (2002). The snail superfamily of zinc-finger transcription factors. Nat. Rev. Mol. Cell. Biol. 3,155 -166.[CrossRef][Medline]
Pan, D. and Courey, A. J. (1992). The same dorsal binding site mediates both activation and repression in a context-dependent manner. EMBO J. 11,1837 -1842.[Medline]
Popperl, H., Schmidt, C., Wilson, V., Hume, C. R., Dodd, J., Krumlauf, R. and Beddington, R. S. (1997). Misexpression of Cwnt8C in the mouse induces an ectopic embryonic axis and causes a truncation of the anterior neuroectoderm. Development 124,2997 -3005.[Abstract]
Ray, R. P., Arora, K., Nusslein-Volhard, C. and Gelbart, W. M. (1991). The control of cell fate along the dorsal-ventral axis of the Drosophila embryo. Development 113, 35-54.[Abstract]
Reach, M., Galindo, R. L., Towb, P., Allen, J. L., Karin, M. and Wasserman, S. A. (1996). A gradient of cactus protein degradation establishes dorsoventral polarity in the Drosophila embryo. Dev. Biol. 180,353 -364.[CrossRef][Medline]
Roth, S. (2003). The origin of dorsoventral polarity in Drosophila. Philos. Trans. R. Soc. London 358,1317 -1329.
Roth, S., Stein, D. and Nusslein-Volhard, C. (1989). A gradient of nuclear localization of the dorsal protein determines dorsoventral pattern in the Drosophila embryo. Cell 59,1189 -1202.[CrossRef][Medline]
Rushlow, C. A., Han, K., Manley, J. L. and Levine, M. (1989). The graded distribution of the dorsal morphogen is initiated by selective nuclear transport in Drosophila. Cell 59,1165 -1177.[CrossRef][Medline]
Russell, J., Gennissen, A. and Nusse, R. (1992). Isolation and expression of two novel Wnt/wingless gene homologues in Drosophila. Development 115,475 -485.[Abstract]
Schneider, D. S., Hudson, K. L., Lin, T. Y. and Anderson, K.
V. (1991). Dominant and recessive mutations define functional
domains of Toll, a transmembrane protein required for dorsal-ventral polarity
in the Drosophila embryo. Genes Dev.
5, 797-807.
Seher, T. C. and Leptin, M. (2000). Tribbles, a cell-cycle brake that coordinates proliferation and morphogenesis during Drosophila gastrulation. Curr. Biol. 10,623 -629.[CrossRef][Medline]
Shirokawa, J. M. and Courey, A. J. (1997). A direct contact between the dorsal rel homology domain and Twist may mediate transcriptional synergy. Mol. Cell. Biol. 17,3345 -3355.[Abstract]
Stathopoulos, A. and Levine, M. (2002). Dorsal gradient networks in the Drosophila embryo. Dev. Biol. 246,57 -67.[CrossRef][Medline]
Stathopoulos, A., Van Drenth, M., Erives, A., Markstein, M. and Levine, M. (2002). Whole-genome analysis of dorsal-ventral patterning in the Drosophila embryo. Cell 111,687 -701.[CrossRef][Medline]
Steward, R. (1989). Relocalization of the dorsal protein from the cytoplasm to the nucleus correlates with its function. Cell 59,1179 -1188.[CrossRef][Medline]
Sun, H., Towb, P., Chiem, D. N., Foster, B. A. and Wasserman, S. A. (2004). Regulated assembly of the Toll signaling complex drives Drosophila dorsoventral patterning. EMBO J. 23,100 -110.[CrossRef][Medline]
Veeman, M. T., Axelrod, J. D. and Moon, R. T. (2003). A second canon. Functions and mechanisms of beta-catenin-independent Wnt signaling. Dev. Cell. 5, 367-377.[CrossRef][Medline]
Wasserman, S. A. (2000). Toll signaling: the enigma variations. Curr. Opin. Genet. Dev. 10,497 -502.[CrossRef][Medline]
Weber, A. N., Tauszig-Delamasure, S., Hoffmann, J. A., Lelievre, E., Gascan, H., Ray, K. P., Morse, M. A., Imler, J. L. and Gay, N. J. (2003). Binding of the Drosophila cytokine Spatzle to Toll is direct and establishes signaling. Nat. Immunol. 4,794 -800.[CrossRef][Medline]
Wu, C.-H. and Nusse, R. (2002). Ligand receptor
interactions in the Wnt signaling pathway in Drosophila.
J. Biol. Chem. 277,41762
-41769.
Yoshikawa, S., McKinnon, R. D., Kokel, M. and Thomas, J. B. (2003). Wnt-mediated axon guidance via the Drosophila Derailed receptor. Nature 422,583 -588.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
H.-F. Yuen, W.-K. Kwok, K.-K. Chan, C.-W. Chua, Y.-P. Chan, Y.-Y. Chu, Y.-C. Wong, X. Wang, and K.-W. Chan TWIST modulates prostate cancer cell-mediated bone cell activity and is upregulated by osteogenic induction Carcinogenesis, August 1, 2008; 29(8): 1509 - 1518. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Dionne and D. S. Schneider Models of infectious diseases in the fruit fly Drosophila melanogaster Dis. Model. Mech., July 1, 2008; 1(1): 43 - 49. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Ching, H. C. Hang, and R. Nusse Lipid-independent Secretion of a Drosophila Wnt Protein J. Biol. Chem., June 20, 2008; 283(25): 17092 - 17098. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. R. Copley, M. Totrov, J. Linnell, S. Field, J. Ragoussis, and I. A. Udalova Functional conservation of Rel binding sites in drosophilid genomes Genome Res., September 1, 2007; 17(9): 1327 - 1335. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zeitlinger, R. P. Zinzen, A. Stark, M. Kellis, H. Zhang, R. A. Young, and M. Levine Whole-genome ChIP-chip analysis of Dorsal, Twist, and Snail suggests integration of diverse patterning processes in the Drosophila embryo Genes & Dev., February 15, 2007; 21(4): 385 - 390. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sandmann, C. Girardot, M. Brehme, W. Tongprasit, V. Stolc, and E. E.M. Furlong A core transcriptional network for early mesoderm development in Drosophila melanogaster Genes & Dev., February 15, 2007; 21(4): 436 - 449. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Biemar, D. A. Nix, J. Piel, B. Peterson, M. Ronshaugen, V. Sementchenko, I. Bell, J. R. Manak, and M. S. Levine Comprehensive identification of Drosophila dorsal-ventral patterning genes using a whole-genome tiling array PNAS, August 22, 2006; 103(34): 12763 - 12768. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||