|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 6 July 2005
doi: 10.1242/dev.01919
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Molecular Genetics, University of Texas, M. D. Anderson Cancer
Center, Houston TX 77030, USA
2 Institute of Zoology, Jagiellonian University, ul. Ingardena 6, 30-060 Krakow,
Poland
3 Public Health Research Institute, Department of Molecular Genetics, 225 Warren
Street, Newark, NJ 07103, USA
* Author for correspondence (e-mail: lde{at}mdanderson.org)
Accepted 25 May 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Localized RNA, Structural role of RNA, Cytokeratin, Germ plasm, Xenopus
| Introduction |
|---|
|
|
|---|
In Xenopus laevis, Vg1 was the first mRNA identified that was
localized at the oocyte vegetal cortex
(Rebagliati et al., 1985
).
Now, many different RNAs are known to be localized at the vegetal cortex
(Bashirullah et al., 1998
;
King et al., 1999
;
Kloc et al., 2002b
;
Palacios and St. Johnston,
2001
). Localized RNAs such as Vg1
(Joseph and Melton, 1998
;
Kessler and Melton, 1995
); the
Xenopus homolog of Bicaudal-C (Wessely and de Robertis, 2000); and
the T-box family member VegT (Xanthos et
al., 2001
; Zhang and King,
1996
) are involved in mesoderm and/or endoderm formation.
Recently, Hermes was shown to regulate the cleavages of the vegetal
blastomeres (Zearfoss et al.,
2004
). Xcat2 and Xpat mRNAs are thought to have functions specific
to germ cells because of their association with germ plasm, which contains the
germ cell determinants within structures called germinal granules
(Yisraeli et al., 1990
;
Kloc and Etkin, 1995
;
Forristall et al., 1995
;
Kloc et al., 1998
;
Kloc et al., 2002a
).
Localized RNAs co-fractionate and co-immunoprecipitate with cytoskeletal
elements that serve in both RNA transport and anchoring
(Alarcon and Elinson, 2001
;
Boccaccio et al., 1999
;
Elinson et al., 1993
;
Forristall et al., 1995
;
Jankovics et al., 2002
;
Klymkowsky et al., 1991
;
Marikawa et al., 1997
;
Pondel and King, 1988
;
Shan et al., 2003
;
Stebbings, 2001
;
Yisraeli et al., 1990
; Zhao et
al., 1991). Interestingly, a noncoding RNA, Xlsirts
(Kloc and Etkin, 1994
) and
VegT mRNA (Heasman et al.,
2001
; Zhang and King,
1996
), when destroyed with antisense oligonucleotides (ODNs),
caused release of specific RNAs from the vegetal cortex. The present study
demonstrates that VegT and Xlsirts RNAs are integrated within the cytokeratin
cytoskeleton and that destruction of these RNAs disrupts the cytoskeleton in
specific ways resulting in the release of several different RNAs. This
suggests the intriguing possibility that both coding and noncoding RNAs may
have several roles, including structural organization of the vegetal cortex in
Xenopus oocytes.
| Materials and methods |
|---|
|
|
|---|
Northern blot
Total RNA was prepared from control and antisense Xpat ODN-injected stage
VI oocytes (100 oocytes in each group) using Trizol (Invitrogen) according to
manufacturer protocol. Poly(A) RNA was isolated from total RNA using
Poly(A)purist kit from Ambion. Northern blot was prepared according to
standard methods and hybridized to digoxigenin-labeled antisense Xpat RNA
probe synthesized from Xpat 3'UTR (Xpat3'UTR in Bluescript was a
gift from Hugh Woodland, University of Warwick, UK), and antisense Xcat2 probe
synthesized from Xcat2-Sport (gift from M. L. King, University of Miami, FL)
in ULTRAhyb buffer (Ambion) according to manufacturer protocol.
Antisense oligonucleotides
We injected 10 ng per oocyte of phosphorothioated oligonucleotides
(synthesized by Sigma Genosys, Woodlands, TX; modified bases marked by the *)
of the following sequences: antisense VegT, 5'
C*A*G*C*AGCATGTACT*T*G*G*C 3' (Zhang et al., 1998;
Heasman et al., 2001
);
antisense Xlsirts 1, 5' C*A*G*GTATAGTAGGG*A*G*A 3'
(Kloc and Etkin, 1994
);
antisense Xlsirts 2, 5' T*C*T*CTGGGAAGGGA*G*T*G 3'
(Kloc and Etkin, 1994
);
antisense XlCaax, 5' C*T*G*CGCTTAGAGAA*C*C*C 3'
(Kloc and Etkin, 1994
);
antisense Xpat, 5' T*T*C*T*GCCTTCAAAGCCAT*A*G*A 3'; sense VegT,
GC*C*A*A*GTACATGCT*G*C*T*G; sense XlCaax, CG*G*T*TCTCTAAGCG*C*A*G; sense
Xlsirts 1:TC*T*C*CCTACTATA*C*C*TG; sense Xlsirts 2, CA*C*T*CCCTTCCCAG*A*G*A
(Kloc and Etkin, 1994
); VegT
morpholino, 5'CCCGACAGCAGTTTCTCATTCCAGC 3' injected at 30 ng (in
10 nl) per oocyte (see Heasman et al.,
2001
).
Molecular beacons
Molecular beacons, with 2'-O-methylribonucleotide backbone and Texas Red at
the 5' end and BHQ2 (Black hole quencher 2) at the 3' end were
synthesized as in Bratu et al. (Bratu et
al., 2003
). The molecular beacon oligonucleotides of the following
sequences were injected into the oocytes (10 ng in 10 nl): VegT, 5'
cacacCAGCAGCATGTACTTGGCgtgtg 3'; a 1:1 mixture of Xlsirts
number 1 (5' cacactCAGGTATAGTAGGGAGAgtgtg 3') and
Xlsirts number 2 (5' caagtTCTCTGGGAAGGGAGTGacttg
3'); and Xpat, 5' caagt TTCTGCCTTCAAAGCCATAGAacttg
3' (the bold nucleotides are the arm sequences). Injected oocytes were
incubated in OCM for 4-6 hours at 18°C. Then, 1 nl of an
anti-pancytokeratin-FITC antibody (C11 antibody, Sigma) was injected into
oocytes, and the vegetal tip of the oocyte was immediately cut off, mounted in
PBS on a microscope slide under a coverslip and observed under a Nikon
fluorescence microscope within 15-30 minutes of C11-FITC injection.
Host transfer and rescue
Host transfer and rescue was carried out according to Heasman et al.
(Heaseman et al., 1991) and Zearfoss et al.
(Zearfoss et al., 2004
).
Cytoskeleton staining
Actin was stained using rhodamine-phalloidin (Molecular Probes)
(Kloc et al., 2004
).
Cytokeratin immunostaining was carried out according to the method of Alarcon
and Elinson (Alarcon and Elinson,
2001
).
In situ hybridization
Light and electron microscopy of whole-mount in situ hybridization of
oocytes and embryos were performed as described by Kloc and Etkin
(Kloc and Etkin, 1994
) and
Kloc et al. (Kloc et al.,
2002a
).
| Results |
|---|
|
|
|---|
|
|
The depletion of Xlsirts or VegT RNA with specific ODNs in stage VI oocytes caused the disruption of the cytokeratin network at the oocyte vegetal cortex (Fig. 2A). Interestingly, the effects of VegT depletion and Xlsirts depletion were different. Destruction of Xlsirts RNA caused a very pronounced `thinning' or `flattening' of the cytokeratin network and its collapse inward towards the yolk mass (Fig. 2A, part 4). The cytokeratin network looked well organized but much thinner and less `three dimensional' than the network in control oocytes, and, in contrast to the control oocytes, the yolk platelets were clearly visible below the cytokeratin network (Fig. 2A, part 4). Destruction of VegT mRNA resulted in fragmentation and disruption of the cytokeratin network (Fig. 2A, part 7).
To analyze the effect of destruction of Xlsirts and VegT RNAs during the processes of maturation and activation, the antisense ODNs were injected into stage VI oocytes, and injected oocytes were incubated for 24 hours, matured by addition of progesterone and activated by pricking. After maturation, cytokeratin foci were sporadically visible in antisense Xlsirts eggs and very rarely visible or not visible at all in antisense VegT egg (Fig. 2A, parts 5 and 8). Upon activation, the cytokeratin network was partially reconstituted in antisense Xlsirts-injected eggs but was less regular than the network in control eggs (Fig. 2A, part 6). However, in antisense VegT activated eggs the cytokeratin network was not reconstituted, and only a few short cytokeratin filaments were visible (Fig. 2A, part 9).
Destruction of vegetally localized Xpat mRNA, a non-localized RNA XlCaax,
and sense oligonucleotides against all of the RNAs had no effect on the
appearance of the cytokeratin network (Fig.
2B, parts 1 and 2). Injection of VegT morpholino that inhibits
translation of VegT protein (Heasman et
al., 2001
) had no effect on the cytokeratin network in stage VI
oocytes (Fig. 2B3) or during
maturation and activation (data not shown). These findings support the
conclusion that disruption of the cytokeratin network in oocytes injected with
antisense VegT oligonucleotides is due to elimination of RNA and not protein.
In addition, no noticeable effect on the cortical actin microfilament
cytoskeleton was observed in oocytes, maturing oocytes or activated eggs when
XlCaax, Xlsirts or VegT was depleted (data not shown).
|
40 minutes. after the injection of antibody,
the network started to disintegrate and, after 3 hours, its remnants were
visible as the brightly fluorescing foci
(Fig. 3B). When
antibody-injected oocytes were matured overnight, the cytokeratin foci,
similar to the punctate foci observed in control matured oocytes were visible
(Fig. 3C). Following
activation, the cytokeratin partially reformed into short filaments, but in
contrast to control activated eggs, it did not reform the network-like
arrangement (Fig. 3D). These
results showed that the disruption of cytokeratin network by
anti-pancytokeratin antibody, had similar, although not identical, effects to
the disruption of cytokeratin caused by the injection of antisense VegT.
Endogenous Xlsirts RNA and VegT mRNA are components of the cytokeratin network
We also determined the relationship between Xlsirts RNA, VegT RNA and the
cytokeratin network. Upon injection of Texas Red-labeled RNAs into vegetal
region of stage VI oocytes, the Xlsirts, VegT and Xpat RNAs formed particles
measuring 0.5-1.0 µm; however, only Xlsirts and VegT particles had an
affinity to the cytokeratin and aggregated on its filaments
(Fig. 4A). The difference
between the number of Xlsirt, VegT and control Xpat particles aggregated on
cytokeratin filaments was statistically significant
(Fig. 4B).
Although these results were informative, they did not provide any
indication of the distribution of endogenous RNAs in relation to cytokeratin
filaments. To investigate the spatial distribution of endogenous Xlsirts and
VegT RNAs on the cytokeratin network, we used the technique of in vivo in situ
hybridization with molecular beacons (Fig.
5). Molecular beacons are short synthetic hairpin
2'-O-methylribonucleotides complementary to their cellular RNA targets
that possess a fluorophore on one end of the molecule and a quencher on the
other end. The hairpin configuration holds the fluorophore and quencher in
close proximity, thus blocking the fluorescence signal. Upon injection into an
oocyte and binding to the cognate RNA, the hairpin configuration becomes
disrupted such that the fluorophore is removed from the vicinity of the
quencher and the fluorescence of the probe is restored
(Bratu et al., 2003
;
Marras et al., 2004
;
Tyagi and Kramer, 1996
).
|
0.5-1.0 µm
in diameter. This is very similar to the size of the particles formed from
injected Xlsirts and Vg1 RNAs while they were translocating to the vegetal
cortex (Kloc et al.,
1996The results of our analysis indicate that endogenous VegT mRNA and Xlsirts RNA are components of the cytokeratin network in the vegetal cortex of stage VI Xenopus oocytes, and that the two RNAs have unique patterns of association with cytokeratin filaments. Although our results do not demonstrate if the interaction with the cytoskeleton is direct or indirect, they do demonstrate the presence of these RNAs within the cytokeratin network.
Exogenous VegT RNA is able to reconstitute and rescue the disrupted cytokeratin network
We next wanted to see if the cytokeratin network disintegrated by the
depletion of VegT mRNA could be reconstituted and rescued upon the injection
of VegT RNA. Stage IV and VI oocytes were injected with antisense VegT ODN,
followed by injection with VegT mRNA known to rescue antisense VegT depletion
(Zhang and King, 1996
;
Heasman et al., 2001
;
Horb and Thomsen, 1997
). The
rationale behind injection into stage IV oocytes was that stage IV oocytes (in
contrast to stage VI oocytes) are able to localize injected RNA to the vegetal
cortex (Yisraeli and Melton,
1988
). The cytokeratin network in vegetal cortex of control stage
IV oocytes differs significantly in appearance from the network of stage VI
oocytes (Clarke and Allan,
2003
); it is irregular and much less intricate
(Fig. 6A,B), thus the
disruption of the network upon antisense VegT ODN injection into stage IV
oocytes causes seemingly much less dramatic effect than in stage VI oocytes
(Fig. 6C,D).
The exogenous VegT mRNA, but not Xpat or Vg1 mRNA, was able to reconstitute and rescue the cytokeratin network in stage IV and stage VI oocytes (Fig. 6E,F; data not shown). Interestingly, the reconstituted network in stage IV oocytes was strikingly more complex and multidimensional than in controls, and similar to the network in stage VI oocytes (Fig. 6E,F). The rescuing effect of VegT mRNA occurred not only in stage IV but also in stage VI oocytes, when injected RNA is unable to localize. Thus, the ability of RNA to localize was irrelevant for rescue. We also found that the exogenous VegT RNA was able to reconstitute, to considerable extent, the cytokeratin network in the oocytes injected with anti-pancytokeratin C11 antibody (see Fig. 3E). In addition, we found that the injection of VegT RNA did not change the cytokeratin network appearance when injected to control oocytes (Fig. 6G,H). This result, and the fact that VegT RNA also reconstitutes the network in antibody-injected oocytes, suggests that the rescuing effect of VegT RNA operates at the level of cytokeratin network-subunit assembly.
Disruption of the cytokeratin network interferes with the formation of the germinal granules and subsequent development of the primordial germ cells
We next investigated the biological consequences of disruption of the
cytokeratin cytoskeleton. Residing at the vegetal cortex are the germinal
granules, which are components of the germ plasm that specifies the germ cell
lineage. Germinal granules are electron-dense structures that contain several
different RNAs, including Xcat2 and Xpat. The Xlsirts RNA is located within
the germ plasm in the germ plasm matrix between the germinal granules
(Hudson and Woodland, 1998
;
Kloc et al., 2001
;
Kloc et al., 2002b
).
As the depletion of Xlsirts and VegT RNAs affects the organization of the
germ plasm-containing region of the vegetal cortex, we analyzed the effect of
depletion of these RNAs on the morphogenesis of the germinal granules in
matured oocytes, activated eggs and embryos of different stages acquired by
host transfer (Heasman et al.,
1991
). Stage VI oocytes injected with either Xlsirts, VegT, XlCaax
antisense ODNs, VegT morpholino or anti-pancytokeratin C11 antibody, were
incubated for 24 hours, matured and placed within the host female. In matured
and activated eggs originating from control, antisense XlCaax, antisense
Xlsirts and VegT morpholino-injected oocytes, the germ plasm and germinal
granules appeared normal at the electron microscopic level
(Fig. 7A-D). However, in
antisense VegT injected oocytes, the germinal granules were strikingly
abnormal, forming long intricate chains of electron dense material
(Fig. 7E) that looked similar
to the germinal granule aggregates normally present much later in cleaving
embryos (Kloc et al., 2002b
).
This finding suggested that the depletion of VegT mRNA (but not VegT protein)
from the oocyte cortex causes untimely and premature aggregation of the
germinal granules.
|
The ultrastructure of germinal granules in antisense and anti-cytokeratin antibody injected embryos was analyzed at the electron microscopic level (Fig. 10A). In embryos injected with antisense XlCaax or antisense Xpat ODNs, the Xcat2 mRNA was located throughout the germinal granule and no abnormalities were detected (Fig. 10A, parts 1, 2, 1', 2'; not shown). In antisense Xlsirts embryos, the germinal granules were largely devoid of Xcat2 mRNA (Fig. 10A, parts 3 and 3'; Fig. 10B). However, in antisense VegT ODN-injected embryos, Xcat2 mRNA remained partially on the granules, which now resembled abnormally large aggregates (Fig. 10A, part 4). These were probably formed by the further aggregation of untimely coalesced stringy aggregates present in VegT-depleted oocytes (see Fig. 7E). The germinal granules in anti-pancytokeratin antibody-injected embryos formed large aggregates that were similar, but not identical, to the germinal granules aggregates in antisense VegT embryos (Fig. 10A, part 5). However, in contrast to antisense VegT embryos, the amount of Xcat2 mRNA in anti-pancytokeratin antibody embryos was similar to control embryos (Fig. 10B). Statistical analysis of Xcat2 mRNA distribution within the germinal granules of control and experimental embryos showed that the number of Xcat2 mRNA grains (silver grains) per 0.25 µm2 area of germinal granule was similar in control, anti-cytokeratin C11 antibody and antisense Xpat ODN-injected embryos, and significantly lower in antisense VegT ODN- and antisense Xlsirts ODNs-injected embryos (Fig. 10B). Thus, disruption of the cytokeratin network within the vegetal cortex of stage VI oocytes by either depletion of Xlsirts and VegT RNAs or by the injection of anti-pancytokeratin antibody has a major effect on the formation, structure and molecular composition of the germinal granules. This indicates an important link between the structural integrity of the vegetal cortex and subsequent events that occur during development, supporting our conclusion that Xlsirts and VegT RNAs do function in the maintenance of the cytokeratin network in the oocyte cortex.
|
|
|
|
| Discussion |
|---|
|
|
|---|
|
|
We propose that an intact cytokeratin network in stage VI oocytes and/or abundant cytokeratin foci in matured eggs prevent the untimely aggregation of germinal granules that normally takes place in embryos during early cleavage. This is supported by our data showing that the appearance of germinal granules in antisense VegT embryos is very similar to that in anti-cytokeratin antibody injected embryos. At present, there is no information on how cytokeratin filaments interact with the germ plasm or germinal granules. One possibility is that cytokeratin anchors the germinal granules, either directly or indirectly via other proteins. Thus, the severance of the cytokeratin network in oocytes injected with antisense VegT oligonucleotides or anti-cytokeratin antibody causes the release and untimely aggregation of germinal granules (Fig. 12). Another possibility is that cytokeratin itself does not have any structural or functional connection to the germinal granules but, as a structural component of the vegetal cortex, is necessary to preserve its integrity. If the latter possibility is true, then the untimely and premature aggregation of germinal granules is the result of intrinsic changes in the organization of the oocyte cortex in oocytes injected with antisense VegT oligonucleotides. Further studies are needed to explain how and why the depletion of Xlsirts RNA in stage VI oocytes caused the release of Xcat2 mRNA from the germinal granules in cleaving embryos and caused the changes in the morphology and the distribution of germ plasm islands in PGCs in blastula-stage embryos.
The importance of an intact cytokeratin network within the cortex has now
been demonstrated in two studies. The first was a previous study showing that
disruption of the cytokeratin in the oocyte cortex using anti-cytokeratin
antibodies results in the release of several different RNAs
(Alarcon and Elinson, 2001
).
The second is our current study, which demonstrated that the injection of
anti-cytokeratin antibody and the depletion of Xlsirts and VegT RNAs (which
specifically disrupted the cytokeratin cytoskeleton) had a dramatic effect on
the morphogenesis and molecular composition of the germinal granules. This
resulted in a phenotype affecting PGC formation in blastula embryos. The
evidence that the VegT mRNA and not protein is serving a structural role is
that antisense morpholino against VegT that inhibit translation of VegT
protein (Heasman et al., 2001
)
did not produce this effect. Xlsirts does not encode protein, thus it must be
functioning as an RNA.
Although the findings of this study apply to only a very specialized situation such as the anchoring of localized RNAs within the vegetal cortex of oocytes, it is quite likely that other RNAs play similar roles in both germ cells and somatic cells of other organisms. In the case of Xenopus oocytes, it is clear that integration of the RNAs into the cytoskeleton is of extreme importance for the proper formation and migration of the germ cells. In other systems, the role of the RNA-cytoskeletal network may serve a different function; however, our results open up the exciting possibility of a new role for RNAs in maintaining the structural integrity of the cellular cytoskeleton.
|
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Alarcon, V. B. and Elinson, R. P. (2001). RNA
anchoring in the vegetal cortex of the Xenopus oocyte. J.
Cell Sci. 114,1731
-1741.[Abstract]
Bashirullah, A., Cooperstock, R. L. and Lipshitz, H. D.
(1998). RNA localization in development. Annu. Rev.
Biochem. 67,335
-394.[CrossRef][Medline]
Boccaccio, G. L., Carminatti, H. and Colman, D. R.
(1999). Subcellular fractionation and association with the
cytoskeleton of messengers encoding myelin proteins. J. Neurosci.
Res. 58,480
-491.[CrossRef][Medline]
Bratu, D. P., Cha, B. J., Mhlanga, M. M., Kramer, F. R. and
Tyagi, S. (2003). Visualizing the distribution and transport
of mRNAs in living cells. Proc. Natl. Acad. Sci. USA
100,13308
-13313.
Clarke, E. J. and Allan, V. J. (2003).
Cytokeratin intermediate filament organisation and dynamics in the vegetal
cortex of living Xenopus laevis oocytes and eggs. Cell
Mot. Cytoskel. 56,13
-26.[CrossRef][Medline]
Elinson, R. P., King, M. L. and Forristall, C.
(1993). Isolated vegetal cortex from Xenopus oocytes
selectively retains localized RNAs. Dev. Biol.
160,554
-562.[CrossRef][Medline]
Forristall, C., Pondel, M., Chen, L. and King, M. L.
(1995). Patterns of localization and cytoskeletal association of
two vegetally localized RNAs, Vg1 and Xcat-2.
Development 121,201
-208.[Abstract]
Heasman, J., Holwill, S. and Wylie, C. C.
(1991). In Xenopus laevis: Practical Uses in
Cell and Molecular Biology. Vol. 36 (ed.
B. K. Kay and H. B. Peng), pp. 213-230. New York:
Academic Press.
Heasman, J., Wessely, O., Langland, R., Craig, E. J. and
Kessler, D. S. (2001). Vegetal localization of maternal mRNAs
is disrupted by VegT depletion. Dev. Biol.
240,377
-386.[CrossRef][Medline]
Horb, M. E. and Thomsen, G. H. (1997). A
vegetally localized T-box transcription factor in Xenopus eggs
specifies mesoderm and is essential for embryonic mesoderm formation.
Development 124,1689
-1698.[Abstract]
Hudson, C. and Woodland, H. R. (1998). Xpat, a
gene expressed specifically in germ plasm and primordial germ cells of
Xenopus laevis. Mech. Dev.
73,159
-168.[CrossRef][Medline]
Jankovics, F., Sinka, R., Lukacsovich, T. and Erdelyi, M.
(2002). MOESIN crosslinks actin and cell membrane in Drosophila
oocytes and is required for OSKAR anchoring. Curr.
Biol. 12,2060
-2065.[CrossRef][Medline]
Jansen, R. P. (2001). mRNA localization:
message on the move. Nat. Rev. Mol. Cell. Biol.
2, 247-256.[CrossRef][Medline]
Joseph, E. M. and Melton, D. A. (1998). Mutant
Vg1 ligands disrupt endoderm and mesoderm formation in Xenopus embryos.
Development 125,2677
-2685.[Abstract]
Kessler, D. S. and Melton, D. A. (1995).
Induction of dorsal mesoderm by soluble, mature Vg1 protein.
Development 121,2155
-2164.[Abstract]
King, M. L., Zhou, Y. and Bubunenko, M. (1999).
Polarizing genetic information in the egg: RNA localization in the frog
oocyte. BioEssays 21,546
-557.[CrossRef][Medline]
Kloc, M. and Etkin, L. D. (1994).
Delocalization of Vg1 mRNA from the vegetal cortex in Xenopus oocytes after
destruction of Xlsirts RNA. Science
265,1101
-1103.
Kloc, M. and Etkin, L. D. (1995). Two distinct
pathways for the localization of RNAs at the vegetal cortex in Xenopus
oocytes. Development
121,287
-297.[Abstract]
Kloc, M., Larabell, C. and Etkin, L. D. (1996).
Elaboration of the messenger transport organizer pathway for localization of
RNA to the vegetal cortex of Xenopus oocytes. Dev.
Biol. 180,119
-130.[CrossRef][Medline]
Kloc, M., Larabell, C., Chan, A. P. and Etkin. L. D.
(1998). Contribution of METRO pathway localized molecules to the
organization of the germ cell lineage. Mech. Dev.
75, 81-93.[CrossRef][Medline]
Kloc, M., Bilinski, S., Chan, A. P., Allen, L. H., Zearfoss, N.
R. and Etkin, L. D. (2001). RNA localization and germ
cell determination in Xenopus. Int. Rev. Cytol.
203, 63-91.[Medline]
Kloc, M., Dougherty, M. T., Bilinski, S., Chan, A. P., Brey, E.,
King, M. L., Patrick, C. W. and Etkin, L. D. (2002a).
Three-dimensional ultrastructural analysis of RNA distribution within germinal
granules of Xenopus. Dev. Biol.
241, 79-93.[CrossRef][Medline]
Kloc, M., Zearfoss, N. R. and Etkin, L. D.
(2002b). Mechanisms of subcellular mRNA localization.
Cell 108,533
-544.[CrossRef][Medline]
Kloc, M., Bilinski, S., Dougherty, M. T., Brey, E. M. and Etkin,
L. D. (2004). Formation, architecture and polarity of female
germline cyst in Xenopus. Dev. Biol.
266, 43-61.[CrossRef][Medline]
Klymkowsky, M. W. and Maynell, L. A. (1989).
MPF-induced breakdown of cytokeratin filament organization in the maturing
Xenopus oocyte depends upon the translation of maternal mRNAs.
Dev. Biol. 134,479
-485.[CrossRef][Medline]
Klymkowsky, M. W., Maynell, L. A. and Nislow, C.
(1991). Cytokeratin phosphorylation, cytokeratin filament
severing and the solubilization of the maternal mRNA Vg1. J. Cell
Biol. 114,787
-797.
Marikawa, Y., Li, Y. and Elinson, R. P. (1997).
Dorsal determinants in the Xenopus egg are firmly associated with the vegetal
cortex and behave like activators of the Wnt pathway. Dev.
Biol. 191,69
-79.[CrossRef][Medline]
Marras, S. A., Gold, B., Kramer, F. R., Smith, I. and Tyagi,
S. (2004). Real-time measurement of in vitro transcription.
Nucleic Acids Res. 32,e72
.
Palacios, I. M. and St. Johnston, D. (2001).
Getting the message across: the intracellular localization of mRNA in higher
eukaryotes. Annu. Rev. Cell. Dev. Biol.
17,569
-614.[CrossRef][Medline]
Pondel, M. D. and King, M. L. (1988). Localized
maternal mRNA related to transforming growth factor beta mRNA is concentrated
in a cytokeratin-enriched fraction from Xenopus oocytes. Proc.
Natl. Acad. Sci. USA 85,7612
-7616.
Rebagliati, M. R., Weeks, D. L., Harvey, R. P. and Melton, D.
A. (1985). Identification and cloning of localized maternal
RNAs from Xenopus egg. Cell
42,769
-777.[CrossRef][Medline]
Shan, J., Munro, T. P., Barbarese, E., Carson, J. H. and Smith,
R. (2003). A molecular mechanism for mRNA trafficking in
neuronal dendrites. J. Neurosci.
23,8859
-8866.
Stebbings, H. (2001). Cytoskeleton-dependent
transport and localization of mRNA. Int. Rev. Cytol.
211, 1-31.[Medline]
Tyagi, S. and Kramer, F. R. (1996). Molecular
beacons: probes that fluoresce upon hybridization. Nat.
Biotechnol. 14,303
-308.[CrossRef][Medline]
Wessely, O. and de Roberis, E. M. (2000). The
Xenopus homologue of Bicaudal-C is a localized maternal mRNA that can
induce endoderm formation. Development
127,2053
-2062.[Abstract]
Xanthos, J. B., Kofron, M., Wylie, C. and Heasman, J.
(2001). Maternal VegT is the initiator of a molecular network
specifying endoderm in Xenopus laevis.
Development 128,167
-180.[Abstract]
Yisraeli, J. K. and Melton, D. A. (1988). The
maternal mRNA Vg1 is correctly localized following injection into
Xenopus oocytes. Nature
336,592
-595.[CrossRef][Medline]
Yisraeli, J. K., Sokol, S. and Melton, D. A.
(1990). A two-step model for the localization of maternal mRNA in
Xenopus oocytes: involvement of microtubules and microfilaments in
the translocation and anchoring of Vg1 mRNA.
Development 108,289
-298.[Abstract]
Zearfoss, N. R., Chan, A. P., Wu, C. F., Kloc, M. and Etkin, L.
D. (2004). Hermes is a localized factor regulating cleavage
of vegetal blastomeres in Xenopus laevis. Dev.
Biol. 267,60
-71.[CrossRef][Medline]
Zhang, J. and King, M. L. (1996). Xenopus VegT
RNA is localized to the vegetal cortex during oogenesis and encodes a novel
T-box transcription factor involved in mesodermal patterning.
Development 122,4119
-4129.[Abstract]
Zhao, W. M., Jiang, C., Kroll, T. T. and Huber, P. W.
(2001). A proline-rich protein binds to the localization element
of Xenopus Vg1 mRNA and to ligands involved in actin polymerization.
EMBO J. 20,2315
-2325.[CrossRef][Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
T. N. Cuykendall and D. W. Houston Vegetally localized Xenopus trim36 regulates cortical rotation and dorsal axis formation Development, September 15, 2009; 136(18): 3057 - 3065. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. K. Arthur, M. Claussen, S. Koch, K. Tarbashevich, O. Jahn, and T. Pieler Participation of Xenopus Elr-type Proteins in Vegetal mRNA Localization during Oogenesis J. Biol. Chem., July 24, 2009; 284(30): 19982 - 19992. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Cooper, J. Guo, Y. Yan, S. Chooniedass-Kothari, F. Hube, M. K. Hamedani, L. C. Murphy, Y. Myal, and E. Leygue Increasing the relative expression of endogenous non-coding Steroid Receptor RNA Activator (SRA) in human breast cancer cells using modified oligonucleotides Nucleic Acids Res., July 1, 2009; 37(13): 4518 - 4531. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Wilusz, H. Sunwoo, and D. L. Spector Long noncoding RNAs: functional surprises from the RNA world Genes & Dev., July 1, 2009; 23(13): 1494 - 1504. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. T. F. Sasaki, T. Ideue, M. Sano, T. Mituyama, and T. Hirose MEN{varepsilon}/{beta} noncoding RNAs are essential for structural integrity of nuclear paraspeckles PNAS, February 24, 2009; 106(8): 2525 - 2530. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Condorelli and S. Dimmeler MicroRNAs: components of an integrated system controlling cardiac development, physiology, and disease pathogenesis Cardiovasc Res, September 1, 2008; 79(4): 551 - 552. [Full Text] [PDF] |
||||
![]() |
L.-h. Meng, Z. Meng, Z.-h. Miao, T. D. Veenstra, and Y. Pommier Cytokeratin-RNA Cross-Linking Mediated by the Antitumor Aminoflavone, 5-Amino-2,3-fluorophenyl-6,8-difluoro-7-methyl-4H-1-benzopyran-4-one J. Pharmacol. Exp. Ther., May 1, 2008; 325(2): 674 - 680. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. O'Gorman and A. Akoulitchev What Is So Special About Oskar Wild? Sci. Signal., December 12, 2006; 2006(365): pe51 - pe51. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Jenny, O. Hachet, P. Zavorszky, A. Cyrklaff, M. D. J. Weston, D. S. Johnston, M. Erdelyi, and A. Ephrussi A translation-independent role of oskar RNA in early Drosophila oogenesis Development, August 1, 2006; 133(15): 2827 - 2833. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Heasman Patterning the early Xenopus embryo. Development, April 1, 2006; 133(7): 1205 - 1217. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. CZAPLINSKI and I. W. MATTAJ 40LoVe interacts with Vg1RBP/Vera and hnRNP I in binding the Vg1-Localization Element RNA, February 1, 2006; 12(2): 213 - 222. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||