|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 6 July 2005
doi: 10.1242/dev.01921
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Cellular and Molecular Biology Training Program, University of
Wisconsin-Madison, Madison, WI 53706, USA
2 Department of Biochemistry, University of Wisconsin-Madison, Madison, WI
53706, USA
3 Howard Hughes Medical Institute, University of Wisconsin-Madison, Madison, WI
53706, USA
* Author for correspondence (e-mail: jekimble{at}facstaff.wisc.edu)
Accepted 27 May 2005
| SUMMARY |
|---|
|
|
|---|
120 germ cells, fog-1; fbf-1
fbf-2 triple mutants make only
10 germ cells. The triple mutant
germline divides normally until early L2, when germ cells prematurely enter
meiosis and begin oogenesis. Importantly, fog-1/+; fbf-1
fbf-2 animals make more germ cells than fbf-1 fbf-2 double
mutants, demonstrating that one dose of wild-type fog-1
promotes proliferation more effectively than two doses at least in the
absence of FBF. FOG-1 protein is barely detectable in proliferating germ
cells, but abundant in germ cells destined for spermatogenesis. Based on
fog-1 dose effects, together with the gradient of FOG-1 protein
abundance, we suggest that low FOG-1 promotes proliferation and high FOG-1
specifies spermatogenesis. FBF binds specifically to regulatory elements in
the fog-1 3'UTR, and FOG-1 increases in animals lacking FBF.
Therefore, FBF represses fog-1 expression. We suggest that FBF
promotes continued proliferation, at least in part, by maintaining FOG-1 at a
low level appropriate for proliferation. The dose-dependent control of
proliferation and cell fate by FOG-1 has striking parallels with
Xenopus CPEB, suggesting a conserved mechanism in animal
development.
Key words: C. elegans, Germline, FBF, FOG-1, CPEB, Sex determination, Mitosis, Meiosis, Sperm, Oocyte
| Introduction |
|---|
|
|
|---|
The C. elegans germline provides a simple model for analyzing
molecular and genetic mechanisms that coordinate growth and differentiation.
During the first two stages of larval development (L1 and L2), germ cells
actively proliferate; during the next larval stage (L3), distal germ cells
continue proliferation, while proximal germ cells enter the meiotic cell
cycle; during L4 and adulthood, germlines maintain proliferating cells at the
distal end while continuously producing sperm or oocytes at the proximal end
(see Kimble and Crittenden at
http://dev.wormbook.org/).
Four major regulatory pathways control growth and differentiation of the
germline. Notch signaling promotes proliferation throughout development
(Kimble and Simpson, 1997
); an
RNA regulatory network controls both mitosis/meiosis and sperm/oocyte
decisions (Crittenden et al.,
2003
); the sex determination pathway controls the sperm/oocyte
decision (see Ellis and Schedl at
http://dev.wormbook.org/);
and MAP kinase controls progression through meiosis and oocyte maturation
(Church et al., 1995
;
Miller et al., 2001
). Many
components of these four regulatory systems are homologous to vertebrate
regulators of growth and differentiation (e.g. GLP-1/Notch, FBF/Pumilio,
TRA-1/GLI and MPK-1/MAP kinase). Therefore, understanding C. elegans
germline development has direct implications for regulation of growth and
differentiation in vertebrates.
The regulators most crucial for this work are FBF (for fem-3
binding factor) and FOG-1 (for feminization of the germline). FBF is a
collective term for two nearly identical proteins, FBF-1 and FBF-2, which
belong to the PUF family of RNA-binding proteins
(Wickens et al., 2002
;
Zamore et al., 1997
;
Zhang et al., 1997
). Like
other PUF proteins, FBF-1 and FBF-2 bind 3'UTR regulatory elements and
repress target mRNA expression (Bernstein
et al., 2005
; Crittenden et
al., 2002
; Eckmann et al.,
2004
; Lamont et al.,
2004
; Wickens et al.,
2002
; Zhang et al.,
1997
) (this work). FBF binds to regulatory elements called FBF
binding elements (FBEs), for which a consensus sequence has been defined
(Bernstein et al., 2005
). In
fbf-1 fbf-2 double mutants, germline proliferation is normal until
late L3 or early L4, but during L4 all germ cells enter meiosis and
differentiate as sperm (Crittenden et al.,
2002
; Zhang et al.,
1997
). Therefore, FBF is required to maintain a population of
germline stem cells in late larvae and adult animals, and to promote the
switch from spermatogenesis to oogenesis in hermaphrodites.
FOG-1 belongs to the CPEB family of RNA regulatory proteins
(Jin et al., 2001a
;
Luitjens et al., 2000
). CPEB
proteins in Xenopus bind U-rich elements, called CPEs (cytoplasmic
polyadenylation elements), and thereby regulate both poly(A) tail length and
translation of target mRNAs (Mendez and
Richter, 2001
). The C. elegans FOG-1 protein may also
bind CPEs (Jin et al., 2001b
).
Before this study, FOG-1 was thought to have only one function in nematode
development specification of the sperm fate
(Barton and Kimble, 1990
). In
the absence of fog-1, germ cells differentiate as oocytes rather than
sperm. The sperm/oocyte choice is also controlled by fog-3, another
germline regulator (Ellis and Kimble,
1995
), as well as global sex-determining genes (e.g. Fem genes,
tra-1) (see Ellis and Schedl at
http://dev.wormbook.org/).
The global sex-determining genes control fog-1 and fog-3
expression (Chen and Ellis,
2000
; Jin et al.,
2001a
), and FOG-1/FOG-3 appear to be terminal regulators of sperm
fate.
In this paper, we demonstrate that FOG-1 promotes early larval germline proliferation. Importantly, fog-1 controls proliferation in a dose-dependent manner. The fog-1 dose effects, together with FOG-1 immunocytochemistry, suggest that low FOG-1 promotes proliferation, whereas high FOG-1 promotes spermatogenesis. Three lines of evidence demonstrate that FBF represses fog-1 expression, probably by binding directly to the fog-1 3'UTR. Similarly, FOG-3 and FEM-3 promote proliferation, and the fog-3 3'UTR also possesses an FBF-binding element. We suggest that FBF may coordinately repress sperm-specifying mRNAs to direct oogenesis and that it represses the fog-1 mRNA to maintain FOG-1 at a low level appropriate for proliferation.
| Materials and methods |
|---|
|
|
|---|
In situ methods
To generate FOG-1 antibodies, rats were injected with
keyhole-limpet-hemocyanin-coupled peptides corresponding to amino acids 2-22
of the long FOG-1 isoform (Genemed Synthesis). Extruded germlines were
freeze-cracked, fixed with 1% paraformaldehyde and permeabilized with PBS +
0.5% BSA + 0.1% Triton X100; staining was carried out using affinity-purified
-FOG-1 antibodies at a concentration of 1:5 by standard methods
(Crittenden and Kimble, 1998
).
Larvae were fixed as described by Finney and Ruvkun
(Finney and Ruvkun, 1990
). To
stain with rabbit
-RME-2 (Grant and
Hirsh, 1999
), mouse SP56 (Ward
et al., 1986
) and rabbit
-PGL-1
(Kawasaki et al., 1998
),
larvae were freeze-cracked and fixed in 20°C methanol, followed by
20°C acetone (Crittenden and
Kimble, 1998
). 4', 6-diamidino-2-phenylindole (DAPI) was
included to visualize DNA. Epifluorescent images were captured with a Zeiss
Axioskop equipped with a Hamamatsu digital CCD camera, and collected with
Openlab 3.1.7. Confocal images were obtained on a Bio-Rad MR1024 confocal
microscope and processed using Adobe Photoshop.
For mRNA in situ hybridization, adult male germlines were extruded and
stained as described (Jones et al.,
1996
). Single-stranded probes were amplified from plasmid pJK1047,
using primers BT35 (5' TTACATCACGACGACGAGTTC 3') and BT36
(5' GGTACAATTCTCGGGAGTCCT 3').
FBE analysis
A consensus FBE (Bernstein et al.,
2005
) was used to identify candidate sites, and three-hybrid
assays were performed as described
(Bernstein et al., 2002
). DNA
oligonucleotides containing predicted FBEs were cloned into pIIIA/MS2-2
vector. Gal4 activation domain fusion proteins with FBF-1 (amino acids
121-614), FBF-2 (amino acids 121-634) or PUF-5 (amino acids 1-553) were
expressed from pACT2 plasmids in yeast strain YBZ-1. ß-Galactosidase was
quantified using the Beta-Glo system (Promega) as described by Hook et al.
(Hook et al., 2005
). For gel
shifts, GST fused FBF-2 (amino acids 121-634) was purified as described
(Bernstein et al., 2005
) and
combined with 100 fMol 32P-end-labeled RNA oligoribonucleotides
(IDT and Dharmacon). Shift conditions were identical to those described by
Bernstein et al. (Bernstein et al.,
2005
), and binding constants were calculated as described in Hook
et al. (Hook et al.,
2005
).
| Results |
|---|
|
|
|---|
1000 germ cells in each of two U-shaped
arms (Hirsh et al., 1976
60 germ cells in each arm
(Fig. 1B)
(Crittenden et al., 2002
-PGL-1 antibodies to visualize germ cells
(Kawasaki et al., 1998
100-fold compared with wild-type or fog-1 single
mutants, and by
10-fold compared with fbf-1 fbf-2 double
mutants. We confirmed the synthetic defect using RNAi: fog-1;
fbf(RNAi) and fog-1(RNAi); fbf-1 fbf-2 germlines were both
similar to fog-1; fbf-1 fbf-2 triple mutant germlines (not shown).
Therefore, the synthetic defect is not due to extraneous mutations on either
the fog-1 or fbf-1 fbf-2 mutant chromosome.
Fig. 1 shows the triple mutant
with fog-1(q250), a nonsense mutation and putative null
(Jin et al., 2001b
|
|
10 total germ cells were present on average,
and that number remained constant in L3s and L4s
(Fig. 1G). No germ cells were
observed outside the gonad; germ cells appeared healthy and no evidence of
cell death was seen. Therefore, the defect appears specific for
proliferation.
We next asked if the decreased proliferation was accompanied by early entry
into meiosis. In wild-type germlines, crescent-shaped nuclei typical of early
meiotic prophase are first seen in mid-L3
(Hansen et al., 2004a
), and
pachytene nuclei are seen a few hours later, just before the molt to L4
(Kimble and White, 1981
);
gametogenesis does not occur in wild-type germlines until L4. In fog-1;
fbf-1 fbf-2 triple mutants, germline nuclei appeared enlarged and
granular during L2 by Nomarski microscopy; after DAPI-staining,
crescent-shaped nuclei were observed in some L2 germlines
(Fig. 1F). Typical pachytene
nuclei were rarely seen, even in later germlines, but 12 univalents were
present in some L4 germline nuclei (not shown). Furthermore, as described
below, germ cells in the triple mutant were oogenic in L3, much earlier than
gametogenesis begins in wild type. Therefore, triple mutant germ cells stop
mitotic divisions and enter meiosis earlier than normal, although meiotic
prophase does not progress normally. We conclude that FOG-1 can promote
proliferation in the early larval germline.
fog-1 dose affects germline proliferation
While constructing strains, we noticed that fog-1/+; fbf-1
fbf-2 animals made more germ cells than the fbf-1 fbf-2 double
mutant (Fig. 2B,C). Indeed,
fbf-1 fbf-2 mutants made an average of 123 germ cells (n=18,
range, 73-192), but fog-1/+; fbf-1 fbf-2 mutants made an average of
557 germ cells (n=6, range, 261-795). Some fog-1/+; fbf-1
fbf-2 mutants contained mitotically dividing germ cells into adulthood,
which is not seen in fbf-1 fbf-2 double mutants. The fog-1/+;
fbf-1 fbf-2 germlines made excess sperm and no oocytes
(Fig. 2B,C), which is
consistent with the presence of FOG-1 (which specifies sperm) and absence of
FBF, which promotes oogenesis. All germ cells ultimately differentiated as
sperm (not shown). We conclude that one dose of wild-type fog-1 is
more effective in promoting germline proliferation than are two doses, at
least in the absence of FBF. This finding supports the idea that a low level
of FOG-1 promotes proliferation, whereas a high level of FOG-1 promotes
spermatogenesis (see Discussion).
|
60 germ cells per arm (
120 total
germ cells), the fog-1(q325) allele partially suppressed its
proliferation defect. This suppression was abolished by fog-1 RNAi,
suggesting that fog-1(q325) possesses residual fog-1
activity. In fog-1(q253 ts); fbf-1 fbf-2 triple mutants, germ cell
numbers had to be counted at 25°C, a temperature at which fbf-1
fbf-2 homozygotes make more cells than at lower temperatures (190 germ
cells, n=5). The triple mutant made an average of 110 germ cells
(n=7), a minor reduction compared with the double; however, germ cell
number was further reduced after fog-1 RNAi, again suggesting
residual FOG-1 in the triple. A simple explanation is that these two non-null
fog-1 alleles made enough functional FOG-1 to support proliferation,
but not enough to drive spermatogenesis. We conclude that the fog-1
effect on germline proliferation is separable from its effect on germline
feminization.
FOG-1 and FBF function downstream of Notch and upstream of gld/nos
We next investigated the relationship of fog-1 and fbf
with other regulators of germline proliferation. One key regulatory pathway is
Notch signaling: in mutants lacking the GLP-1/Notch receptor, only one or two
germ cell divisions occur before entry into meiosis
(Austin and Kimble, 1987
). To
determine whether fog-1 and fbf act downstream of
GLP-1/Notch signaling, we employed a glp-1 gain-of-function (gf)
mutant that renders the germline tumorous. All glp-1(gf) homozygotes
have a tumorous germline, but glp-1(gf)/glp-1(lf) heterozygotes can
produce a few progeny before becoming tumorous
(Berry et al., 1997
). We
co-injected fog-1 and fbf dsRNAs into L4
glp-1(gf)/glp-1(lf) hermaphrodites. Among their progeny, 11 out of 19
glp-1(gf) homozygotes had small germlines with oocyte-like cells
extending to the distal end (Fig.
3A). By contrast, neither fog-1 RNAi (n=14) nor
fbf RNAi (n=35) alone affected the glp-1(gf) tumors
(Fig. 3B,C). Therefore,
fog-1 and fbf are likely to function downstream of Notch
signaling (Fig. 3D). We
conclude that Notch stimulation of germline proliferation is abolished when
both fbf and fog-1 are depleted. This finding suggests that
Notch signaling promotes proliferation by controlling FBF and FOG-1. The
fbf-2 gene appears to be a direct target of Notch signaling
(Lamont et al., 2004
), but
Notch targets that impinge on FOG-1 activity are unknown.
FBF promotes proliferation in the late larval germline, at least in part,
by repressing mRNAs in each of two meiosis-promoting branches (see
Fig. 3D)
(Crittenden et al., 2002
;
Eckmann et al., 2004
). To
determine where fbf and fog-1 act in relation to
gld/nos regulators, we depleted fog-1 by RNAi in quadruple
mutants that lack the two Fbf genes and one gene from each meiosis-promoting
branch. All fbf-1 fbf-2 gld-3 nos-3; fog-1(RNAi) and
fbf-1 fbf-2; gld-1 gld-2; fog-1(RNAi) homozygotes had tumorous
germlines, while control fbf-1 fbf-2; fog-1(RNAi) animals phenocopied
the fog-1; fbf-1 fbf-2 mutant (n>15 for each genotype).
To confirm this result, we performed the reciprocal experiment, depleting
gld-1 and gld-2 by RNAi in fog-1; fbf-1 fbf-2
animals. Again, fog-1; fbf-1 fbf-2; gld-1(RNAi) gld-2(RNAi) animals
were tumorous. To test if removal of nos-3 alone might suppress the
fog-1; fbf-1 fbf-2 proliferation defect, we depleted nos-3
by RNAi in fog-1; fbf-1 fbf-2 mutants. fog-1; fbf-1 fbf-2;
nos-3(RNAi) animals maintained a mitotic region and generated only
oocytes (n=17). We conclude that fog-1 and fbf act
upstream of gld/nos genes to promote proliferation
(Fig. 3D).
FBF and FOG-1 in germline sex determination
The fog-1 germline makes only oocytes
(Fig. 1A)
(Barton and Kimble, 1990
), but
fbf-1 fbf-2 germlines make only sperm
(Fig. 1B) (Crittenden et al., 2002
;
Zhang et al., 1997
). In
fog-1; fbf-1 fbf-2 triple mutants, germ cells appeared oocyte-like.
By Nomarski, these cells were larger than mitotic germ cells and somewhat
granular, but not as large as typical oocytes
(Fig. 2A). We therefore used
antibodies to assess gamete differentiation. Specifically, we used the RME-2
yolk protein receptor as the oocyte marker
(Grant and Hirsh, 1999
) and
SP56 as the sperm marker (Ward et al.,
1986
). Germ cells in fbf-1 fbf-2 double mutants stained
with the sperm marker (Fig.
4A), but not the oocyte marker
(Fig. 4B); by contrast,
fog-1; fbf-1 fbf-2 germ cells failed to express the sperm marker
(Fig. 4C), but expressed the
oocyte marker (Fig. 4D).
Consistent with an early entry into meiosis, germ cells began to express the
oocyte marker in L3 germlines and continued to express it in L4 germlines. We
conclude that fog-1; fbf-1 fbf-2 germ cells differentiate as oocytes
and that fbf acts upstream of fog-1 in the sex determination
pathway. A simple interpretation is that FBF represses fog-1
expression to promote the hermaphrodite switch from spermatogenesis to
oogenesis (Fig. 4E).
|
10-fold fewer germ cells than fbf-1 fbf-2 (approximately
seven germ cells/arm; n=31). Therefore, fog-3, like
fog-1, controls early larval germline proliferation redundantly with
fbf.
We also analyzed fbf-1 fbf-2; fem-3 triple mutants. The
fem-3 gene has a strong maternal effect
(Barton et al., 1987
;
Hodgkin, 1986
), so we examined
mutants derived from fem-3 homozygous parents. Such progeny are
called fem-3(mz), because they possess no maternal (m)
or zygotic (z) fem-3. The fbf-1 fbf-2;
fem-3(mz) germline was indistinguishable from that of
fog-1; fbf-1 fbf-2 (Table
1; not shown). By contrast, fbf-1 fbf-2;
fem-3(m+z) animals (which retain maternal, but lack zygotic,
fem-3) had more germ cells than fbf-1 fbf-2 double mutants
and were similar in size to fog-1/+; fbf-1 fbf-2 germlines. Mitotic
divisions were observed in some fbf-1 fbf-2; fem-3(m+z) adult
germlines, and only oocytes were made. Therefore, maternal fem-3 is
sufficient to achieve some germline proliferation, but not sufficient for
specification of sperm. Importantly, germline proliferation in fbf-1
fbf-2; fem-3(m+z) is dependent on fog-1; it is abolished
if FOG-1 is depleted by RNAi. Thus, fem-3 effects on proliferation
may be explained by absence of FOG-1 in fem-3(mz); fbf-1
fbf-2 germlines and low FOG-1 in fem-3(m+z); fbf-1 fbf-2
germlines. We suggest that the sex-determining pathway influences germline
proliferation by controlling FOG-1 and FOG-3.
|
The binding of FBF to two adjacent sites, fog-1 FBE bc, was
particularly robust (Fig.
5D,E). These binding sites are predicted to overlap, though their
core elements are distinct. We assayed the FBF binding to an RNA carrying a
UGU to ACA substitution in one or both FBEs
(Fig. 5B). FBF bound the
wild-type RNA strongly; the level of ß-galactosidase activity in
three-hybrid assays (Fig. 5D)
and apparent binding constant in gel shifts
(Fig. 5E) were similar to those
reported for the strong interaction between FBF and an FBE in the
gld-1 3'UTR (Bernstein et
al., 2005
). This wild-type fog-1 FBE bc RNA yielded two
complexes, one comparable in mobility with that obtained with the single FBE a
(Fig. 5E, left), and the other
migrating more slowly (Fig. 5E, center). This `supershift' was reduced, although still detectable, when either
FBE was mutated (Fig. 5E,
center and right). We conclude that FBF binds specifically to all three FBEs
in the fog-1 3'UTR, and that the overlap of two FBEs creates a
particularly strong binding site.
We also examined other fem and fog mRNAs for putative
FBEs (Fig. 5A,B). We found one
FBE in the fog-3 3'UTR; both FBF-1 and FBF-2 interacted
specifically with this element in the yeast three-hybrid system, and FBF-2
bound it specifically in vitro (Fig.
5D,E). We also found one FBE in the fem-1 3'UTR;
both FBF-1 and FBF-2 interacted specifically with this element in yeast, but
FBF-2 did not bind it in the gel retardation assay. Such a discrepancy is
unusual (Bernstein et al.,
2005
). The fem-2 3'UTR carried two UGURxxAU
sequences, but these did not conform to the more restricted UGURHHAUW
consensus (Fig. 5D,E) and did
not bind FBF (data not shown). The fog-2 3'UTR possessed no
potential FBEs. We conclude that FBF binds FBEs in the fog-1 and
fog-3 3'UTRs, in addition to the fem-3 FBE identified
in previous work (Zhang et al.,
1997
).
FOG-1 expression and its regulation by FBF
The fog-1 dose effects predicted that FOG-1 might be less abundant
in proliferating germ cells and more abundant in cells destined for
spermatogenesis. In addition, genetic epistasis and the identification of FBEs
in the fog-1 3'UTR predicted that fog-1 expression
might be subject to FBF repression. To test these predictions, we raised rat
polyclonal antibodies against the long isoform of FOG-1, which is the crucial
isoform for fog-1 function (Jin
et al., 2001a
).
In wild-type animals, FOG-1 protein was observed in the germline and was
predominantly cytoplasmic (Fig.
6). In L2s, FOG-1 became detectable, but staining was faint
(Fig. 6A). In L3s, the level of
FOG-1 remained low distally in proliferating germ cells, but FOG-1 was
abundant more proximally in germ cells that had entered meiosis and were
destined for spermatogenesis (Fig.
6B). Temperature shift experiments with a fog-1(ts)
allele showed that FOG-1 specifies spermatogenesis in L3 when germ cells enter
meiosis (Barton and Kimble,
1990
), consistent with the idea that the abundant FOG-1 in early
meiotic germ cells is specifying the sperm fate. In adult male germlines,
FOG-1 was spatially graded: FOG-1 was either not detected or barely visible in
the distal half of the mitotic region, became detectable in the proximal half
of the mitotic region where some germ cells have entered pre-meiotic S phase
(Hansen et al., 2004a
) (S.
Crittenden, personal communication), intensified in the transition zone and
remained high in distal pachytene germ cells; no FOG-1 was detected in more
proximal pachytene cells (Fig.
6E). This adult male pattern of fog-1 expression was
confirmed by in situ hybridization using an antisense probe to detect
fog-1 mRNA (Fig. 6F);
no RNA was seen with a sense probe (not shown). Germlines dissected from
fog-1(q250) mutant males had no detectable FOG-1 protein
(Fig. 6G), consistent with its
being a null allele and demonstrating specificity of the antibody. In contrast
to adult male germlines, no FOG-1 was detected in adult hermaphrodites
(Fig. 6H). Therefore, FOG-1
expression is sexually dimorphic in adults. FOG-1 is graded in spermatogenic
germlines: FOG-1 is low or undetectable in proliferating cells but abundant in
cells entering the meiotic cell cycle and destined for spermatogenesis. By
contrast, FOG-1 is not detected in oogenic germlines.
|
To assess FOG-1 in germlines that possess proliferative cells throughout the entire tissue, we stained germlines that are tumorous in the presence and absence of FBF. The quantity of FOG-1 protein was low in gld-3 nos-3 tumorous germlines (Fig. 6I), but consistently higher in fbf-1 fbf-2 gld-3 nos-3 tumorous germlines (Fig. 6J). We conclude that the FBF represses fog-1 expression in vivo and that FBF is required for establishing the temporal and spatial pattern of FOG-1 expression.
| Discussion |
|---|
|
|
|---|
|
A major challenge for the future is to understand how FOG-1 and FOG-3
control both proliferation and sperm specification. One intriguing possibility
is that a central aspect of sperm specification is cell cycle control.
Spermatogenic cells continue to divide rapidly, albeit by meiotic divisions,
whereas a conserved aspect of oogenesis is cell cycle arrest and growth. The
fog-1 gene appears to specify sperm as germ cells enter meiosis, a
conclusion based on temperature shifts
(Barton and Kimble, 1990
) and
FOG-1 expression (this work, see below). We speculate that FOG-1 and FOG-3 may
control cell cycle regulators to both control mitosis and specify sperm. We do
not know if the FOG-1 regulation of proliferation effects a male mode of the
mitotic cell cycle. One argument against this idea is that FOG-1 can promote
mitosis in an oogenic germline (e.g. fog-1(q325); fbf-1 fbf-2 or
fem-3(m+z); fbf-1 fbf-2). However, these mutant germlines are
aberrant, and in wild-type germlines, FOG-1-dependent mitoses generate primary
spermatocytes, both in early larval hermaphrodite development and in
males.
FOG-1 levels controls distinct germline fates
One dose of wild-type fog-1 promotes proliferation better than two
doses, and FOG-1 is less abundant in proliferative cells and more abundant in
cells entering the meiotic cell cycle and destined for spermatogenesis. These
two lines of evidence lead us to propose that the level of FOG-1 may determine
biological outcome. Fig. 7A
depicts this idea, with a broken line indicating the threshold of FOG-1
activity, low FOG-1 promoting mitosis and high FOG-1 specifying sperm. The
fog-1 dose effects are only seen in a mutant background that lacks
FBF, which normally represses FOG-1 levels. One simple view of those dose
effects is provided in Fig. 7A.
Briefly, two wild-type fog-1 genes lead to a rapid accumulation of
high FOG-1, the threshold is crossed and all germ cells are driven into
spermatogenesis; one wild-type fog-1 gene generates high FOG-1 levels
more slowly, the threshold is crossed later and more mitotic divisions occur;
but the absence of wild-type fog-1 results in few mitotic divisions
and oogenesis. A more complex idea, which is perhaps more likely, is that the
FOG-1 increase is not linear. Such a non-linear increase might result from the
dual regulation of FOG-1 abundance by FBF repression (this work) and FOG-1
positive autoregulation (Jin et al.,
2001b
).
|
How might FOG-1 promote proliferation at a low level and spermatogenesis at
a high level? One idea is that CPEB monomers and CPEB multimers affect
translation of target mRNAs differently
(Mendez et al., 2002
). This
idea derives from the observation that in Xenopus, Mos, which
contains a single CPE site, is activated at a high CPEB concentration, whereas
cyclin B1, which contains two CPE sites, is activated at a low CPEB
concentration and repressed at a high concentration. Thus, Mendez et al.
(Mendez et al., 2002
) suggest
that CPEB monomers activate target mRNAs, while CPEB multimers repress target
mRNAs. According to this scenario, FOG-1 might activate a mitosis-promoting
mRNA at a low concentration, but repress that same mRNA at a higher
concentration. However, many possibilities exist. Indeed, FEM-3 and FOG-3 may
also contribute to the gradient of activity specifying these two fates.
Understanding the underlying molecular mechanisms by which FOG-1 controls
germline fates will require the identification and characterization of
specific FOG-1 target mRNAs.
Relationship between FBF and FOG-1
FBF promotes both proliferation and oogenesis, whereas FOG-1 promotes
proliferation and spermatogenesis. How do these two regulators accomplish both
common and antagonistic roles? We suggest that FBF and FOG-1 have partially
redundant roles, but that FBF is also a repressor of fog-1
expression. The partial redundancy is based in large part on the synthetic
proliferation defect of the fog-1; fbf-1 fbf-2 triple mutant. We do
not yet understand this redundancy at a molecular level. PUF and CPEB family
proteins bind distinct RNA sequences in vitro
(Bernstein et al., 2005
;
Mendez and Richter, 2001
;
White et al., 2001
), so it
seems unlikely that FBF and FOG-1 control mitosis by binding the same
regulatory element in vivo. One simple idea is that FOG-1 might activate
mitosis-promoting mRNAs, while FBF represses meiosis-promoting mRNAs. Two
known FBF target mRNAs, gld-1 and gld-3, promote entry into
meiosis (Crittenden et al.,
2002
; Eckmann et al.,
2004
; Kadyk and Kimble,
1998
), but FOG-1 targets are unknown. Another possibility is that
FBF and FOG-1 both repress the same key target. Consistent with this idea,
Xenopus Pumilio and CPEB both repress cyclin B1 mRNA
(Groisman et al., 2002
;
Nakahata et al., 2003
). In
C. elegans, gld-1 might be a common target mRNA: a putative CPE is
present in the gld-1 3'UTR, although it has not been confirmed
as a FOG-1 binding site (B.E.T., unpublished). A third possibility is that FBF
and FOG-1 control the same mRNA, but do so using antagonistic activities. For
example, FBF repression and FOG-1 activation might cooperate to obtain the
correct level of a dose-dependent regulator of mitosis. The identification of
FOG-1 and FBF target mRNAs should clarify which of these three plausible
possibilities are involved.
In addition to their redundancy, FBF represses fog-1 expression.
This repression is logical for the sperm/oocyte decision: FBF promotes
oogenesis by repressing fog-1, which is required for spermatogenesis.
We previously showed that FBF represses the fem-3 mRNA
(Zhang et al., 1997
); now
fog-1 and fog-3 are also likely targets. Therefore, FBF
appears to regulate the switch from spermatogenesis to oogenesis by
coordinately repressing several key regulators. Similarly, PUF3 in S.
cerevisiae binds and may regulate more than 100 nuclear-encoded mRNAs
with mitochondrial functions (Gerber et
al., 2004
; Olivas and Parker,
2000
). Therefore, PUF proteins are emerging as master regulators
of developmental and cellular processes by regulating batteries of genes at a
post-transcriptional level.
FBF repression of fog-1 seems counterintuitive for proliferation.
However, one possible explanation is that FBF repression maintains FOG-1 at an
appropriately low level to promote proliferation. In wild-type animals, FBF
levels decrease and FOG-1 levels increase as germ cells enter meiosis
(Crittenden et al., 2002
;
Lamont et al., 2004
) (this
work). By contrast, in fbf-1 fbf-2 mutants, FOG-1 levels increase
throughout the germline, and all germ cells enter spermatogenesis. Therefore,
FBF repression of fog-1 appears to be a crucial mechanism by which
FBF promotes mitosis. However, given the redundancy of FBF and FOG-1, we note
that FBF must promote germline mitoses by other mechanisms as well (e.g.
repression of gld-1 and gld-3)
(Crittenden et al., 2002
;
Eckmann et al., 2004
).
CPEB homologs may control mitosis broadly in animal development
FOG-1 is the second CPEB known to control mitotic divisions.
Xenopus CPEB is required for progression through the mitotic cell
cycle (Groisman et al., 2000
;
Groisman et al., 2002
) in
addition to its well-known role in meiosis (reviewed by
Mendez and Richter, 2001
).
Specifically, Xenopus CPEB promotes mitotic divisions during early
embryogenesis (Groisman et al.,
2000
; Groisman et al.,
2002
). A striking parallel between Xenopus CPEB and
C. elegans FOG-1 is that concentration is crucial in both cases. In
C. elegans, low FOG-1 promotes mitosis, while high FOG-1 specifies
sperm; in Xenopus, the amount of CPEB is reduced by regulated
degradation, and that decrease is necessary to promote mitotic divisions
(Mendez et al., 2002
). At a
high level, Xenopus CPEB regulates Mos RNA and progression through
meiosis, but it cannot promote mitosis. Given the striking parallels between
Xenopus CPEB and C. elegans FOG-1, we suggest that CPEB
family members may control mitosis broadly during animal development.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Austin, J. and Kimble, J. (1987). glp-1 is required in the germ line for regulation of the decision between mitosis and meiosis in C. elegans. Cell 51,589 -599.[CrossRef][Medline]
Barton, M. K. and Kimble, J. (1990). fog-1, a regulatory gene required for specification of spermatogenesis in the germ line of Caenorhabditis elegans.Genetics 125,29 -39.[Abstract]
Barton, M. K., Schedl, T. B. and Kimble, J.
(1987). Gain-of-function mutations of fem-3, a
sex-determination gene in Caenorhabditis elegans.Genetics 115,107
-119.
Bernstein, D. S., Buter, N., Stumpf, C. and Wickens, M. (2002). Analyzing mRNA-protein complexes using a yeast three-hybrid system: methods and applications. Methods 26,123 -141.[CrossRef][Medline]
Bernstein, D., Hook, B., Hajarnavis, A., Opperman, L. and
Wickens, M. (2005). Binding specificity and mRNA targets of a
C. elegans PUF protein, FBF-1. RNA
11,447
-458.
Berry, L. W., Westlund, B. and Schedl, T. (1997). Germ-line tumor formation caused by activation of glp-1, a Caenorhabditis elegans member of the Notch family of receptors. Development 124,925 -936.[Abstract]
Brenner, S. (1974). The genetics of
Caenorhabditis elegans. Genetics
77, 71-94.
Chen, P.-J. and Ellis, R. E. (2000). TRA-1A regulates transcription of fog-3, which controls germ cell fate in C. elegans. Development 127,3119 -3129.[Abstract]
Chen, P.-J., Singal, A., Kimble, J. and Ellis, R. E. (2000). A novel member of the Tob family of proteins controls sexual fate in Caenorhabditis elegans germ cells. Dev. Biol. 217,77 -90.[CrossRef][Medline]
Church, D. L., Guan, K.-L. and Lambie, E. J. (1995). Three genes of the MAP kinase cascade, mek-2, mpk-1/sur-1 and let-60 ras, are required for meiotic cell cycle progression in Caenorhabditis elegans. Development 121,2525 -2535.[Abstract]
Crittenden, S. L. and Kimble, J. (1998). Immunofluorescence methods for C. elegans. In Cells: A Laboratory Manual (ed. D. Spector, R. Goldman and L. Leinwand), pp. 108.1-108.9. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Crittenden, S. L., Bernstein, D. S., Bachorik, J. L., Thompson, B. E., Gallegos, M., Petcherski, A. G., Moulder, G., Barstead, R., Wickens, M. and Kimble, J. (2002). A conserved RNA-binding protein controls germline stem cells in Caenorhabditis elegans.Nature 417,660 -663.[CrossRef][Medline]
Crittenden, S. L., Eckmann, C. R., Wang, L., Bernstein, D. S.,
Wickens, M. and Kimble, J. (2003). Regulation of the
mitosis/meiosis decision in the Caenorhabditis elegans germline.
Philos. Trans. R. Soc. London Ser. B
358,1359
-1362.
Eckmann, C. R., Kraemer, B., Wickens, M. and Kimble, J. (2002). GLD-3, a Bicaudal-C homolog that inhibits FBF to control germline sex determination in C. elegans. Dev. Cell 3, 697-710.[CrossRef][Medline]
Eckmann, C. R., Crittenden, S. L., Suh, N. and Kimble, J.
(2004). GLD-3 and control of the mitosis/meiosis decision in the
germline of Caenorhabditis elegans. Genetics
168,147
-160.
Ellis, R. E. and Kimble, J. (1995). The fog-3 gene and regulation of cell fate in the germ line of Caenorhabditis elegans. Genetics 139,561 -577.[Abstract]
Finney, M. and Ruvkun, G. (1990). The unc-86 gene product couples cell lineage and cell identity in C. elegans. Cell 63,895 -905.[CrossRef][Medline]
Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E. and Mello, C. C. (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.Nature 391,806 -811.[CrossRef][Medline]
Forbes, A. and Lehmann, R. (1998). Nanos and Pumilio have critical roles in the development and function of Drosophila germline stem cells. Development 125,679 -690.[Abstract]
Gerber, A. P., Herschlag, D. and Brown, P. O. (2004). Extensive association of functionally and cytotopically related mRNAs with Puf family RNA-binding proteins in yeast. PLoS Biol. 2,E79 .[CrossRef][Medline]
Grant, B. and Hirsh, D. (1999).
Receptor-mediated endocytosis in the Caenorhabditis elegans oocyte.
Mol. Biol. Cell 10,4311
-4326.
Groisman, I., Huang, Y. S., Mendez, R., Cao, Q., Theurkauf, W. and Richter, J. D. (2000). CPEB, maskin, and cyclin B1 mRNA at the mitotic apparatus: implications for local translational control of cell division. Cell 103,435 -447.[CrossRef][Medline]
Groisman, I., Jung, M. Y., Sarkissian, M., Cao, Q. and Richter, J. D. (2002). Translational control of the embryonic cell cycle. Cell 109,473 -483.[CrossRef][Medline]
Hake, L. E. and Richter, J. D. (1994). CPEB is a specificity factor that mediates cytoplasmic polyadenylation during Xenopus oocyte maturation. Cell 79,617 -627.[CrossRef][Medline]
Hansen, D., Hubbard, E. J. A. and Schedl, T. (2004a). Multi-pathway control of the proliferation versus meiotic development decision in the Caenorhabditis elegans germline. Dev. Biol. 268,342 -357.[CrossRef][Medline]
Hansen, D., Wilson-Berry, L., Dang, T. and Schedl, T.
(2004b). Control of the proliferation versus meiotic development
decision in the C. elegans germline through regulation of GLD-1
protein accumulation. Development
131,93
-104.
Hirsh, D., Oppenheim, D. and Klass, M. (1976). Development of the reproductive system of Caenorhabditis elegans.Dev. Biol. 49,200 -219.[CrossRef][Medline]
Hodgkin, J. (1986). Sex determination in the
nematode C. elegans: analysis of tra-3 suppressors and
characterization of fem genes. Genetics
114, 15-52.
Hook, B., Bernstein, D., Zhang, B. and Wickens, M.
(2005). RNA-protein interactions in the yeast three-hybrid
system: affinity, sensitivity, and enhanced library screening.
RNA 11,227
-233.
Huynh, J.-R. and St Johnston, D. (2000). The role of BicD, Egl, Orb and the microtubules in the restriction of meiosis to the Drosophila oocyte. Development 127,2785 -2794.[Abstract]
Jan, E., Motzny, C. K., Graves, L. E. and Goodwin, E. B. (1999). The STAR protein, GLD-1, is a translational regulator of sexual identity in Caenorhabditis elegans. EMBO J. 18,258 -269.[CrossRef][Medline]
Jin, S.-W., Kimble, J. and Ellis, R. E. (2001a). Regulation of cell fate in Caenorhabditis elegans by a novel cytoplasmic polyadenylation element binding protein. Dev. Biol. 229,537 -553.[CrossRef][Medline]
Jin, S. W., Arno, N., Cohen, A., Shah, A., Xu, Q., Chen, N. and
Ellis, R. E. (2001b). In Caenorhabditis
elegans, the RNA-binding domains of the cytoplasmic polyadenylation
element binding protein FOG-1 are needed to regulate germ cell fates.
Genetics 159,1617
-1630.
Jones, A. R., Francis, R. and Schedl, T. (1996). GLD-1, a cytoplasmic protein essential for oocyte differentiation, shows stage- and sex-specific expression during Caenorhabditis elegans germline development. Dev. Biol. 180,165 -183.[CrossRef][Medline]
Kadyk, L. C. and Kimble, J. (1998). Genetic regulation of entry into meiosis in Caenorhabditis elegans.Development 125,1803 -1813.[Abstract]
Kawasaki, I., Shim, Y.-H., Kirchner, J., Kaminker, J., Wood, W. B. and Strome, S. (1998). PGL-1, a predicted RNA-binding component of germ granules, is essential for fertility in C. elegans. Cell 94,635 -645.[CrossRef][Medline]
Kimble, J. and Simpson, P. (1997). The LIN-12/Notch signaling pathway and its regulation. Annu. Rev. Cell Dev. Biol. 13,333 -361.[CrossRef][Medline]
Kimble, J. E. and White, J. G. (1981). On the control of germ cell development in Caenorhabditis elegans. Dev. Biol. 81,208 -219.[CrossRef][Medline]
Kraemer, B., Crittenden, S., Gallegos, M., Moulder, G., Barstead, R., Kimble, J. and Wickens, M. (1999). NANOS-3 and FBF proteins physically interact to control the sperm-oocyte switch in Caenorhabditis elegans. Curr. Biol. 9,1009 -1018.[CrossRef][Medline]
Lamont, L. B., Crittenden, S. L., Bernstein, D., Wickens, M. and Kimble, J. (2004). FBF-1 and FBF-2 regulate the size of the mitotic region in the C. elegans germline. Dev. Cell 7,697 -707.[CrossRef][Medline]
Lin, H. and Spradling, A. C. (1997). A novel group of pumilio mutations affects the asymmetric division of germline stem cells in the Drosophila ovary. Development 124,2463 -2476.[Abstract]
Luitjens, C., Gallegos, M., Kraemer, B., Kimble, J. and Wickens,
M. (2000). CPEB proteins control two key steps in
spermatogenesis in C. elegans. Genes Dev.
14,2596
-2609.
Mendez, R. and Richter, J. D. (2001). Translational control by CPEB: a means to the end. Nat. Rev. Mol. Cell Biol. 2,521 -529.[CrossRef][Medline]
Mendez, R., Barnard, D. and Richter, J. D. (2002). Differential mRNA translation and meiotic progression require Cdc2-mediated CPEB destruction. EMBO J. 21,1833 -1844.[CrossRef][Medline]
Miller, M. A., Nguyen, V. Q., Lee, M. H., Kosinski, M., Schedl,
T., Caprioli, R. M. and Greenstein, D. (2001). A sperm
cytoskeletal protein that signals oocyte meiotic maturation and ovulation.
Science 291,2144
-2147.
Nakahata, S., Kotani, T., Mita, K., Kawasaki, T., Katsu, Y., Nagahama, Y. and Yamashita, M. (2003). Involvement of Xenopus Pumilio in the translational regulation that is specific to cyclin B1 mRNA during oocyte maturation. Mech. Dev. 120,865 -880.[CrossRef][Medline]
Olivas, W. and Parker, R. (2000). The Puf3 protein is a transcript-specific regulator of mRNA degradation in yeast. EMBO J. 19,6602 -6611.[CrossRef][Medline]
Richter, J. D. (1999). Cytoplasmic
polyadenylation in development and beyond. Microbiol. Mol. Biol.
Rev. 63,446
-456.
Tay, J. and Richter, J. D. (2001). Germ cell differentiation and synaptonemal complex formation are disrupted in CPEB knockout mice. Dev. Cell 1, 201-213.[CrossRef][Medline]
Timmons, L. and Fire, A. (1998). Specific interference by ingested dsRNA. Nature 395, 854.[CrossRef][Medline]
Ward, S., Roberts, T. M., Strome, S., Pavalko, F. M. and Hogan,
E. (1986). Monoclonal antibodies that recognize a polypeptide
antigenic determinant shared by multiple Caenorhabditis elegans
sperm-specific proteins. J. Cell Biol.
102,1778
-1786.
White, E. K., Moore-Jarrett, T. and Ruley, H. E. (2001). PUM2, a novel murine Puf protein, and its consensus RNA-binding site. RNA 7,1855 -1866.[Abstract]
Wickens, M., Bernstein, D. S., Kimble, J. and Parker, R. (2002). A PUF family portrait: 3'UTR regulation as a way of life. Trends Genet. 18,150 -157.[CrossRef][Medline]
Zamore, P. D., Williamson, J. R. and Lehmann, R. (1997). The Pumilio protein binds RNA through a conserved domain that defines a new class of RNA-binding proteins. RNA 3,1421 -1433.[Abstract]
Zhang, B., Gallegos, M., Puoti, A., Durkin, E., Fields, S., Kimble, J. and Wickens, M. P. (1997). A conserved RNA-binding protein that regulates sexual fates in the C. elegans hermaphrodite germ line. Nature 390,477 -484.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
S. Nadarajan, J. A. Govindan, M. McGovern, E. J. A. Hubbard, and D. Greenstein MSP and GLP-1/Notch signaling coordinately regulate actomyosin-dependent cytoplasmic streaming and oocyte growth in C. elegans Development, July 1, 2009; 136(13): 2223 - 2234. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Y. Koh, L. Opperman, C. Stumpf, A. Mandan, S. Keles, and M. Wickens A single C. elegans PUF protein binds RNA in multiple modes RNA, June 1, 2009; 15(6): 1090 - 1099. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Suh, S. L. Crittenden, A. Goldstrohm, B. Hook, B. Thompson, M. Wickens, and J. Kimble FBF and Its Dual Control of gld-1 Expression in the Caenorhabditis elegans Germline Genetics, April 1, 2009; 181(4): 1249 - 1260. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R. Stumpf, J. Kimble, and M. Wickens A Caenorhabditis elegans PUF protein family with distinct RNA binding specificity RNA, August 1, 2008; 14(8): 1550 - 1557. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-H. Lee, M. Ohmachi, S. Arur, S. Nayak, R. Francis, D. Church, E. Lambie, and T. Schedl Multiple Functions and Dynamic Activation of MPK-1 Extracellular Signal-Regulated Kinase Signaling in Caenorhabditis elegans Germline Development Genetics, December 1, 2007; 177(4): 2039 - 2062. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kimble and D. C. Page The Mysteries of Sexual Identity: The Germ Cell's Perspective Science, April 20, 2007; 316(5823): 400 - 401. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-G. Cheong and T. M. T. Hall Engineering RNA sequence specificity of Pumilio repeats PNAS, September 12, 2006; 103(37): 13635 - 13639. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Otori, T. Karashima, and M. Yamamoto The Caenorhabditis elegans Homologue of Deleted in Azoospermia Is Involved in the Sperm/Oocyte Switch Mol. Biol. Cell, July 1, 2006; 17(7): 3147 - 3155. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. E. Thompson, L. B. Lamont, and J. Kimble Germ-line induction of the Caenorhabditis elegans vulva PNAS, January 17, 2006; 103(3): 620 - 625. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Bachorik and J. Kimble Redundant control of the Caenorhabditis elegans sperm/oocyte switch by PUF-8 and FBF-1, two distinct PUF RNA-binding proteins PNAS, August 2, 2005; 102(31): 10893 - 10897. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||