|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 6 July 2005
doi: 10.1242/dev.01918
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Center for Cancer Research, Massachusetts Institute of Technology, Cambridge
MA 02139, USA
2 Department of Internal Medicine and Yale Liver Center, Yale University School
of Medicine, New Haven, CT 06520-8019, USA
* Author for correspondence (e-mail: kirsten_sadler_phd98{at}post.harvard.edu)
Accepted 24 May 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Hepatomegaly, Biliary paucity, Choledochal cyst, Steatosis, Hepatogenesis, Zebrafish
| Introduction |
|---|
|
|
|---|
25% of US citizens
(Neuschwander-Tetri and Caldwell,
2003
The power of zebrafish to study vertebrate development is well appreciated,
and many disease models have emerged from studies with this organism
(Rubinstein, 2003
). There are
several advantages to using zebrafish embryos to develop models of liver
diseases. First, in addition to the embryological and genetic benefits of
zebrafish, the liver is not the site of embryonic hematopoiesis as it is in
mammals, and therefore mutants in liver size or structure will not have the
confounding phenotype of hematopoietic dysfunction. Second, the zebrafish
embryo survives on yolk for the first 3-4 days of development, after which its
digestive system is fully functional and the embryonic fish begins feeding on
day 5. Thus, not only is embryogenesis rapid, but the development of a
physiologically functional liver occurs within the span of a few days. This
provides the opportunity to carry out an embryonic screen to identify mutants
that are defective in either liver development or function, or both. Third,
baring minor differences, the anatomy, function, organization and cellular
composition of adult zebrafish and mammalian livers are virtually the same
(Hinton and Couch, 1998
;
Rocha et al., 1994
;
Wallace and Pack, 2003
), as is
the histopathology of fatty liver (steatosis), cholestasis and neoplasia
(Amatruda et al., 2002
;
Spitsbergen et al., 2000
) (J.
Glickman, personal communication), allowing direct comparison between
zebrafish and mammalian liver disease processes. Indeed, recent work has
demonstrated that genes that underlie Alagille Syndrome, a pediatric disorder
that results in a paucity of intrahepatic bile ducts, among other defects,
play an important role in zebrafish biliary development
(Lorent et al., 2004
).
Finally, although the early stages of hepatogenesis are relatively well
understood and are similar in mice and zebrafish
(Duncan, 2003
;
Field et al., 2003
;
Ober et al., 2003
), less is
known in either system about the final stage of hepatogenesis hepatic
outgrowth. Therefore, the zebrafish is an excellent system in which to screen
for embryonic mutants with large livers (hepatomegaly), for it holds the
potential of uncovering both developmental and pathological processes that
contribute to this phenotype.
Our laboratory has used insertional mutagenesis to generate over 400 lines
of zebrafish bearing mutations in 315 genes that are essential for embryonic
development, and the mutated gene has been cloned for each line
(Amsterdam et al., 2004
;
Golling et al., 2002
). We
calculate that this represents
22% of the total number of zygotic genes
that are essential, as determined genetically, between days 1 and 5 of
development (Amsterdam et al.,
2004
).
We developed a tool to screen day 5 embryos for abnormalities in liver
size. Seven mutants with hepatomegaly were identified out of the 297 lines
screened. Although several of the mutants may be defective in the regulation
of hepatic outgrowth, three of them [vps18, neurofibromatosis 2
(nf2) and foie gras (fgr; flj12716l
Zebrafish Information Network)] demonstrate signs of hepatic
pathology. Mutation in the vps18 gene (which is required for
endosomal trafficking to acidic organelles) results in albinism and
hepatomegaly associated with enlarged hepatocytes, malformation of the bile
canaliculi (which is the site of bile secretion at the hepatocyte apical
membrane) and biliary paucity. Whereas the pigmentation defect and hepatocyte
enlargement can be attributed to the failure to traffic endosomes to the
correct intracellular compartment, the canalicular defect probably reflects a
defect in the formation of the hepatocyte apical membrane. The hepatobiliary
phenotypes seen in this mutant resemble the hepatic signs of individuals with
arthrogryposis-renal dysfunction-cholestasis (ARC) syndrome, which is caused
by mutation of vps33B (Gissen et
al., 2004
), a gene that interacts with vps18
(Kim et al., 2001
;
Peterson and Emr, 2001
;
Sriram et al., 2003
). Second,
mutation of nf2 results in hepatomegaly associated with choledochal
cyst formation, and we hypothesize that this results from deregulated biliary
cell proliferation. Third, fgr mutants develop severe steatosis and
we propose this mutant as the first non-mammalian model of a fatty liver
disease.
| Materials and methods |
|---|
|
|
|---|
CY3-SA labeling
The labeling protocol was modified from that developed by C. Semino
(Phylonix Pharmaceuticals). Embryos were rehydrated through a graded series of
methanol to PBST, bleached with 10% H2O2/0.5x
SSC/0.5% formamide for 12 minutes and blocked with PBST/10% BSA for 1 hour at
room temperature. Embryos were incubated with CY3-SA (Sigma; 1:500) in a dark
chamber for 2 hours at room temperature, washed with PBST and stored in 80%
glycerol.
Embryos were viewed on a Leica MZFLIII stereomicroscope equipped with a
fluorescent attachment and scored for liver size, shape, number of lobes as
well as for labeling and morphology of the gut. Mutants with hepatomegaly had
a left lobe that was visually estimated as greater than
20% larger than
that of their phenotypically wild-type siblings. In each case, the general
morphological phenotype has been shown to be tightly linked to a single viral
insertion (Golling et al.,
2002
), and the liver phenotype was always associated with the
general morphological phenotype. The mutants were coded, scored blind and only
decoded after the phenotype had been observed in at least four clutches.
Images were obtained on a Zeiss Axioplan 2 using OpenLab software
(Improvision, Lexington, MA).
Morpholino injection
Approximately 0.5-2.0 nl of the following morpholinos at the indicated
concentrations were injected into one-cell embryos: vps18 (1 mM)
ATTGATCCAGAATAGATGCCATTGC; nf2 (0.5 mM) TCAGACCCAAATTGACATAGTGAC;
fgr (0.05 mM) GAGATCCCATTGCGCTGGACTCATG.
RT-PCR
Day 5 wild-type and mutant embryos from each line were collected and RNA
was extracted using the RNAEasy kit (Qiagen). Oligo dT primed cDNA from the
RNA equivalent of two embryos was created using the SuperScript II RT Kit
(Invitrogen). PCR reactions (30 µl) contained 0.25% of the cDNA reaction,
1x buffer, 0.4 mM MgCl2, 0.2 µM dNTPs, 0.5 µl Taq
polymerase (Invitrogen) and 0.4 µM of each primer, and the reaction was
carried out for 30 cycles. PCR products were run on a 1.2% agarose gel
containing 1 µg/ml ethidium bromide. Primers sequences, 3' to
5': fgr-F CTTGCCCCATGAGGTATGAGCAC, fgr-R TGTTGAGCTGAGGGAGGACT; vps18-F
CTGGAGGTTGAACGTGGTTT, vps18-R GCAGGAGCAAGAAGTGGAAC; nf2-F
CAACCCCACAACAAGCTGAGC, nf2-R GAAGATCGGCTGTTTCCTCAGAG; Actin-F
CATCAGCATGGCTTCTGCTCT, Actin R-GCAGTGTACAGAGACACCC.
Histology and electron microscopy
Embryos were fixed in 4% paraformaldehyde for 4 hours at room temperature,
washed and dehydrated as described above and embedded in histogel
(Richard-Allen Scientific) and then in paraffin. Serial sections (4 µm)
were cut and stained with Hematoxylin and Eosin, photographed on a Leica DMRB
microscope mounted with a QImaging Retiga EXi digital camera and processed
using Adobe Photoshop 5.0.
Embryos for electron microscopy were fixed over night in Karnovsky's fixative (0.1 M cacodylate/2.5% gluteraldehyde/2% formaldehyde/0.85 M CaCl2 pH 7.4) and processed by the Renal Pathology Service at the Brigham and Woman's Hospital (Boston, MA).
Tissue immunolocalization
Day 5 and 7 embryos were anesthetized and embedded in OCT Compound (Tissue
Tek, Sakura Fintek), frozen on dry ice and 10 µm sections were cut.
Sections were thawed and fixed for 10 minutes with acetone cooled to
20°C. Non-specific sites were blocked with 1% BSA in PBS containing
0.05% Triton X100 and was incubated with 2 hours at room temperature with a
1:100 dilution of monoclonal antibody to P-glycoprotein (Mdr1 and 3, clone
C219; Signet laboratories, Dedham, MA). Sections were washed and incubated
with Cy3-SA (1:250; Sigma) and Alexa 488 anti-mouse IgG (1:1000; Molecular
probes, Eugene, OR) for 1 hour at room temperature. Images were acquired on a
Zeiss LSM 510 confocal microscope and processed using Adobe Photoshop.
PED-6 labeling
Day 7 embryos were bathed in 0.3 µg/ml PED6 (Molecular Probes) for 2
hours at 28°C and imaged on a Ziess Axioplan 2. Over 30 mutant, wild-type
and morphant embryos were scored for incorporation of the dye into the
gallbladder and for the size of the common bile duct.
Histological measurements
Lysosomes and nuclei were counted in 5 thin (1 µm), Toluidine Blue
stained Epon sections through the liver of day 5 vps18 mutant embryos
and their phenotypically wild-type siblings.
For each line with hepatomegaly, the hepatocyte internuclear distance was determined from Hematoxylin and Eosin sections. Ten images at 1000x magnification from at least two wild-type and three mutant embryos from the same clutch were collected and the distance between adjacent cell nuclei was measured for 125-175 hepatocytes using Openlab. T-tests were performed on each wild-type-mutant pair; P-values <0.001 were considered to be significant.
| Results |
|---|
|
|
|---|
22% saturation
(Amsterdam et al., 1999Hepatomegaly is one of the most common and obvious signs of liver disease. Therefore, hepatomegaly in day 5 zebrafish embryos could be a sign of liver pathology. Alternatively, hepatomegaly could develop from a deregulated liver growth during hepatic outgrowth, and such mutants would be valuable for understanding this final phase of liver development.
We developed a technique to specifically label the liver so as to carry out
a large scale screen using fixed material. As biotin serves as a cofactor for
a number of liver enzymes (Moss and Lane,
1971
), it is found at high levels in hepatocytes. We found that
streptavidin conjugated to the fluorophore CY3 (CY3-SA) labels the liver in
day 5 embryos (Fig. 1A,B).
Additionally, CY3-SA labels the intestinal epithelia and yolk because of a
high concentration of biotin in these tissues
(Fig. 1A,B).
We used CY3-SA to screen nearly all of the lines of our collection to
identify those which develop hepatomegaly on day 5 of development. Out of the
297 lines that were available to be screened, seven mutants with hepatomegaly
were identified (Fig. 1B;
Table 1), representing 2.4% of
all mutants screened. Given that our collection represents
22% of all
embryonic essential genes, and that this screen covered 94% of our collection
(i.e.
21% of all embryonic essential genes), we estimate that a total of
33 of the essential genes could result in this phenotype. The genes
underlying hepatomegaly each appear to function in different cellular
processes, although two (fgr and pté) have no defined
cellular or biochemical function (i.e. `novel';
Table 1).
|
-tub, and is severely abnormal in fgr.
|
-tub and thoc2) were identified
as having enlarged hepatocytes, which was confirmed by a quantitative measure
of cell size (Fig. 2). Two
mutants (vps18 and nf2) contained large spaces in the
extracellular hepatic matrix (Fig.
2A; see Fig. 5).
Further analysis suggested that this is associated with biliary defects in
both cases (see below). In two mutants (sox9a and
pté), the hepatocytes are the same size as wild type
(Fig. 2B) and there is no
evidence of expansion of the extracellular space; in these cases, hepatomegaly
may develop due to unregulated proliferation of hepatocytes. Signs of
hepatobiliary pathology were detected in three mutants (vps18, nf2
and fgr), and we further characterized each of these.
vps18 is required for pigmentation, endosomal transport in hepatocytes, formation of the bile canaliculi and intrahepatic biliary development: a model for the hepatic signs of ARC syndrome
Mutants from hi2499A contain an insertion in the
vps18 gene following nucleotide 2236
(Fig. 3A). This insertion
results in an abrogation of the vps18 message in mutant embryos
(Fig. 3B). vps18
message is present in oocytes (i.e. immature and unfertilized eggs) and in
embryos on days 1-5 of development (K.C.S., unpublished), and only the
zygotically transcribed message is affected in the hi2499A mutants.
Injecting high concentrations of a morpholino directed against the start site
of the vps18 gene to knock-down the translation of the maternal
message results in pigmentation defects
(Fig. 3A) and, in some embryos,
causes global developmental defects early in development (K.C.S.,
unpublished). Lower concentrations of the morpholino do not interfere
significantly with pigmentation or development, but do cause hepatomegaly
(Fig. 4A). These data indicate
that the pigmentation defects and hepatomegaly observed in mutants from
hi2499A can be attributed to the loss of vps18 function.
Thus, we hereafter refer to the hi2499A mutants as
vps18.
vps18 is a class C vacuolar protein sorting gene
(Raymond et al., 1992
). The
products of the class C genes (vps11, vps16, vps18 and
vps33) direct the targeting, docking and SNARE-mediated fusion of
vesicles to the yeast vacuole and animal lysosome
(Kim et al., 2001
;
Peterson and Emr, 2001
;
Poupon et al., 2003
;
Raymond et al., 1992
;
Sato et al., 2000
;
Srivastava et al., 2000
). We
carried out a detailed analysis to determine whether this function of the
vps18 gene could account for the two prominent phenotypes displayed
by vps18 mutants: albinism and hepatomegaly.
|
|
|
Livers in day 5 wild-type embryos consist primarily of hepatocytes, which have a lacey, eosinophilic cytoplasm (Fig. 2A; Fig. 5B). Although sinusoids can be easily identified, bile ducts are never observed in embryonic livers using standard histological methods. Hepatocytes in vps18 mutant embryos are enlarged (Fig. 2) and contain large cytoplasmic structures resembling vesicles or vacuoles (Fig. 5D). There is less eosinophic material in the vps18 mutant hepatocytes compared with wild type, and this may reflect the decreased levels of stored glycogen in the vps18 mutant hepatocytes (K.C.S., unpublished).
We used transmission electron microscopy (TEM) to determine the nature of
the cytoplasmic structures seen in vps18 mutant hepatocytes
(Fig. 5E,F). Hepatocytes from
wild-type day 5 embryos contain copious glycogen, which causes the cytoplasm
to have a homogeneous, grainy appearance. By contrast, little glycogen is seen
in the vps18 mutant hepatocytes. Instead, large, membrane-bound
structures containing proteinacious material and debris were observed
(Fig. 5F). These are similar to
the aberrant structures seen in yeast and Drosophila cells that lack
vps18 (Sevrioukov et al.,
1999
; Sriram et al.,
2003
; Srivastava et al.,
2000
). A failure to deliver endosomal cargo to the lysosome
prevents lysosome biogenesis; we found that vps18 mutant hepatocytes
have one-quarter the number of lysosomes of wild type
(Fig. 4G). Taken together,
these data suggest that vps18 acts in zebrafish to target endosomes
to the pigment granule in melanocytes and to the lysosome in hepatocytes. We
conclude that the failure of endosomal-lysosomal targeting causes transport
intermediates to build up in the hepatocytes, resulting in hepatocyte
enlargement and hepatomegaly.
ARC syndrome is an autosomal recessive disease that affects the liver,
kidneys, platelets and neurogenic muscular function
(Eastham et al., 2001
).
Typical hepatic defects include hepatomegaly, intrahepatic biliary paucity and
cholestasis associated with mislocalization of canalicular markers
(Gissen et al., 2004
;
Horslen et al., 1994
).
Recently, Gissen et al. have shown that this disease is due to mutation in
another class C vps gene, vps33B
(Gissen et al., 2004
). Given
that Vps18 and Vps33B function in the same complex
(Huizing et al., 2001
;
Kim et al., 2001
;
Peterson and Emr, 2001
;
Poupon et al., 2003
;
Raymond et al., 1992
;
Subramanian et al., 2004
), we
asked whether biliary defects similar to ARC syndrome occur in vps18
zebrafish mutants.
vps18 mutant livers contain large spaces in between hepatocytes (Fig. 2A). The spaces are devoid of nucleated red blood cells and were not lined by endothelial cells. We concluded that they were not part of the hepatic microvasculature (sinusoids). In order to determine whether these spaces reflected a defect in the intrahepatic biliary system, we undertook a detailed histological, immunological and ultrastructural examination of the embryonic biliary tree.
Bile is secreted at the hepatocyte apical membrane in a specialized
structure called the bile canaliculi
(Ujhazy et al., 2001
). Bile
transporters, such as MDR1, are specifically localized to the canaliculi in
mammals (Trauner et al., 1997
;
Trauner and Boyer, 2003
) and
in fish (Hemmer et al., 1995
;
Lorent et al., 2004
). In day 5
wild-type zebrafish embryos, MDR1 is localized exclusively to the tube-shaped
canaliculi (Fig. 6B,C). By
contrast, MDR1 localization in vps18 mutant livers is punctate
(Fig. 6E,F) and the canaliculi
are large and round (Fig. 6F,
arrows). Importantly, we found MDR1 labeling in the cytoplasm of some
vps18 hepatocytes (box in Fig.
6F), suggesting that it is not trafficked properly to the apical
canalicular domain.
In mammals, bile flows from bile canaliculi to bile ducts through the canal
of Hering. Teleosts do not appear to have a canal of Hering, but instead the
canaliculi empty directly into the lumen of preductules, which are formed by
biliary pre-ductal epithelial cells (PDEC), a specialized cell of the
intrahepatic biliary tree in teleosts
(Hinton and Pool, 1976
;
Rocha et al., 1994
). PDECs
form the lumen of the pre-ductule by wrapping around themselves, analogous to
capillary formation by endothelial cells
(Hinton and Couch, 1998
;
Hinton and Pool, 1976
;
Rocha et al., 1994
). Although
PDECs are reported to express cytokeratin 19
(Lorent et al., 2004
;
Matthews et al., 2004
), a
classic marker of biliary epithelial cells, they are not columnar, they lack a
basal lamina (Rocha et al.,
1994
) and they appear less differentiated than the cholangiocytes
that form the hepatic duct, gallbladder and common bile duct
(Fig. 7G).
|
|
TEM was used to determine whether vps18 mutants have a defect in PDECs and the bile canaliculi. The number of PDECs in day 5 vps18 mutant livers is drastically reduced, and those we could identify were shrunken, did not maintain tight junctions with the surrounding hepatocytes and their nuclei contained condensed DNA (Fig. 6H), suggestive of apoptosis. The space seen to surround PDECs in vps18 mutants may represent the large extracellular spaces observed on histological sections. As in ARC syndrome patients (P. Gissen, personal communication) the extrahepatic biliary tree is not affected in vps18 mutants (K.C.S., unpublished).
Consistent with the abnormal MDR1 labeling seen in vps18 mutant
livers, there are dramatic defects in the bile canaliculi. Canaliculi in
wild-type zebrafish embryos are packed with regularly spaced and evenly shaped
microvilli (Fig. 6I), and
ultrastructurally appear very similar to canaliculi in mammals. Canaliculi in
vps18 mutants have sparse, blunted microvilli and are distended and
contain debris (Fig. 6C,D).
This morphology is typically seen in individuals with cholestasis and is
identical to those seen in sea lamprey which develop cholestasis during
metamorphosis (Sidon and Youson,
1983
), suggesting cholestasis may also develop in vps18
mutants.
Our analysis of vps18 mutants indicates that the pigmentation
defects and hepatomegaly can be attributed to the well characterized function
for this gene in endosomal-lysosomal trafficking. In addition, this study has
identified a new role for vps18 in trafficking to the hepatocyte
apical plasma membrane and formation of the bile canaliculi. Canalicular
malformation (Gissen et al.,
2004
) and biliary paucity (P. Gissen, personal communication) is
an abnormality shared between vps18 mutants in zebrafish and mutation
of the vps33B gene in individuals with ARC syndrome. Taken together,
these data are consistent with the hypothesis that class C VPS genes are
required in trafficking to the bile canaliculi at the hepatocyte apical plasma
membrane.
nf2 mutants as a model for choledochal cysts
Choledochal cyst formation is a congenital disorder that is most often
detected in childhood, although an increased incidence in adults has recently
been reported (Soreide et al.,
2004
). Cyst classification is based on the site of the cyst and
whether both intrahepatic and extrahepatic involvement is detected
(Soreide et al., 2004
). The
etiology of cyst formation is not known. Although most cases are the result of
developmental defects, a genetic component is suggested by the occurrence of
some familial cases (Behrns et al.,
1998
; Iwama, 1998
;
Iwama et al., 1985
;
Iwata et al., 1998
).
Choledochal cysts carry a greatly elevated risk for developing
cholangiocarcinoma, and although cyst excision diminishes this risk, it is not
eliminated (Soreide et al.,
2004
). This suggests that that cholangiocytes in individuals with
choledochal cysts may be predisposed to hyperproliferation and malignant
transformation.
The Nf2 gene in mammals is a tumor suppressor
(Lekanne Deprez et al., 1994
;
McClatchey et al., 1998
;
Ruttledge et al., 1994
;
Sanson et al., 1993
). Mutants
from hi3332 contain a single viral insertion within the
intron preceding the first coding exon of the nf2 gene
(Fig. 7A). This insertion
causes a complete abrogation of the nf2 message in mutant embryos
(Fig. 7B). The nf2
gene has been duplicated in zebrafish to create nf2a (subsequently
called nf2) and nf2b genes, which are over 60% identical at
the nucleotide level (A.A., unpublished). The nf2 gene is expressed
in oocytes and in embryos through day 5 of development, while the
nf2b message is detected only in oocytes (K.C.S., unpublished).
Injecting embryos with a morpholino that is specific for the nf2
message phenocopies the biliary phenotype observed in mutants from
hi3332 (see below). Thus, it is unlikely that
nf2b significantly affects the phenotype of mutants bearing an
insertion in the nf2 gene and we refer to the mutants from
hi3332 as nf2.
Mouse embryos homozygously deleted for the nf2 gene arrest before
gastrulation (McClatchey et al.,
1997
). Our screen indicates that the nf2 gene is also
essential for embryogenesis in zebrafish, although nf2 mutants have
only modest morphological defects on day 5 of development, including a small
forebrain and hepatomegaly (Fig.
1B). We attribute this difference to the presence of maternal
nf2 message, as injecting a high concentration of a morpholino
designed against the nf2 start site arrests embryos at the one- to
two-cell stage.
|
The most striking phenotype of nf2 mutants is the dilated common bile duct (Fig. 7G-N). On histological sections, both the gallbladder and the common bile duct are enlarged compared with wild-type sections through the same plane (Fig. 7G-I), indicating the formation of a type Ic (solitary, cystic) choledochal cyst. In some nf2 mutant embryos, diverticuli are observed in the cystic ducts (Fig. 7I), indicating the formation of Type II (supraduodenal diverticuli) choledochal cysts. Both of these abnormalities are not accompanied by any obvious morphological or dysplastic change in the cholangiocytes, but there does appear to be an increase in the number of cells forming the duct.
The fluorphor-linked phospholipid, PED6, has been used in zebrafish to
visualize the gut and gallbladder in live embryos
(Farber et al., 2001
). We used
PED6 to examine the common hepatic duct in live embryos. All wild-type day 7
embryos incubated in PED6 demonstrate robust fluorescence in the gut and
gallbladder, as do the majority of the nf2 mutants
(Fig. 7J,K), although some of
the mutants and nf2 morphants fail to transfer any PED6 to the
gallbladder (i.e. `no label' in Fig.
7O) The common bile duct can barely be detected as a string of
fluorescence connecting the gallbladder and the gut in wild-type embryos
(Fig. 7M,O), while 80% of the
nf2 mutant embryos have a markedly distended bile duct
(Fig. 7N,O). Roughly half of
the mutant embryos also form a diverticuli from the common bile duct
(Fig. 7N), confirming the
histological phenotype (Fig.
7I). Obstruction can result in biliary dilation; however, serial
sectioning through the common bile duct nf2 embryos as well as pulse
chase experiments with PED6 did not reveal any obstruction distal to the cyst
(K.C.S., unpublished). Taken together, these histological and physiological
data indicate that the nf2 gene in zebrafish is involved in bile
ductogenesis, and that loss of nf2 function results the formation of
type I and type II choledochal cysts.
Fgr mutants as a model for steatosis
Steatosis is a common cause of hepatomegaly
(Neuschwander-Tetri and Caldwell,
2003
). Approximately 10% of individuals with steatosis that have
no history of alcohol abuse progress to develop the severe fatty liver disease
non-alcoholic steatohepatitis (NASH), characterized by hepatomegaly, deranged
liver function and steatosis, resulting in hepatocyte death and inflammation
that can develop into cirrhosis (Diehl,
2001
). It is not clear why only a subset of individuals progress
from simple steatosis to NASH, but genetic predisposition may play an
important role. Indeed, while steatosis and NASH are usually associated with
obesity, there are well documented cases of familial NASH
(Neuschwander-Tetri and Caldwell,
2003
; Struben et al.,
2000
; Willner et al.,
2001
), indicating a genetic component to this disease.
hi1532B mutants develop massive hepatomegaly, a failure of gut development and abnormalities lower jaw and the fin morphology (Fig. 1). hi1532B mutants contain an insertion in the intron between exons 11 and 12 of a novel gene which we named foie gras (fgr). The virus contains a 172 bp gene-trap cassette and in hi1532B mutant embryos, the gene-trap is spliced in frame following bp 1287 of the fgr-coding sequence (Fig. 8A). This results in a frame shift that creates a stop codon immediately following the gene trap (Fig. 8A). Thus, mutant embryos from hi1532B contain only transcript that encodes the allele with the gene trap (Fig. 8B, mutant band), while phenotypically wild-type siblings from the same clutch, of which two-thirds of these embryos are heterozygotes, have transcript encoding the wild-type allele as well as a small amount of the mutant allele (Fig. 8B). Injection of a morpholino designed against the start codon of the fgr message phenocopies the hi1532B mutants (K.C.S., unpublished), leading us to conclude that the viral insertion in this gene results in a loss of fgr function. Henceforth, we refer to mutants from hi1532B as fgr.
Histological analysis of fgr mutant livers revealed enlarged hepatocytes which are filled with large, clear vesicles (Fig. 8C-D), suggestive of fat accumulation. Cells with fragmented nuclei and cell corpses, indicative of cell death, were frequently seen in fgr mutant livers (Fig. 8D), but never in wild type. Using the lipid stain, oil red O, we found a substantial amount of lipid accumulation in fgr mutant livers (Fig. 8E,F). Thus, some of the hallmark signs of NASH hepatocytes enlargement, steatosis and an increase in hepatocyte death were all observed in fgr mutants. The exception is the conspicuous absence of inflammation in fgr mutant livers, despite the marked cell death. We attribute this to the incomplete maturation of the zebrafish immune system at this stage of development. Nevertheless, mutation of the fgr gene, for which the function has not yet been determined in any organism, results in hepatomegaly associated with a phenotype that resembles NASH, and may serve as a non-mammalian model for studying this widespread and important disease.
| Discussion |
|---|
|
|
|---|
The role of vps18 in vesicle trafficking to the vacuole in yeast
(Peterson and Emr, 2001
;
Sato et al., 2000
;
Srivastava et al., 2000
), to
the pigment granule and synapse in Drosophila
(Narayanan et al., 2000
;
Sevrioukov et al., 1999
;
Shestopal et al., 1997
) and to
the lysosome in mammals (Huizing et al.,
2001
; Kim et al.,
2001
; Poupon et al.,
2003
) has been well defined. Although data from
Drosophila (Counce,
1956
) and our morpholino experiments suggest an essential role for
vps18 early in development, we believe the maternal contribution of
RNA, protein and nutrients in zebrafish enables the vps18 mutants,
and others (such as
-tub) that bear mutation in a
cell-essential gene, to survive the first few days of development.
We found that the two prominent morphological phenotypes of the
vps18 mutant zebrafish embryo pigmentation and hepatomegaly
could both be attributed to the well characterized role for the Vps18
protein in trafficking to the pigment granule or lysosome. It is likely that
hepatomegaly develops in these embryos due to the accumulation of prelysosomal
vesicles in the hepatocyte cytoplasm causing cell enlargement. Further
analysis of this mutant, however, suggests that this protein also functions in
trafficking to the hepatocyte apical membrane and formation of the canaliculi,
and is required for development of the intrahepatic biliary tree.
Alternatively, biliary paucity in these mutants could develop because of
damage and death of the PDECs (i.e. biliary atresia), possibly as a result of
cholestasis which may develop in these mutants. Biliary paucity and
canalicular defects are also seen in individuals who suffer from ARC syndrome
(P. Gissen, personal communication), which is due to homozygous mutation of
the vps33B gene (Gissen et al.,
2004
). Given that the Vps18 and Vps33B proteins act as part of the
same complex in yeast and in animals
(Huizing et al., 2001
;
Kim et al., 2001
;
Peterson and Emr, 2001
;
Sato et al., 2000
) in
trafficking to the vacuole and lysosome, and that vesicle targeting and fusion
with the apical membrane in hepatocytes involves a SNARE-dependent process
that requires other VPS genes (Tuma and
Hubbard, 2001
,), our data support the hypothesis that
vps18 and vps33B are also required for trafficking to the
apical membrane.
Interestingly, morpholino knock down of vps33B message in zebrafish embryos reportedly results in cholestasis and biliary paucity (M. Pack, personal communication). Given that the phenotypes of vps18 mutants, vps33B morphants and individuals with ARC syndrome are not identical [i.e. vps18 mutants do not have signs of arthrogryposis or renal dysfunction (K.C.S., unpublished)] and vps33B zebrafish morphants and individuals with ARC syndrome are normally pigmented (M. Pack and P. Gissen, personal communication), we propose that vps18 and vps33B may take on tissue specific roles or that functional redundancy exists in some tissues but not in others. Our data suggest, however, that the hepatic phenotype of vps18 mutants and individuals with ARC syndrome are very similar, and that this is due to the interruption of the same molecular complex involved in two trafficking pathways in hepatocytes. We thus propose the vps18 zebrafish mutant as a model for studying the hepatic signs of ARC syndrome.
|
The Nf2 protein merlin is a member of the ERM (ezrinradixin-moesin) family,
which serve as membrane-cytoskeletal linkers. Merlin is thought to be required
for contact-mediated inhibition of growth through stabilization of adherens
junctions (Lallemand et al.,
2003
) and also through the inhibition of Pak1
(Kissil et al., 2003
). Our
preliminary studies indicate that tight junctions are not disrupted in
nf2 mutant livers (K.C.S., unpublished). It is interesting that using
RNAi to knock down the levels of a C. elegans ERM gene, erm-1,
results in the formation of cyst in every tubular epithelial organ in which
the gene is normally expressed (Gobel et
al., 2004
), although junctions are not affected in this model. It
will be of interest to examine the structure of the cytoskeleton, junctions
and the proliferative index of biliary cells and hepatocytes in nf2
mutant zebrafish.
Although ARC syndrome and choledochal cysts are relatively rare, steatosis
is found in
25% of the population of the USA, and nearly 1-2% of US
citizens have fatty liver disease
(Neuschwander-Tetri and Caldwell,
2003
), which places it among the most common hepatic pathologies
in the developed world (Clark et al.,
2002
; Neuschwander-Tetri and
Caldwell, 2003
). Although obesity and excessive alcohol intake are
the greatest contributing factors to steatosis and NASH, the clustering of
NASH within some families (Struben et al.,
2000
; Willner et al.,
2001
) and the numerous mouse models that develop NASH points to a
considerable yet varied genetic component to this disease.
We therefore predicted that we might uncover a model of steatosis through a
screen for hepatomegaly, but were surprised to find that fgr so
closely resembles NASH, with the noted exception that there is no inflammation
in this mutant. Moreover, as the well-conserved fgr gene has no
identifiable domains or motifs, it represents a truly novel factor regulating
fat accumulation. Multiple molecular pathways, including those controlled by
SREBP1-c, PPAR
and insulin are important regulators of hepatic
steatosis (Browning and Horton,
2004
), and it will be of interest to see whether fgr
plays a role in any of these pathways.
In summary, by screening for zebrafish mutants with hepatomegaly, novel and physiologically relevant genes underlying embryonic hepatomegaly have been uncovered. We have identified three mutant lines that can serve as valuable models of diseases of lysosomal trafficking, choledochal cyst formation and fatty liver disease. Additionally, several mutants may also provide insight onto the processes that control liver growth and size during development.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Amatruda, J. F., Shepard, J. L., Stern, H. M. and Zon, L. I.
(2002). Zebrafish as a cancer model system. Cancer
Cell 1,229
-231.[CrossRef][Medline]
Amsterdam, A. and Hopkins, N. (1999).
Retrovirus-mediated insertional mutagenesis in zebrafish. Meth.
Cell Biol. 60,87
-98.[Medline]
Amsterdam, A., Burgess, S., Golling, G., Chen, W., Sun, Z.,
Townsend, K., Farrington, S., Haldi, M. and Hopkins, N.
(1999). A large-scale insertional mutagenesis screen in
zebrafish. Genes Dev.
13,2713
-2724.
Amsterdam, A., Nissen, R. M., Sun, Z., Swindell, E. C.,
Farrington, S. and Hopkins, N. (2004). Identification of 315
genes essential for early zebrafish development. Proc. Natl. Acad.
Sci. USA 101,12792
-12797.
Behrns, K. E., Shaheen, N. J. and Grimm, I. S.
(1998). Type I choledochal cyst in association with familial
adenomatous polyposis. Am. J. Gastroenterol.
93,1377
-1379.[CrossRef][Medline]
Browning, J. D. and Horton, J. D. (2004).
Molecular mediators of hepatic steatosis and liver injury. J. Clin.
Invest. 114,147
-152.[CrossRef][Medline]
Clark, J. M., Brancati, F. L. and Diehl, A. M.
(2002). Nonalcoholic fatty liver disease.
Gastroenterology 122,1649
-1657.[CrossRef][Medline]
Counce, S. J. (1956). Studies on
female-sterility genes in Drosophila melanogaster. I. The effects of the gene
deep orange on embryonic development. Z. Indukt. Abstamm.
Vererbungsl. 87,443
-461.
Diehl, A. (2001). Alcoholic and non-alcoholic
steatohepatitis. In The Liver: Biology and
Pathophysiology (ed. I. Arias), pp.738
-753. Philadelphia: Lipincott Williams and
Wilkins.
Duncan, S. A. (2003). Mechanisms controlling
early development of the liver. Mech. Dev.
120, 19-33.[CrossRef][Medline]
Eastham, K. M., McKiernan, P. J., Milford, D. V., Ramani, P.,
Wyllie, J., van't Hoff, W., Lynch, S. A. and Morris, A. A. M.
(2001). ARC syndrome: an expanding range of phenotypes.
Arch. Dis. Child. 85,415
-420.
Farber, S. A., Pack, M., Ho, S. Y., Johnson, I. D., Wagner, D.
S., Dosch, R., Mullins, M. C., Hendrickson, H. S., Hendrickson, E. K. and
Halpern, M. E. (2001). Genetic analysis of digestive
physiology using fluorescent phospholipid reporters.
Science 292,1385
-1388.
Field, H. A., Ober, E. A., Roeser, T. and Stainier, D. Y.
(2003). Formation of the digestive system in zebrafish. I. Liver
morphogenesis. Dev. Biol.
253,279
-290.[CrossRef][Medline]
Gissen, P., Johnson, C. A., Morgan, N. V., Stapelbroek, J. M.,
Forshew, T., Cooper, W. N., McKiernan, P. J., Klomp, L. W., Morris, A. A.,
Wraith, J. E. et al. (2004). Mutations in VPS33B, encoding a
regulator of SNARE-dependent membrane fusion, cause arthrogryposis-renal
dysfunction-cholestasis (ARC) syndrome. Nat. Genet.
36,400
-404.[CrossRef][Medline]
Gobel, V., Barrett, P. L., Hall, D. H. and Fleming, J. T.
(2004). Lumen morphogenesis in C. elegans requires the
membrane-cytoskeleton linker erm-1. Dev. Cell
6, 865-873.[CrossRef][Medline]
Golling, G., Amsterdam, A., Sun, Z., Antonelli, M., Maldonado,
E., Chen, W., Burgess, S., Haldi, M., Artzt, K., Farrington, S. et al.
(2002). Insertional mutagenesis in zebrafish rapidly identifies
genes essential for early vertebrate development. Nat.
Genet. 31,135
-140.[CrossRef][Medline]
Hemmer, M. J., Courtney, L. A. and Ortego, L. S.
(1995). Immunohistochemical detection of P-glycoprotein in
teleost tissues using mammalian polyclonal and monoclonal antibodies.
J. Exp. Zool. 272,69
-77.[CrossRef][Medline]
Her, G. M., Chiang, C. C., Chen, W. Y. and Wu, J. L.
(2003). In vivo studies of liver-type fatty acid binding protein
(L-FABP) gene expression in liver of transgenic zebrafish (Danio rerio).
FEBS Lett. 538,125
-133.[CrossRef][Medline]
Hinton, D. and Pool, C. (1976). Ultrastructure
of the liver in channel catfish Ictalurus punctatus (Rafinesque).
J. Fish Biol. 8,209
-219.[CrossRef]
Hinton, D. and Couch, J. (1998). Architectural
pattern, tissue and cellular morphology in livers of fishes: relationship to
experimentally-induced neoplastic responses. In Fish
Ecotoxicology (ed. T. Braunbeck, D. Hinton and B. Streit), pp.141
-164. Basel: Birkhauser Verlag.
Horslen, S. P., Quarrell, O. W. and Tanner, M. S.
(1994). Liver histology in the arthrogryposis multiplex
congenita, renal dysfunction, and cholestasis (ARC) syndrome: report of three
new cases and review. J. Med. Genet.
31, 62-64.
Huizing, M., Didier, A., Walenta, J., Anikster, Y., Gahl, W. A.
and Kramer, H. (2001). Molecular cloning and characterization
of human VPS18, VPS 11, VPS16, and VPS33. Gene
264,241
-247.[CrossRef][Medline]
Iwama, T. (1998). Familial case of
choledochocele. J. Gastroenterol. Hepatol.
13, 237.[Medline]
Iwama, T., Iwata, S., Murakami, S., Ishida, H. and Mishima,
Y. (1985). Congenital bile duct dilatationpossibly an
hereditary condition. Jpn J. Surg.
15,501
-505.[CrossRef][Medline]
Iwata, F., Uchida, A., Miyaki, T., Aoki, S., Fujioka, T.,
Yamada, J., Joh, T. and Itoh, M. (1998). Familial occurrence
of congenital bile duct cysts. J. Gastroenterol.
Hepatol. 13,316
-319.[Medline]
Kelly, D. A. and McKiernan, P. J. (1998).
Metabolic liver disease in the pediatric patient. Clin. Liver
Dis. 2,1
-30.[CrossRef][Medline]
Kim, B. Y., Kramer, H., Yamamoto, A., Kominami, E., Kohsaka, S.
and Akazawa, C. (2001). Molecular characterization of
mammalian homologues of class C Vps proteins that interact with syntaxin-7.
J. Biol. Chem. 276,29393
-29402.
Kissil, J. L., Wilker, E. W., Johnson, K. C., Eckman, M. S.,
Yaffe, M. B. and Jacks, T. (2003). Merlin, the product of the
Nf2 tumor suppressor gene, is an inhibitor of the p21-activated kinase, Pak1.
Mol. Cell 12,841
-849.[CrossRef][Medline]
Lallemand, D., Curto, M., Saotome, I., Giovannini, M. and
McClatchey, A. I. (2003). NF2 deficiency promotes
tumorigenesis and metastasis by destabilizing adherens junctions.
Genes Dev. 17,1090
-1100.
Lekanne Deprez, R. H., Bianchi, A. B., Groen, N. A., Seizinger,
B. R., Hagemeijer, A., van Drunen, E., Bootsma, D., Koper, J. W., Avezaat, C.
J., Kley, N. et al. (1994). Frequent NF2 gene transcript
mutations in sporadic meningiomas and vestibular schwannomas. Am.
J. Hum. Genet. 54,1022
-1029.[Medline]
Lorent, K., Yeo, S. Y., Oda, T., Chandrasekharappa, S., Chitnis,
A., Matthews, R. P. and Pack, M. (2004). Inhibition of
Jagged-mediated Notch signaling disrupts zebrafish biliary development and
generates multi-organ defects compatible with an Alagille syndrome phenocopy.
Development 131,5753
-5766.
Matthews, R. P., Lorent, K., Russo, P. and Pack, M.
(2004). The zebrafish onecut gene hnf-6 functions in an
evolutionarily conserved genetic pathway that regulates vertebrate biliary
development. Dev. Biol.
274,245
-259.[CrossRef][Medline]
McClatchey, A. I., Saotome, I., Ramesh, V., Gusella, J. F. and
Jacks, T. (1997). The Nf2 tumor suppressor gene product is
essential for extraembryonic development immediately prior to gastrulation.
Genes Dev. 11,1253
-1265.
McClatchey, A. I., Saotome, I., Mercer, K., Crowley, D.,
Gusella, J. F., Bronson, R. T. and Jacks, T. (1998). Mice
heterozygous for a mutation at the Nf2 tumor suppressor locus develop a range
of highly metastatic tumors. Genes Dev.
12,1121
-1133.
Moss, J. and Lane, M. D. (1971). The
biotin-dependent enzymes. Adv. Enzymol. Relat. Areas Mol.
Biol. 35,321
-442.[Medline]
Nambirajan, L., Taneja, P., Singh, M. K., Mitra, D. K. and
Bhatnagar, V. (2000). The liver in choledochal cyst.
Trop. Gastroenterol. 21,135
-139.[Medline]
Narayanan, R., Kramer, H. and Ramaswami, M.
(2000). Drosophila endosomal proteins hook and deep orange
regulate synapse size but not synaptic vesicle recycling. J.
Neurobiol. 45,105
-119.[CrossRef][Medline]
National Center for Health Statistics (2004).
Health, United States, 2004 With Chartbook on Trends in the Health
of Americans. Hyattsville, MD: US Department of Health and Human
Services, Center for Disease Control and Prevention.
Neuschwander-Tetri, B. A. and Caldwell, S. H.
(2003). Nonalcoholic steatohepatitis: summary of an AASLD Single
Topic Conference. Hepatology
37,1202
-1219.[CrossRef][Medline]
Newsome, P. N., Hussain, M. A. and Theise, N. D.
(2004). Hepatic oval cells: helping redefine a paradigm in stem
cell biology. Curr. Top. Dev. Biol.
61, 1-28.[Medline]
Ober, E. A., Field, H. A. and Stainier, D. Y.
(2003). From endoderm formation to liver and pancreas development
in zebrafish. Mech. Dev.
120, 5-18.[CrossRef][Medline]
Pall, H. and Jonas, M. M. (2005). Pediatric
hepatobiliary disease. Curr. Opin. Gastroenterol.
21,344
-347.[CrossRef][Medline]
Peterson, M. R. and Emr, S. D. (2001). The
class C Vps complex functions at multiple stages of the vacuolar transport
pathway. Traffic 2,476
-486.[CrossRef][Medline]
Poupon, V., Stewart, A., Gray, S. R., Piper, R. C. and Luzio, J.
P. (2003). The role of mVps18p in clustering, fusion, and
intracellular localization of late endocytic organelles. Mol. Biol.
Cell 14,4015
-4027.
Puckett, L. and Petty, K. (1980). Temperature
sensitivity of deep orange: effects on eye pigmentation. Biochem.
Genet. 18,1221
-1228.[CrossRef][Medline]
Raymond, C. K., Howald-Stevenson, I., Vater, C. A. and Stevens,
T. H. (1992). Morphological classification of the yeast
vacuolar protein sorting mutants: evidence for a prevacuolar compartment in
class E vps mutants. Mol. Biol. Cell
3,1389
-1402.[Abstract]
Rocha, E., Monteiro, R. A. and Pereira, C. A.
(1994). The liver of the brown trout, Salmo trutta fario: a light
and electron microscope study. J. Anat.
185,241
-249.
Rubinstein, A. L. (2003). Zebrafish: from
disease modeling to drug discovery. Curr. Opin. Drug Discov.
Dev. 6,218
-223.[Medline]
Ruttledge, M. H., Sarrazin, J., Rangaratnam, S., Phelan, C. M.,
Twist, E., Merel, P., Delattre, O., Thomas, G., Nordenskjold, M., Collins, V.
P. et al. (1994). Evidence for the complete inactivation of
the NF2 gene in the majority of sporadic meningiomas. Nat.
Genet. 6,180
-184.[CrossRef][Medline]
Sanson, M., Marineau, C., Desmaze, C., Lutchman, M., Ruttledge,
M., Baron, C., Narod, S., Delattre, O., Lenoir, G., Thomas, G. et al.
(1993). Germline deletion in a neurofibromatosis type 2 kindred
inactivates the NF2 gene and a candidate meningioma locus. Hum.
Mol. Genet. 2,1215
-1220.
Sato, T. K., Rehling, P., Peterson, M. R. and Emr, S. D.
(2000). Class C Vps protein complex regulates vacuolar SNARE
pairing and is required for vesicle docking/fusion. Mol.
Cell 6,661
-671.[CrossRef][Medline]
Sevrioukov, E. A., He, J. P., Moghrabi, N., Sunio, A. and
Kramer, H. (1999). A role for the deep orange and carnation
eye color genes in lysosomal delivery in Drosophila. Mol.
Cell 4,479
-486.[CrossRef][Medline]
Shestopal, S. A., Makunin, I. V., Belyaeva, E. S., Ashburner, M.
and Zhimulev, I. F. (1997). Molecular characterization of the
deep orange (dor) gene of Drosophila melanogaster. Mol. Gen.
Genet. 253,642
-648.[CrossRef][Medline]
Sidon, E. W. and Youson, J. H. (1983).
Morphological changes in the liver of the sea lamprey, Petromyzon marinus L.,
during metamorphosis. II. Canalicular degeneration and transformation of the
hepatocytes. J. Morphol.
178,225
-246.[CrossRef][Medline]
Soreide, K., Korner, H., Havnen, J. and Soreide, J. A.
(2004). Bile duct cysts in adults. Br. J.
Surg. 91,1538
-1548.[CrossRef][Medline]
Spitsbergen, J. M., Tsai, H. W., Reddy, A., Miller, T.,
Arbogast, D., Hendricks, J. D. and Bailey, G. S. (2000).
Neoplasia in zebrafish (Danio rerio) treated with
7,12-dimethylbenz[a]anthracene by two exposure routes at different
developmental stages. Toxicol. Pathol.
28,705
-715.
Sriram, V., Krishnan, K. S. and Mayor, S.
(2003). deep-orange and carnation define distinct stages in late
endosomal biogenesis in Drosophila melanogaster. J. Cell
Biol. 161,593
-607.
Srivastava, A., Woolford, C. A. and Jones, E. W.
(2000). Pep3p/Pep5p complex: a putative docking factor at
multiple steps of vesicular transport to the vacuole of Saccharomyces
cerevisiae. Genetics
156,105
-122.
Struben, V. M., Hespenheide, E. E. and Caldwell, S. H.
(2000). Nonalcoholic steatohepatitis and cryptogenic cirrhosis
within kindreds. Am. J. Med.
108, 9-13.[Medline]
Subramanian, S., Woolford, C. A. and Jones, E. W.
(2004). The Sec1/Munc18 protein, Vps33p, functions at the
endosome and the vacuole of Saccharomyces cerevisiae. Mol. Biol.
Cell 15,2593
-2605.
Sun, Z., Amsterdam, A., Pazour, G. J., Cole, D. G., Miller, M.
S. and Hopkins, N. (2004). A genetic screen in zebrafish
identifies cilia genes as a principal cause of cystic kidney.
Development 131,4085
-4093.
Trauner, M. and Boyer, J. L. (2003). Bile salt
transporters: molecular characterization, function, and regulation.
Physiol. Rev. 83,633
-671.
Trauner, M., Arrese, M., Soroka, C. J., Ananthanarayanan, M.,
Koeppel, T. A., Schlosser, S. F., Suchy, F. J., Keppler, D. and Boyer, J.
L. (1997). The rat canalicular conjugate export pump (Mrp2)
is down-regulated in intrahepatic and obstructive cholestasis.
Gastroenterology 113,255
-264.[CrossRef][Medline]
Tuma, P. and Hubbard, A. (2001). The hepatocyte
surface: dynamic polarity. In The liver: biology and
pathophysiology (ed. I. Arias, J. L. Boyer, F. Chisari, N.
Fausto, D. Schachter and D. Shafritz), pp.96
-117.Philadelphia: Lippincot Williams and
Wilkins.
Ujhazy, P., Kipp, H., Misra, S., Wakabasyasi, Y. and Arias, I.
M. (2001). The biology of the bile canaliculus. In
The Liver: Biology and Pathobiology (ed. I. M. Arias,
J. L. Boyer, F. Chisari, N. Fausto, D. Schachter and D. Shafritz), pp.360
-372. Philadelphia: Lippincott Williams and
Wilkins.
Wallace, K. N. and Pack, M. (2003). Unique and
conserved aspects of gut development in zebrafish. Dev.
Biol. 255,12
-29.[CrossRef][Medline]
Willner, I. R., Waters, B., Patil, S. R., Reuben, A., Morelli,
J. and Riely, C. A. (2001). Ninety patients with nonalcoholic
steatohepatitis: insulin resistance, familial tendency, and severity of
disease. Am. J. Gastroenterol.
96,2957
-2961.[CrossRef][Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
E. J. Flynn III, C. M. Trent, and J. F. Rawls Ontogeny and nutritional control of adipogenesis in zebrafish (Danio rerio) J. Lipid Res., August 1, 2009; 50(8): 1641 - 1652. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. P. Matthews, K. Lorent, R. Manoral-Mobias, Y. Huang, W. Gong, I. V. J. Murray, I. A. Blair, and M. Pack TNF{alpha}-dependent hepatic steatosis and liver degeneration caused by mutation of zebrafish s-adenosylhomocysteine hydrolase Development, March 1, 2009; 136(5): 865 - 875. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hama, E. Provost, T. C. Baranowski, A. L. Rubinstein, J. L. Anderson, S. D. Leach, and S. A. Farber In vivo imaging of zebrafish digestive organ function using multiple quenched fluorescent reporters Am J Physiol Gastrointest Liver Physiol, February 1, 2009; 296(2): G445 - G453. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-E. Jao, L. Maddison, W. Chen, and S. M. Burgess Using retroviruses as a mutagenesis tool to explore the zebrafish genome Brief Funct Genomic Proteomic, November 1, 2008; 7(6): 427 - 443. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Huang, H. Ruan, M. Y. Aw, A. Hussain, L. Guo, C. Gao, F. Qian, T. Leung, H. Song, D. Kimelman, et al. Mypt1-mediated spatial positioning of Bmp2-producing cells is essential for liver organogenesis Development, October 1, 2008; 135(19): 3209 - 3218. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. B. Schonthaler, V. C. Fleisch, O. Biehlmaier, Y. Makhankov, O. Rinner, R. Bahadori, R. Geisler, H. Schwarz, S. C. F. Neuhauss, and R. Dahm The zebrafish mutant lbk/vam6 resembles human multisystemic disorders caused by aberrant trafficking of endosomal vesicles Development, January 15, 2008; 135(2): 387 - 399. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C. Sadler, K. N. Krahn, N. A. Gaur, and C. Ukomadu Liver growth in the embryo and during liver regeneration in zebrafish requires the cell cycle regulator, uhrf1 PNAS, January 30, 2007; 104(5): 1570 - 1575. [Abstract] [Full Text] [PDF] |
||||
![]() |
I M McGonnell and R C Fowkes Fishing for gene function - endocrine modelling in the zebrafish. J. Endocrinol., June 1, 2006; 189(3): 425 - 439. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Amsterdam Insertional mutagenesis in zebrafish: genes for development, genes for disease Brief Funct Genomic Proteomic, March 1, 2006; 5(1): 19 - 23. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. P. Matthews, N. Plumb-Rudewiez, K. Lorent, P. Gissen, C. A. Johnson, F. Lemaigre, and M. Pack Zebrafish vps33b, an ortholog of the gene responsible for human arthrogryposis-renal dysfunction-cholestasis syndrome, regulates biliary development downstream of the onecut transcription factor hnf6 Development, December 1, 2005; 132(23): 5295 - 5306. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||