|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 20 July 2005
doi: 10.1242/dev.01924
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


Department of Cell and Developmental Biology, John Innes Centre, Norwich Research Park, Colney Lane, Norwich NR4 7UH, UK
Author for correspondence (e-mail:
caroline.dean{at}bbsrc.ac.uk)
Accepted 1 June 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Arabidopsis thaliana, flowering, polyadenylation, FCA, FY
| Introduction |
|---|
|
|
|---|
In parallel to vernalization, the autonomous pathway also acts to promote
flowering by repressing expression of FLC
(Michaels and Amasino, 1999
;
Sheldon et al., 1999
). Loss of
autonomous function confers a recessive vernalization requirement
(Koornneef et al., 1991
). The
autonomous pathway currently comprises seven genes; FCA, FY, FPA, FVE,
FLD, FLK and LUMINIDEPENDENS (LD), which encode
putative transcriptional (FLD, LD, FVE) and post-transcriptional
(FCA, FY, FPA, FLK) regulators of gene expression
(Ausin et al., 2004
;
He et al., 2003
;
Lee et al., 1994
;
Lim et al., 2004
;
Macknight et al., 1997
;
Mockler et al., 2004
;
Schomburg et al., 2001
;
Simpson et al., 2003
).
Epistasis analysis indicates that these genes repress FLC in a
partially non-redundant manner (Koornneef
et al., 1998
). FCA and FY make up one epistasis
group and this reflects functional interaction of their gene products
(Simpson et al., 2003
). FCA is
a plant-specific, nuclear RNA binding protein with a C-terminal WW protein
interaction domain (Macknight et al.,
1997
). FCA interacts with FY, which is homologous to a highly
conserved polyadenylation factor, Pfs2p
(Ohnacker et al., 2000
;
Simpson et al., 2003
).
In eukaryotes, the 3' ends of RNA polymerase-II-generated transcripts
are cleaved and polyadenylated and this is an essential step for transcript
stability (Zhao et al., 1999
).
Genetic and biochemical approaches in Saccharomyces cerevisiae have
defined a large number of conserved proteins required for RNA 3'-end
processing, including the polyadenylation factor Pfs2p
(Zhao et al., 1999
). Pfs2p
contains seven WD repeats and acts as an interaction surface within the
cleavage and polyadenylation factor (CPF) 3'-end processing complex
(Ohnacker et al., 2000
). CPF
acts with the cleavage factor I (CFI) complex to direct 3'-end
processing of pre-mRNA transcripts (Zhao
et al., 1999
). The Arabidopsis homologue of Pfs2p is FY
and this was revealed to play a role in RNA 3'-end processing through
analysis of FCA gene regulation
(Quesada et al., 2003
;
Simpson et al., 2003
). FCA
negatively autoregulates its expression by promoting premature cleavage and
polyadenylation within intron 3, to generate the non-functional
FCA-ß transcript (Macknight
et al., 2002
; Quesada et al.,
2003
). This feedback mechanism requires an interaction between FCA
and FY (Quesada et al., 2003
;
Simpson et al., 2003
). The
mechanism by which FCA and FY regulate FLC is unknown, but this may
also involve regulated 3'-end processing. In plants, FY possesses an
extended C-terminal domain in addition to seven conserved WD repeats
(Fig. 1). This C terminus
carries sequences predicted to interact with the FCA WW domain
(Sudol and Hunter, 2000
).
Hence, the novel RNA-binding protein FCA is recruited to FY, a conserved
polyadenylation factor, to mediate regulated 3'-processing.
Mutations in the 3'-end processing machinery are generally lethal and
this is true for null pfs2 mutations in yeast
(Ohnacker et al., 2000
;
Wang et al., 2005
). However,
hypomorphic mutations that are viable can also be recovered
(Ohnacker et al., 2000
;
Zhao et al., 1999
). Viable
mutations in the Drosophila polyadenylation factor, suppressor of
forked (su(f)) were identified as modifiers of retrotransposon
insertions in the Forked gene
(Parkhurst and Corces, 1985
;
Parkhurst and Corces, 1986
).
The su(f) mutation modified usage of premature polyadenylation sites
within the retrotransposon long terminal repeats, restoring forked
gene expression (Parkhurst and Corces,
1985
; Parkhurst and Corces,
1986
). However, strong or null su(f) alleles are
cell-autonomous, lethal mutations that prevent mitotic proliferation
(Audibert et al., 1998
;
Audibert and Simonelig, 1999
).
To investigate whether FY is also an essential gene in
Arabidopsis, an allelic series of fy mutations was
characterised. A null fy mutation combined with conditional silencing
of FY in Nicotiana demonstrate that FY is required for
growth and development in plants. In addition, the different fy
alleles indicate a requirement for both the conserved FY WD repeats and the C
terminus in repression of FLC.
| Materials and methods |
|---|
|
|
|---|
Genotyping the fy alleles
Plants carrying fy mutations were genotyped using PCR markers. The
fy-3 mutation was genotyped by amplifying with the FY3F
(5'-ACCACACCTTCAGGAAGACGTCTTATCTAG-3') and FY3XBA
(5'-TCACCAGAAACCATATAATTTTCATTGTGG-3') primers, the PCR product
was cut with XbaI in fy-3 mutants. The fy-4
mutation was genotyped by amplifying with the FY4F
(5'-CCCAAAGTGGGGAGTTTACTCTCT-3') and FY4XBA
(5'-CCTCCATCATCACCAGAAACC-3') primers, the PCR product was cut by
XbaI in fy-4 mutants. The dCAPs marker used to identify
fy-1 was as described previously
(Simpson et al., 2003
). Plants
carrying fy-2 were identified by herbicide (BASTA) resistance
conferred by the T-DNA insertion or by PCR. Amplifying with a T-DNA left
border primer LB (5'-TGGTTCACGTAGTGGGCCATCG-3') and
FY4 (5'-CTGTTGGAAAGGGTTGTTGTAGCCTGGAATC-3') produces a
product in the presence of the fy-2 T-DNA insertion.
Construction of the FY-GUS transgene
The FY::GUS transgene was constructed by PCR, amplifying the
FY promoter from Arabidopsis genomic DNA, made from the
Columbia accession, using the primers PFYF
(5'-CGAGCTCGGTGTGTTTTTGGG-3') and PFYR
(5'-CATGCCATGGTTGCCCACGGAGAAC-3'). The 1.3 kb PCR product was
cloned and sequenced. The PFY sequence was then introduced
upstream of ß-glucuronidase (GUS) as a NcoI-SacI
fragment in the pGreen0029 binary vector
(Hellens et al., 2000
). The
FY::GUS transgene was introduced into Arabidopsis by
Agrobacterium-mediated floral dip transformation
(Bechtold et al., 1993
).
Transformed lines were selected using kanamycin resistance.
Construction of the pFY::FY complementation transgene
The complementation transgene was constructed using the FY
open-reading frame amplified by RT-PCR using RNA extracted from Col seedlings
with the primers FYBstEIIF (GGGTCTAGAGGTAACCTAAATTCGAACACTTTCGCAG)
and F20SalIR (CCCGTCGACCTACTGATGTTGCTGATTGTT). The FY cDNA
was cloned into pCAMBIA1300 as a XbaI/SalI fragment. The
FY promoter was amplified using Pfu (Stratagene) from Columbia
genomic DNA with the primers Pfy5 (GAGGGATCCACTATAGGTGTGGCAAAGCTCAT)
and Pfy3 (GTTGCCCACGGAGAACAGT) and cloned as a
BamHI/BstEII fragment upstream of the FY cDNA in
pCAMBIA1300. The FY 3'-UTR was amplified from Col genomic DNA
using the primers 3UTR-1 (GTAGGTCGACGTTGTATTAGTACATTAGTTT) and
3UTR-2 (CTCCGTCGACGTCTGCTGTGGTGGCTTGGGTCTT) and cloned as a
SalI fragment downstream of the FY cDNA. The
pCAMBIA-pFY::FY plasmid was transformed into Agrobacterium
strain GV3101 and used to transform fy-4/FY heterozygote plants.
Inheritance of fy-4 in T1 progeny was analysed by
genotyping with a dCAPs marker amplified with FY4F and FY4R
(TTTAAACAGTCAATACCAGGAGCAG) and digested with XbaI.
In situ hybridization, light microscopy and GUS histochemical staining
To analyse seed development whole siliques were fixed for 1 hour at room
temperature in Cornoy's solution (acetic acid:ethanol, 1:9) and then washed
for 1 hour in 80% ethanol followed by 70% ethanol. The ethanol was then
replaced with fresh clearing solution (chloral
hydrate:H2O:glycerol, 8:2:1) and left overnight at room
temperature. Cleared seeds were dissected from siliques using 0.2 µm
needles and mounted on a slide. Seeds were viewed using differential
interference contrast (DIC) microscopy with a Nikon Microphot microscope
(x20 or x40 objectives). Pictures were taken using a Nikon digital
camera.
Plants were stained for GUS expression as described previously
(Jefferson, 1987
). To analyse
GUS expression during seed development, material was first fixed in Cornoy's
solution for 1 hour at room temperature. After fixation the seed was
extensively washed in GUS staining buffer and then GUS stained as described
previously (Jefferson, 1987
).
After staining, seed was cleared as described above and analysed with DIC
microscopy.
mRNA in situ hybridization was performed using a published protocol
(Coen et al., 1990
). 8 µm
cross sections of Ler 10-day shoot meristems and longitudinal
sections through siliques at several stages of development were used.
Antisense and sense probes were constructed using the FY-CT construct
as a template. The insert was amplified using M13 forward and reverse primers
and transcribed with T3 RNA polymerase (antisense) and T7 RNA polymerase
(sense).
Virus-induced gene silencing
LeFCA sequence from tomato (Lycopersicon esculentum) was
provided by Dr R. Macknight (University of Otago, New Zealand). LeFCA
sequence was PCR amplified using FCAVBAM
(5'-CGGGATCCTTGTTGGATCTGTTCCTAGAAC-3') and FCAVHIND
(5'-TTCATCGATTCAGCAAATCTAACAATCAGAGG-3') primers and cloned into
the TRV-00 vector as a BamHI-HindIII fragment
(Ratcliff et al., 2001
). The
potato (Solanum tuberosum) EST BI176637 provided StFY
Solanaceous sequence. StFY sequence was PCR amplified using
FYVBAM (5'-CGGGATCCAGGACAGTGTTACAACCTAGC-3') and
FYVHIND (5'-TTCATCGATTCTCGTATTGATTCTTTATGTGC-3') primers
and cloned into the TRV-00 vector as a BamHI-HindIII
fragment. The TRV vectors were transformed into Agrobacterium and
used to inoculate young tobacco plants as described previously
(Ratcliff et al., 2001
).
To analyse gene expression, RNA was extracted from leaves systemically infected with either TRV-00 (empty vector), TRV-FY or TRV-FCA and used to generate cDNA. The expression of FY, FCA and ACTIN was analysed by PCR amplification using the following primers: FYF (5'-ATGATGCGGCAGCCATCTGCATCC-3'), FYR (5'-ACCAGTGACCATCCAGTTATC-3'), FCAF (5'-ATTTGTTGGATCTGTTCCTAG-3'), FCAR (5'-TCTCGTATTGATTCTTTATGTGC-3'), ACTINF (5'-ATGGCAGACGGTGAGGATATTCA-3'), ACTINR (5'-GCCTTTGCAATCCACATCTGTTG-3'). PCR reactions were amplified for 27, 30, 32, 35 and 40 cycles and analysed using agarose gel electrophoresis with ethidium bromide staining. Gels were visualised using a fluorescence scanner (Amersham-Pharmacia).
Generation of an FY antibody
FY (residues 416-646) sequence was amplified by PCR and cloned
into the pET19b vector (Novagen) using the primers FYNDEI
(5'-AATCCCAATGTTCTTATGCAGAACC-3') and FYR
(5'-CCGGTATACCTACTGCTGTTGCTGATTGTT-3'). This allowed inducible
expression and purification of the FY-CT protein with a 6x histidine
tag. After elution from the nickel affinity resin, the FY-CT protein was
further purified using SDS-PAGE (8% acrylamide) and electroelution (BioRad).
The FY-CT antigen was then concentrated using Centricon spin columns (Amicon)
and dialysed against PBS. FY-CT was used to immunise two female New Zealand
White rabbits according to standard procedures
(Harlow and Lane, 1988
).
Specific FY antibodies were purified from FY cross-reactive serum using
affinity purification techniques (AminoLink, Pierce). Purified antibodies were
concentrated, dialysed against PBS, supplemented with 10 mg/ml BSA and 0.1%
sodium azide as a preservative and stored at 80°C. The FY antibody
was used at a concentration of 1:1000 according to standard procedures.
In vitro protein interaction assays
Interaction of FCA and FY proteins was tested using the in vitro GST
pull-down assay previously described
(Simpson et al., 2003
). FY was
subcloned as either WD (residues 1-415) or CT domains (residues 416-646). The
FY-WD subclone was generated by PCR amplification using the
WDF (5'-GGAATTCAATAAACCATGTACGCCGGCGGCGATATG-3') and
WDR (5'-CGGGATCCCTAATCTCGGGGATTATCTGC-3') primers and
cloning the PCR product under the T7 promoter in pBLUESCRIPT IISK. The
FY-CT subclone was generated by PCR amplification using the
CTF (5'-GGAATTCAATAAACCATGGTTCTTATGCAGAACCAAGGC-3') and
CTR (5'-CGGGATCCCTACTGATGTTGCTGATTGTTG-3') primers and
cloning the PCR product under the T7 promoter in pBLUESCRIPTIISK-. The FY-CT
subclone was then mutagenised to generate the PPLPP
AAAAA mutants using
the Quikchange method (Stratagene). PPLPP-1 was mutagenised in two steps using
the PA1A1
(5'-CCATGGCACTGGGGGCTGCTGCTGCGGCACCTGGTCCCCACCCATCG-3') and
PA1A2
(5'-CGATGGGTGGGGACCAGGTGCCGCAGCAGCAGCCCCCAGTGCCATGG-3') oligos
first, followed by the PA1B1
(5'-GGGGCTGCTGCTGCGGCAGCTGCTGCCCACGCATCGCTTCTTGGAAGTGGC-3') and
PA1B2
(5'-GCCACTTCCAAGAAGCGATGCGTGGGCAGCAGCTGCCGCAGCAGCAGCCCC-3')
oligos. PPLPP-2 was mutagenised using the PA21
(5'-AACAACCCTTTCCAACAGCAGGCAGCTGCAGCTGCTGGCGCTGCACCAAACAACAATCAGCAAC-3')
and PA22
(5'-GTTGCTGATTGTTGTTTGGTGCAGCGCCAGCAGCTGCAGCTGCCTGCTGTTGGAAAGGGTTGTT-3')
oligos.
| Results |
|---|
|
|
|---|
|
AAAAA mutants
(Fig. 2D). Interaction assays
revealed that mutation of either PPLPP repeat alone did not prevent FY-CT
binding to GST-FCA in vitro (Fig.
2C). However, the double PPLPP
AAAAA mutant FY-CT showed no
interaction (Fig. 2C). This
demonstrates that both PPLPP within the FY-CT are capable of interaction with
the FCA WW domain in vitro. Hence, the FY C-terminal domain mediates
recruitment of the RNA-binding protein FCA.
FY regulates FLC mRNA accumulation to control flowering time
The FY WD repeats and C terminus are distinct in their degree of
conservation throughout eukaryotes (Fig.
1). To investigate the requirement of these domains for FY
function in vivo, an allelic series of fy mutations was
characterised. Forward and reverse genetics provided four fy alleles.
The fy-1 mutation was isolated from an EMS screen for late-flowering
mutants (Koornneef et al.,
1991
). Sequencing revealed a splice-acceptor mutation at exon 16
in fy-1 (Simpson et al.,
2003
) (Fig. 3A).
Mutations caused by insertion of T-DNA can be isolated from the Syngenta SAIL
(Syngenta Arabidopsis Insertion Library) collection
(Sessions et al., 2002
). This
collection provided the fy-2 allele, which carries a T-DNA insertion
within exon 16 (Fig. 3A). The
fy-3 and fy-4 mutations were isolated by the
Arabidopsis TILLING project
(McCallum et al., 2000
).
TILLING allows reverse genetic isolation of EMS-induced mutations in a gene of
interest. These fy alleles affect the first FY-WD repeat and
introduce glycine to serine (G141S) and tryptophan to stop-codon (W150*)
substitutions, respectively (Fig.
3A). Together these alleles provide mutations in both the
conserved FY WD repeats and the C-terminal domain.
|
|
|
To investigate whether the late-flowering fy alleles were null
mutations, the expression of FY mRNA and FY protein was analysed.
Northern blot analysis showed reduced abundance of FY mRNA in
fy-1 and the presence of transcripts varying in size
(Fig. 3C). This size variation
is likely to be due to the utilization of multiple, cryptic splice-acceptor
sites and potentially exon skipping
(Simpson et al., 1998
).
Sequencing revealed the presence of premature stop codons in mutant
fy-1 mRNAs, which would disrupt expression of the C-terminal domain
(Simpson et al., 2003
). No FY
protein was found to accumulate in fy-1
(Fig. 3D), however, the FY
antibody was raised using the C-terminal domain as an antigen. A translation
product of mutant fy-1 mRNA would only overlap by approximately seven
amino acids with the peptide used to raise antibodies. Hence, although no FY
protein is detectable in fy-1, this may be due to a lack of expressed
epitopes rather than it being a null allele. The possibility of fy-1
being a hypomorphic allele is also supported by its weak effect on
FLC expression and flowering time
(Fig. 3C and
Table 1). The T-DNA in
fy-2 is inserted within exon 16, 320 nucleotides downstream of the
fy-1 mutation. Although FY mRNA is reduced in fy-2
(Fig. 3C), the 3' T-DNA
insertion site means a truncated protein of 62.4 kDa could be produced,
encoding the conserved WD repeats but lacking an intact C-terminal domain.
Western blot analysis revealed the presence of this truncated FY protein in
fy-2 (Fig. 3D). Hence,
it appears that in both fy-1 and fy-2 the FY C-terminal
domain is disrupted and this results in FLC misexpression. Disruption
of this domain is likely to impair recruitment of FCA to FY complexes in vivo
because of loss of the PPLPP repeats.
|
|
|
Pleiotropic functions for FY in development were suggested previously by
genetic analysis within the autonomous pathway
(Koornneef et al., 1998
). An
fy fpa double mutant was never recovered, suggestive of lethality. In
contrast, both fca fy and fca fpa double mutants are viable
and late flowering (Koornneef et al.,
1998
). To provide further insight into these interactions,
reproductive defects in plants heterozygous for fy-1 and homozygous
for fpa-1 mutations were analysed. The siliques of fy-1/FY,
fpa-1/fpa-1 plants displayed a high incidence of aborted seed
(Fig. 5F). To analyse possible
gametophytic defects mutant plants were crossed reciprocally to Ler
plants. Significant transmission of fpa-1 fy-1 gametes was observed
through both crosses, indicating that gametophytic defects are unlikely to be
the major cause of fy fpa lethality
(Table 2). However, less than
50% of the F1 progeny were fy-1 heterozygous when plants
were used as either pollen-donor or acceptor
(Table 2), meaning that
although fy-1 fpa-1 gametes participate in fertilization, they have
reduced vigour or viability. Analysis of seed development in fy-1/FY,
fpa-1/fpa-1 plants revealed that mutant seed had ceased dividing and
aborted very early after fertilization, with a similar phenotype to that
observed in fy-4 (Fig.
5H). Furthermore, examination of fy-1, fpa-1 and
fpa-2 single mutants revealed elevated levels of seed abortion
relative to Ler (Fig.
5I). In contrast, fca-1 siliques were indistinguishable
from wild type and fca-1 did not enhance the defect observed in
fy-1 in the fca-1 fy-1 double mutant
(Fig. 5I). A one-way ANOVA
shows these differences to be significant (P<0.001). Hence,
fy-1 and fpa-1 have weakly penetrant defects in seed
development, which combine to cause synergistic lethality. These interactions
are likely to reflect essential FY functions. The fact that fca-1
lacks these phenotypes indicates that FCA acts more specifically in
development than FY and FPA.
Conditional silencing of FY, but not FCA, is deleterious
The embryo lethality of null fy-4 mutations precludes analysis of
loss of FY function later in development. Virus-induced gene
silencing (VIGS) allows conditional silencing of target genes in Nicotiana
benthamiana (Lu et al.,
2003
). Infection of N. benthamiana with a tobacco rattle
virus (TRV) vector carrying target gene sequences leads to gene silencing of
the endogenous target mRNA (Ratcliff et
al., 2001
). This system was utilised to assay the effect of
silencing FCA and FY expression during post-embryonic
development. FCA and FY are well conserved throughout higher
plants and BLAST searches identified several potato and tomato EST sequences
with strong nucleotide similarity to AtFCA and AtFY
(Macknight et al., 1997
;
Simpson et al., 2003
). Within
the Solanaceae the sequences homologous to FCA and FY were
>90% identical, making them suitable for use in TRV VIGS in N.
benthamiana (Lu et al.,
2003
). Potato (StFCA) and tomato (LeFCA)
FCA sequences were cloned into a TRV vector and called TRV-FCA and
TRV-FY respectively. The LeFCA sequence was very similar to
AtFCA sequence from exons 3 and 4, which spans the alternatively
processed FCA intron 3. The four alternative FCA mRNAs
contain exon 3 sequence and hence VIGS against this sequence should target all
FCA transcripts (Macknight et
al., 1997
; Macknight et al.,
2002
).
|
Although silencing of FY in Nicotiana induced deleterious
phenotypes, the infected plants continued to grow and produce leaves and
flowers. However, VIGS does not completely eliminate target mRNAs and residual
levels of FY mRNA may be sufficient for continued growth
(Lu et al., 2003
;
Ratcliff et al., 2001
). To
investigate the extent of silencing induced by TRV infection, total RNA was
extracted from systemically infected tissue and analysed for target gene
expression using RT-PCR (Fig.
6E). Expression was assayed relative to TRV-00 infected plants and
ACTIN mRNA levels, used as an internal control. Both the TRV-FY and
TRV-FCA viruses induced silencing of their target endogenous gene, though in
both cases residual levels of mRNA remained
(Fig. 6E). The remaining
FY mRNA may provide sufficient FY expression to support the continued
growth.
FY expression pattern reflects flowering time and essential functions
The failure of seed development in fy-4 mutants reveals that
FY is required for embryogenesis. To determine whether this reflects
expression of FY during seed development, a reporter transgene was
constructed. 1.3 kb of genomic promoter sequence was used to generate a
FY::GUS transgene. Transformation with FY::GUS was performed
in the Col background and homozygous lines were analysed for GUS expression.
FY::GUS siliques were harvested at progressive stages of maturity and
seeds histochemically stained for GUS expression
(Fig. 7A-C). At globular stage,
strong GUS staining was evident throughout the embryo, endosperm and
surrounding maternal seed tissues (Fig.
7A). From heart-stage of embryogenesis onwards GUS expression was
more restricted to the embryo (Fig.
7B,C), Additionally, the funiculus connecting the seed to the
silique showed strong staining, which extended into the chalazal base of the
seed (Fig. 7B). To confirm the
FY::GUS expression pattern we also performed in situ hybridization
experiments. Sectioning of embryos and hybridization with an antisense
FY probe revealed expression in globular, heart and torpedo stage
embryos (Fig. 7K-M). No signal
was detected when a sense probe was used for hybridization
(Fig. 7N). Therefore,
consistent with the failure of embryo and endosperm development in
fy-4 mutants, the FY promoter is active in these
tissues.
The function of FY in regulating flowering time also leads to an
expectation of post-embryonic expression. FY::GUS expression was
analysed in 12-day-old seedlings. Strong GUS expression was evident in the
meristematic regions of the shoot and the root
(Fig. 7D-7F). High expression
was clear in the shoot meristem and the adjacent young leaves
(Fig. 7D). In cotyledons and
older leaves GUS expression was only evident in the vasculature
(Fig. 7D). In situ
hybridization using an antisense FY probe confirmed expression in
shoot apical meristems, young leaves and vasculature
(Fig. 7O-Q), while no signal
was detected when a sense FY probe was used
(Fig. 7R). In the root, both
the apical and emergent lateral meristems showed strong expression
(Fig. 7E,F). The
FY::GUS line with strongest levels of expression also showed staining
in differentiated, non-proliferating tissues (data not shown). However,
expression was still much weaker relative to meristematic and vascular
regions. This expression pattern is closely related to the majority of genes
defined to regulate vernalization requirement and response, including
FLC (Macknight et al.,
2002
; Schomburg et al.,
2001
; Sheldon et al., 2002; He
et al., 2003
) (C. Lister and C. D., unpublished data).
|
| Discussion |
|---|
|
|
|---|
The homology of FY to the Pfs2p polyadenylation factor presents a
hypothesis for the cause of fy-4 lethality. Polyadenylation factors
are generally essential proteins in eukaryotes and the lethality of such
mutations in yeast reflects an inability to correctly process 3' ends of
transcripts (Zhao et al.,
1999
; Dheur et al.,
2003
; Ohnacker et al.,
2000
; Wang et al.,
2005
). Additionally, loss of the Drosophila Su(f)
polyadenylation factor leads to cell-autonomous defects in proliferation and
viability (Audibert and Simonelig,
1999
). FY essential functions may reflect a conserved role in
general RNA 3'-end processing. However, although the WD repeats of FY
and Pfs2p are highly homologous, FY fails to complement PFS2
function in S. cerevisae (I.R.H. and C.D., unpublished data). Hence,
some aspects of their function appear to have diverged. An alternative
possibility is that FY could function to regulate a subset of RNAs, one or
several of which are essential.
Although FY may function generally in RNA processing, it is possible that
it performs a more specialised role in regulated 3'-end processing. In
vitro study of polyadenylation has commonly used constitutively utilised
3'-end processing signals (Zhao et
al., 1999
). However, there is abundant evidence that regulated
3'-end processing occurs in vivo
(Beaudoing and Gautheret, 2001
;
Edwalds-Gilbert et al., 1997
).
The cis signals and trans factors mediating alternative polyadenylation are
poorly understood, though polyadenylation site choice during FCA
autoregulation represents one instance
(Macknight et al., 2002
;
Quesada et al., 2003
). With
respect to FY function in constitutive versus regulated polyadenylation it is
important to consider potential redundancy within 3'-end processing
complexes (Keller and Minvielle-Sebastia,
1997
). Pfs2p and a second polyadenylation factor, CstF-50, are
proposed functional orthologues based on their domain organisation and similar
protein interactions (Ohnacker et al.,
2000
; Takagaki and Manley,
1992
). S. cerevisae is unusual relative to other
eukaryotes in encoding only a Pfs2p-like protein. The presence of both
CstF-50-like and Pfs2p-like proteins in other eukaryotes may have facilitated
functional divergence of Pfs2p-like proteins. Indeed, Pfs2p-like proteins
sequenced from eukaryotes other than S. cerevisae display unusual
features. The acquisition of distinct C-terminal domains is evident in many
FY/Pfs2p homologues (Fig. 1).
By analogy, these domains may function as binding sites for trans-regulators
of 3'-end processing, similar to FCA. A developmental function for the
mammalian FY/Pfs2p homologue, WDC146, is probably the result of its specific
expression pattern during spermatogenesis and its absence from constitutive
polyadenylation complexes (Ito et al.,
2001
; Zhao et al.,
1999
). The functions of FY/Pfs2p proteins in regulated
polyadenylation may be addressed by searching for proteins interacting with
these C-terminal domains. It will be interesting to determine whether distinct
FY polyadenylation complexes mediate flowering time and essential functions,
and furthermore whether this reflects different roles in regulated versus
constitutive RNA 3'-end processing.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Present address: School of Life Sciences, Dundee University and Gene
Expression Programme, Scottish Crop Research Institute, Invergowrie, Dundee
DD2 5DA, UK ![]()
| REFERENCES |
|---|
|
|
|---|
Audibert, A. and Simonelig, M. (1999). The
suppressor of forked gene of Drosophila, which encodes a homologue of human
CstF-77K involved in mRNA 3'-end processing, is required for progression
through mitosis. Mech. Dev.
82, 41-50.[CrossRef][Medline]
Audibert, A., Juge, F. and Simonelig, M.
(1998). The suppressor of forked protein of Drosophila, a
homologue of the human 77K protein required for mRNA 3'-end formation,
accumulates in mitotically-active cells. Mech. Dev.
72, 53-63.[CrossRef][Medline]
Ausin, I., Alonso-Blanco, C., Jarillo, J. A., Ruiz-Garcia, L.
and Martinez-Zapater, J. M. (2004). Regulation of flowering
time by FVE, a retinoblastoma-associated protein. Nat.
Genet. 36,162
-166.[CrossRef][Medline]
Beaudoing, E. and Gautheret, D. (2001).
Identification of alternate polyadenylation sites and analysis of their tissue
distribution using EST data. Genome Res.
11,1520
-1526.
Bechtold, N., Ellis, J. and Pelletier, G.
(1993). In planta Agrobacterium mediated gene transfer
by infiltration of adult Arabidopsis thaliana plants.
Comptes rendus de l'Academie des sciences. Serie III, Sciences de
la vie 316,1194
-1199.
Coen, E. S., Romero, J. M., Doyle, S., Elliott, R., Murphy, G.
and Carpenter, R. (1990). Floricaula: a homeotic
gene required for flower development in Antirrhinum majus.
Cell 63,1311
-1322.[CrossRef][Medline]
Dheur, S., Vo le, T. A., Voisinet-Hakil, F., Minet, M.,
Schmitter, J. M., Lacroute, F., Wyers, F. and Minvielle-Sebastia, L.
(2003). Pti1p and Ref2p found in association with the mRNA
3' end formation complex direct snoRNA maturation. EMBO
J. 22,2831
-2840.[CrossRef][Medline]
Edwalds-Gilbert, G., Veraldi, K. L. and Milcarek, C.
(1997). Alternative poly(A) site selection in complex
transcription units: means to an end? Nucleic Acids
Res. 25,2547
-2561.
Gazzani, S., Gendall, A. R., Lister, C. and Dean, C.
(2003). Analysis of the molecular basis of flowering time
variation in Arabidopsis accessions. Plant
Physiol. 132,1107
-1114.
Harlow, E. and Lane, D. (1988).
Antibodies: A Laboratory Manual. Cold Spring Harbor:
Cold Spring Harbor Laboratory Press.
Hellens, R. P., Edwards, E. A., Leyland, N. R., Bean, S. and
Mullineaux, P. M. (2000). pGreen: a versatile and flexible
binary Ti vector for Agrobacterium-mediated plant transformation.
Plant Mol. Biol. 42,819
-832.[CrossRef][Medline]
He, Y., Michaels, S. D. and Amasino, R. M.
(2003). Regulation of flowering time by histone acetylation in
Arabidopsis. Science
302,1751
-1754.
Hepworth, S. R., Valverde, F., Ravenscroft, D., Mouradov, A. and
Coupland, G. (2002). Antagonistic regulation of
flowering-time gene SOC1 by CONSTANS and FLC via separate
promoter motifs. EMBO J.
21,4327
-4337.[CrossRef][Medline]
Holm, M., Hardtke, C. S., Gaudet, R. and Deng, X. W.
(2001). Identification of a structural motif that confers
specific interaction with the WD40 repeat domain of Arabidopsis COP1.
EMBO J. 20,118
-127.[CrossRef][Medline]
Ito, S., Sakai, A., Nomura, T., Miki, Y., Ouchida, M., Sasaki,
J. and Shimizu, K. (2001). A novel WD40 repeat protein,
WDC146, highly expressed during spermatogenesis in a stage-specific manner.
Biochem. Biophys Res. Commun.
280,656
-663.[CrossRef][Medline]
Jefferson, R. A. (1987). Assaying chimeric
genes in plants: the GUS fusion system. Plant Mol. Biol.
Rep. 5,387
-405.
Johanson, U., West, J., Lister, C., Michaels, S., Amasino, R.
and Dean, C. (2000). Molecular analysis of FRIGIDA,
a major determinant of natural variation in Arabidopsis flowering
time. Science 290,344
-347.
Keller, W. and Minvielle-Sebastia, L. (1997). A
comparison of mammalian and yeast pre-mRNA 3'-end processing.
Curr. Opin. Cell. Biol.
9, 329-336.[CrossRef][Medline]
Koornneef, M., Hanhart, C. J. and Van der Veen, J. H.
(1991). A genetic and physiological, analysis of late flowering
mutants in Arabidopsis thaliana. Mol. Gen.
Genet. 229,57
-66.[Medline]
Koornneef, M., Alonso-Blanco, C., Blankestijn-de Vries, H.,
Hanhart, C. J. and Peeters, A. J. (1998). Genetic
interactions among late-flowering mutants of Arabidopsis.
Genetics 148,885
-892.
Lee, I., Aukerman, M. J., Gore, S. L., Lohman, K. N., Michaels,
S. D., Weaver, L. M., John, M. C., Feldmann, K. A. and Amasino, R. M.
(1994). Isolation of LUMINIDEPENDENS: a gene involved in
the control of flowering time in Arabidopsis. Plant
Cell 6,75
-83.[Abstract]
Lim, M. H., Kim, J., Kim, Y. S., Chung, K. S., Seo, Y. H., Lee,
I., Hong, C. B., Kim, H. J. and Park, C. M. (2004). A new
Arabidopsis gene, FLK, encodes an RNA binding protein with K homology
motifs and regulates flowering time via FLOWERING LOCUS C.
Plant Cell 16,731
-740.
Lu, R., Martin-Hernandez, A. M., Peart, J. R., Malcuit, I. and
Baulcombe, D. C. (2003). Virus-induced gene silencing in
plants. Methods 30,296
-303.[CrossRef][Medline]
Macias, M. J., Wiesner, S. and Sudol, M.
(2002). WW and SH3 domains, two different scaffolds to recognize
proline-rich ligands. FEBS Lett.
513, 30-37.[CrossRef][Medline]
Macknight, R., Bancroft, I., Page, T., Lister, C., Schmidt, R.,
Love, K., Westphal, L., Murphy, G., Sherson, S., Cobbett, C. et al.
(1997). FCA, a gene controlling flowering time in
Arabidopsis, encodes a protein containing RNA-binding domains.
Cell 89,737
-745.[CrossRef][Medline]
Macknight, R., Duroux, M., Laurie, R., Dijkwel, P., Simpson, G.
and Dean, C. (2002). Functional significance of the
alternative transcript processing of the Arabidopsis floral promoter
FCA. Plant Cell
14,877
-888.
McCallum, C. M., Comai, L., Greene, E. A. and Henikoff, S.
(2000). Targeting induced local lesions IN genomes (TILLING) for
plant functional genomics. Plant Physiol.
123,439
-442.
McNellis, T. W., von Arnim, A. G., Araki, T., Komeda, Y.,
Misera, S. and Deng, X. W. (1994). Genetic and molecular
analysis of an allelic series of cop1 mutants suggests functional
roles for the multiple protein domains. Plant Cell
6, 487-500.[Abstract]
Michaels, S. D. and Amasino, R. M. (1999).
FLOWERING LOCUS C encodes a novel MADS domain protein that acts as a
repressor of flowering. Plant Cell
11,949
-956.
Michaels, S. D. and Amasino, R. M. (2001). Loss
of FLOWERING LOCUS C activity eliminates the late-flowering
phenotype of FRIGIDA and autonomous pathway mutations but not
responsiveness to vernalization. Plant Cell
13,935
-941.
Michaels, S. D., He, Y., Scortecci, K. C. and Amasino, R. M.
(2003). Attenuation of FLOWERING LOCUS C activity as a
mechanism for the evolution of summer-annual flowering behavior in
Arabidopsis. Proc. Natl. Acad. Sci. USA
100,10102
-10107.
Mockler, T. C., Yu, X., Shalitin, D., Parikh, D., Michael, T.
P., Liou, J., Huang, J., Smith, Z., Alonso, J. M., Ecker, J. R. et al.
(2004). Regulation of flowering time in Arabidopsis by K
homology domain proteins. Proc. Natl. Acad. Sci. USA
101,12759
-12764.
Moon, J., Suh, S. S., Lee, H., Choi, K. R., Hong, C. B., Paek,
N. C., Kim, S. G. and Lee, I. (2003). The SOC1
MADS-box gene integrates vernalization and gibberellin signals for flowering
in Arabidopsis. Plant J.
35,613
-623.[CrossRef][Medline]
Neff, M. M., Neff, J. D., Chory, J. and Pepper, A. E.
(1988). dCAPS, a simple technique for the genetic analysis of
single nucleotide polymorphism: experimental applications in Arabidopsis
thaliana genetics. Plant J.
14,387
-392.
Ohnacker, M., Barabino, S. M., Preker, P. J. and Keller, W.
(2000). The WD-repeat protein Pfs2p bridges two essential factors
within the yeast pre-mRNA 3'-end-processing complex. EMBO
J. 19,37
-47.[CrossRef][Medline]
Parkhurst, S. M. and Corces, V. G. (1985).
Forked, gypsys, and suppressors in Drosophila.
Cell 41,429
-437.[CrossRef][Medline]
Parkhurst, S. M. and Corces, V. G. (1986).
Mutations at the suppressor of forked locus increase the accumulation
of gypsy-encoded transcripts in Drosophila melanogaster.
Mol. Cell Biol. 6,2271
-2274.
Quesada, V., Macknight, R., Dean, C. and Simpson, G. G.
(2003). Autoregulation of FCA pre-mRNA processing
controls Arabidopsis flowering time. EMBO J.
22,3142
-3152.[CrossRef][Medline]
Ratcliff, F., Martin Hernandez, A. M. and Baulcombe, D. C.
(2001). Technical Advance. Tobacco rattle virus as a vector for
analysis of gene function by silencing. Plant J.
25,237
-245.[CrossRef][Medline]
Samach, A., Onouchi, H., Gold, S. E., Ditta, G. S.,
Schwarz-Sommer, Z., Yanofsky, M. F. and Coupland, G. (2000).
Distinct roles of CONSTANS target genes in reproductive development
of Arabidopsis. Science
288,1613
-1616.
Schomburg, F. M., Patton, D. A., Meinke, D. W. and Amasino, R.
M. (2001). FPA, a gene involved in floral induction
in Arabidopsis, encodes a protein containing RNA-recognition motifs.
Plant Cell 13,1427
-1436.
Sessions, A., Burke, E., Presting, G., Aux, G., McElver, J.,
Patton, D., Dietrich, B., Ho, P., Bacwaden, J., Ko, C. et al.
(2002). A high-throughput Arabidopsis reverse genetics
system. Plant Cell 14,2985
-2994.
Sheldon, C. C., Burn, J. E., Perez, P. P., Metzger, J., Edwards,
J. A., Peacock, W. J. and Dennis, E. S. (1999). The
FLF MADS box gene: a repressor of flowering in Arabidopsis
regulated by vernalization and methylation. Plant Cell
11,445
-458.
Simpson, G. G. and Dean, C. (2002).
Arabidopsis, the Rosetta stone of flowering time?
Science 296,285
-289.
Simpson, C. G., McQuade, C., Lyon, J. and Brown, J. W.
(1998). Characterization of exon skipping mutants of the
COP1 gene from Arabidopsis. Plant J.
15,125
-131.[CrossRef][Medline]
Simpson, G. G., Dijkwel, P. P., Quesada, V., Henderson, I. and
Dean, C. (2003). FY is an RNA 3' end-processing factor
that interacts with FCA to control the Arabidopsis floral transition.
Cell 113,777
-787.[CrossRef][Medline]
Smith, T. F., Gaitatzes, C., Saxena, K. and Neer, E. J.
(1999). The WD repeat: a common architecture for diverse
functions. Trends Biochem. Sci.
24,181
-185.[CrossRef][Medline]
Sudol, M. and Hunter, T. (2000). NeW wrinkles
for an old domain. Cell
103,1001
-1004.[CrossRef][Medline]
Takagaki, Y. and Manley, J. L. (1992). A human
polyadenylation factor is a G protein beta-subunit homologue. J.
Biol. Chem. 267,23471
-23474.
Wang, S.-W., Asakawa, K., Win, T. Z., Toda, T. and Norbury, C.
J. (2005). Inactivation of the pre-mRNA cleavage and
polyadenylation factor Pfs2 in fission yeast causes lethal cell cycle defects.
Mol. Cell Biol. 25,2288
-2296.
Zhao, J., Hyman, L. and Moore, C. (1999).
Formation of mRNA 3' ends in eukaryotes: mechanism, regulation, and
interrelationships with other steps in mRNA synthesis. Microbiol.
Mol. Biol. Rev. 63,405
-445.
Related articles in Development:
This article has been cited by other articles:
![]() |
Y. H. Jang, H.-Y. Park, S.-K. Kim, J. H. Lee, M. C. Suh, Y. S. Chung, K.-H. Paek, and J.-K. Kim Survey of Rice Proteins Interacting With OsFCA and OsFY Proteins Which Are Homologous to the Arabidopsis Flowering Time Proteins, FCA and FY Plant Cell Physiol., August 1, 2009; 50(8): 1479 - 1492. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Manzano, S. Marquardt, A. M. E. Jones, I. Baurle, F. Liu, and C. Dean Altered interactions within FY/AtCPSF complexes required for Arabidopsis FCA-mediated chromatin silencing PNAS, May 26, 2009; 106(21): 8772 - 8777. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Veley and S. D. Michaels Functional Redundancy and New Roles for Genes of the Autonomous Floral-Promotion Pathway Plant Physiology, June 1, 2008; 147(2): 682 - 695. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-H. Lee, W. Terzaghi, G. Gusmaroli, J.-B. F. Charron, H.-J. Yoon, H. Chen, Y. J. He, Y. Xiong, and X. W. Deng Characterization of Arabidopsis and Rice DWD Proteins and Their Roles as Substrate Receptors for CUL4-RING E3 Ubiquitin Ligases PLANT CELL, January 1, 2008; 20(1): 152 - 167. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Deng, C. Liu, Y. Pei, X. Deng, L. Niu, and X. Cao Involvement of the Histone Acetyltransferase AtHAC1 in the Regulation of Flowering Time via Repression of FLOWERING LOCUS C in Arabidopsis Plant Physiology, April 1, 2007; 143(4): 1660 - 1668. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Swiezewski, P. Crevillen, F. Liu, J. R. Ecker, A. Jerzmanowski, and C. Dean Small RNA-mediated chromatin silencing directed to the 3' region of the Arabidopsis gene encoding the developmental regulator, FLC PNAS, February 27, 2007; 104(9): 3633 - 3638. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Bove, C. L.H. Hord, and M. A. Mullen The blossoming of RNA biology: Novel insights from plant systems RNA, December 1, 2006; 12(12): 2035 - 2046. [Full Text] [PDF] |
||||
![]() |
S Marquardt, P. Boss, J Hadfield, and C Dean Additional targets of the Arabidopsis autonomous pathway members, FCA and FY J. Exp. Bot., October 1, 2006; 57(13): 3379 - 3386. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. R. Finkelstein Studies of abscisic Acid perception finally flower. PLANT CELL, April 1, 2006; 18(4): 786 - 791. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||