|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online August 2, 2005
doi: 10.1242/10.1242/dev.01937
Molecular Neurobiology Laboratory, The Salk Institute for Biological Studies, 10010 North Torrey Pines Road, La Jolla, CA 92037, USA
e-mail: lamar{at}salk.edu and kintner{at}salk.edu
Accepted 13 June 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Notch, Esr, bHLH, E(spl)/hairy, Neurogenesis, HES, Xenopus
| Introduction |
|---|
|
|
|---|
Paradigms for how bHLH repressors regulate neural differentiation have
arisen from studies of peripheral neurogenesis in Drosophila imaginal
discs (Fisher and Caudy,
1998
). In one scenario, repressors such as Hairy mediate
prepatterning by repressing establishment of proneural domains
(Ohsako et al., 1994
;
Van Doren et al., 1992
). By
contrast, bHLH repressors encoded by genes in the E(spl) Complex
(Knust et al., 1992
) function
within proneural domains as effectors of the Notch/LIN-12 signaling pathway,
which mediates lateral inhibition in invertebrates
(Seydoux and Greenwald, 1989
;
Heitzler and Simpson,
1991
) and vertebrates (reviewed by
Kintner, 2003
). In
Drosophila, activity of E(spl) gene enhancers during lateral
inhibition is driven by direct Notch input via binding sites for the repressor
Suppressor of Hairless [Su(H)] (Bailey and
Posakony, 1995
; Cooper et al.,
2000
; Nellesen et al.,
1999
), known as LAG-1 in worms and CBF1/RBP-J
in mammals,
Notch signaling converts Su(H) to an activator by recruiting the Notch
intracellular domain (ICD) and co-activators such as Mastermind/LAG-3
(Petcherski and Kimble, 2000
;
Fryer et al., 2002
) (reviewed
by Lamar and Kintner, 2003
).
Expression of several E(spl) enhancers during lateral inhibition not
only requires direct input from Notch through Su(H)-binding sites but also
input from the proneural bHLH proteins through E-box-binding sites
(Bailey and Posakony, 1995
;
Nellesen et al., 1999
;
Cooper et al., 2000
;
Cave et al., 2005
). This
combinatorial code explains why these enhancers respond to Notch only in a
proneural context (Furriols and Bray,
2001
; Barolo and Posakony,
2002
), and indicates that proneural proteins activate their own
inhibitors not only non-cell autonomously by transactivating the gene encoding
the Notch ligand Delta (Kunisch et al.,
1994
), but directly.
In vertebrates neural precursors also express genes encoding bHLH
repressors, including proteins structurally related either to Hairy
such as mouse Hes1 (Takebayashi et al.,
1994
) or to mouse Hes5
(Li et al., 2003
). Numerous
studies demonstrate that repressors of either family antagonize neurogenesis
(Deblandre et al., 1999
;
Ohtsuka et al., 1999
;
Takke et al., 1999
;
Koyano-Nakagawa et al., 2000
;
Stancheva et al., 2003
).
Furthermore, many HES genes are likely direct Notch targets as many exhibit
proximal Su(H)-binding sites in an `SPS' motif, for Suppressor of Hairless
paired sites (Bailey and Posakony,
1995
). Although HES gene regulation has not been analyzed in
detail in vertebrates, their expression patterns within a species vary
(Jouve et al., 2000
;
Hatakeyama et al., 2004
;
Fior and Henrique, 2005
),
suggesting a combinatorial mechanism.
Neural precursors in Xenopus embryos also express Hairy and
Hes5-like repressors. A hairy homolog, Xenopus Hairy2, is
expressed during gastrulation (Tsuji et
al., 2003
) prior to upregulation of Delta, while a
Xenopus Hes5 ortholog Esr1 is expressed at time coincident
with Notch signaling (Wettstein et al.,
1997
). A 500 bp enhancer element regulating mesodermal
Hairy2 expression has been characterized
(Davis et al., 2001
). That
element drives Hairy2 expression in the brain and mesoderm
(Davis et al., 2001
), providing
a basis for comparison with Notch effectors of lateral inhibition.
Here, we characterize two such enhancers, those of Esr1 and
Esr10 (Gawantka et al.,
1998
). Both are expressed in neurectodermal domains where primary
neurons form, and proneural genes (Ma et
al., 1996
) and Notch ligands
(Chitnis et al., 1995
) are
expressed. Esr10 is also cyclically expressed in the presomitic
mesoderm, where it may function in the segmentation clock
(Li et al., 2003
). Using
transgenic frogs (Amaya and Kroll,
1999
), we show that Esr1 and Esr10 cis-elements
drive reporter expression in proneural domains mirroring endogenous
expression. Unlike the Hairy2 regulatory element, Esr gene
enhancers are upregulated by Xngnr1, thereby constituting proneural
enhancers. Analysis of transgenic frogs coupled with transfection assays
reveals that regulation of Esr1 and Esr10 differs.
Specifically, although an intact SPS motif is necessary but not sufficient for
expression of either gene in a proneural context, Notch input to each occurs
through architecturally distinct sites. Furthermore, bHLH proteins probably
provide both direct and indirect inputs to the Esr10 enhancer, while
in the case of Esr1 that input is only indirect. These results define
inputs crucial for expression of bHLH repressors within neural precursors
downstream of the Notch pathway.
| Materials and methods |
|---|
|
|
|---|
Identification of promoter elements and transgenic methods
Proximal elements were obtained as described
(Moreno and Kintner, 2004
) and
cloned upstream of GFP in a vector containing the 700 bp
Hairy2 3' instability element
(Davis et al., 2001
). Basal
promoters were determined using
www.fruitfly.org/seq_tools/other.html.
Protein and DNA sequences were obtained from databases at
www.ncbi.nlm.nih.gov
(mouse, chicken, zebrafish and fugu) and
http://genome.jgi-psf.org/Xentr3.home.html
(Xenopus tropicalis). GenBank Accession Numbers for Esr1/RV and
Esr10/Dra are DQ096795 and DQ096794, respectively.
Transgenic frogs were generated using standard
(Amaya and Kroll, 1999
;
Sparrow et al., 2000
)
protocols. In addition, we delayed activation by injecting oocytes in
Ca2+-free injection buffer and activating them following injection
by incubation in 0.1xMMR plus Ca2+ containing 1 µM A23187
(Sigma). This protocol increased transgenic efficiency and reduced
gastrulation defects.
Site-directed mutagenesis
Mutagenesis was achieved by PCR using sense and antisense oligonucleotides
followed by DpnI digestion of the parent plasmid.
Oligonucleotides to mutate Esr1 were (mutant nucleotides underlined): mS1, GCTAAACGAGTGTGGCAAAGTGTAGCAGGTTTG; mS2, GTAGCAGGTTTGGGAGTCATGCATTAGTATGCG; mS4, GATGGGAATCTCTTTGCCACGTTCTCCCACCTC; mE1, GCCCTATTGTACAACCTCTTGTTATACCAAATTACGTG; mE2a, TGTAACACACTCTCAACCTTCTCCACTGGGAGC; 3xmSu(H), GATTATAGTGATGGCAATCTCTTTGCCACGTTCTGCCACCTC; mE2b, GTGTAACACACTCTGAAGGTTTCCACTGGGAGCAG; mE3, GCTCCACAGCTCATATCCTCTCCAGCACTAGC.
Oligonucleotides to mutate Esr10 were: m1E1, GTATCTCAGTGTCCGGATTTCCCACACTTC; m1E2, TGTTCAGGGCTCTCCGGACCACCCTTAATG; m2E1, TAGTATCTCAGTGCCAGTCTTTCCCACACTTCCCCTC; m2E2, ATTGTTCAGGGCTCCCGATTCCACCCTTAATGTGACAC; mS1, GCTACTGAGTGTGGCAACCTCTGCTCAGCC; mS2, CTCAGCCTGATCCTGACACATTATTATGCA; mCAAT, CTGCAGGGCTGGGTCGAGCTACTGAGTGTG.
Animal cap assay
RNA injection, preparation of neuralized caps, RNAse protection assay, and
probes for Esr1 and EF1
were as described were as
previously described (Koyano-Nakagawa et
al., 1999
). The Esr10 probe was a 276 bp fragment of the
3'UTR of clone 11A10 (Gawantka et
al., 1998
), cloned into Bluescript (Stratagene), linearized with
Bam, and transcribed using T7. Caps were cut at stage 10 and harvested when
embryo controls reached stage 12. Quantification was carried out using a
Phosphor Imager (Molecular Dynamics).
Transfections and EMSA
HeLa cells were transfected with Lipofectamine2000 (Invitrogen) as
described (Lamar et al.,
2001
). Effectors were Xenopus ICD
(Wettstein et al., 1997
),
Xngnr1 (Ma et al., 1996
) and
E47 (Lee and Pfaff, 2003
). In
addition to those described in the text, reporters included Xenopus
Hairy2 (Davis et al.,
2001
), Hes1
(Jarriault et al., 1995
) and
multimerized Su(H)-binding sites (Ling et
al., 1994
). Transfection efficiency was assessed using either
co-transfected lacZ expression vectors and ONPG substrate (Sigma) or
tk-Renilla reporters.
For EMSAs proteins were synthesized using a TnT reticulocyte lysate kit (ProMega). Oligos were end-labeled with [32P]dCTP using Klenow to a specific activity of 2x106 CPM/pmol. Heterodimers were preincubated 30 minutes at room temperature prior to binding. Binding reactions included 1-5x105 CPM of probe, 2 µg poly(dI-dC) (Roche), 10 mM Tris (pH 7.5), 50 mM NaCl, 1 mM DTT, 1 mM EDTA and 3% glycerol. After incubating 45 minutes at room temperature, DNA/protein complexes were loaded onto a 5% (30:1) nondenaturing polyacrylamide gel and run for 3 hours at 200 V at 4°C.
| Results |
|---|
|
|
|---|
|
|
|
|
Proneural expression of the Xenopus bHLH repressors was also examined in an animal cap assay in which premature neuronal differentiation is induced in neuralized ectoderm by misexpression of Xngnr1. In this assay, expression levels of both Esr1 and Esr10 (Fig. 2M), but not of Hairy2A (data not shown) are markedly upregulated in response to Xngnr1. Significantly, the response of Esr1 and Esr10 to Xngnr1 in this more quantitative assay differs by several criteria. Although Esr1 RNA levels increased 17-fold in response of Xngnr1, the levels of Esr1 RNA increased only 7.6 fold. Moreover, the response of Esr1 and 10 to Xngnr1 differed when assayed in the presence of either excess ICD or Su(H). Whereas the levels of Esr1 RNA induced by Xngnr1 increased twofold with excess ICD and halved with excess Su(H), the levels of Esr10 remained relatively unchanged (Fig. 2M, left; quantified on the right). In this assay, therefore, the response of Esr1 and Esr10 to proneural input was similar but not equivalent.
Identification of genomic elements flanking Esr1 and Esr10
To identify elements required for proneural expression of the Esr genes, we
isolated genomic sequences lying upstream of Esr1, Esr7 and
Esr10 (Fig. 3A; see
Materials and methods). Each of these sequences exhibits paired Su(H) sites
resembling an SPS proximal to the TATA box, as seen in several E(spl)
genes and vertebrate homologs (Jarriault
et al., 1995
; Bailey and
Posakony, 1995
; Nellesen et
al., 1999
; Gajewski and
Voolstra, 2002
); the upstream S1 site is highly conserved among
Esr1, Esr7, Esr10 and Hairy2
(Davis et al., 2001
), which is
shown for comparison (Fig. 3A).
However, S2 is variable and deviates from the Su(H) consensus site (see
below). All SPS elements are flanked by an inverse CCAAT-type motif
(Fig. 3A) seen in numerous
vertebrate E(spl) homologs
(Gajewski and Voolstra, 2002
).
Homology among Esr1, Esr7, Esr10 and Hairy2 is high in the
proximal 100 base pairs, with Esr1 exhibiting comparable identity
with Esr7 (56%), Esr10 (56%) and Hairy2 (51%).
However, the degree of homology between 100 and 200 reflects the
degree of identity of the proteins (see
Fig. 1), with the Esr1
promoter exhibiting 64%, 41% and 27% identity with Esr7, Esr10 and
Hairy2, respectively.
Esr gene proximal sequences drive neural reporter expression
To determine if the isolated genomic fragments contained proneural
enhancers, they were assayed in transgenic frogs using vectors containing
GFP as a reporter (Fig.
3B). Each genomic fragment carried its own basal promoter and the
vector contained the 3' Hairy2 UTR, which mediates RNA
instability and is required for the striped pattern of mesodermal
Hairy2 expression (Davis et al.,
2001
). Although GFP expression was apparent at neural
plate stages (data not shown), we analyzed embryos at neurula stages (18-20)
owing to the robust response. The neural expression of GFP RNA in
frogs transgenic with the longest (FL) fragments of Esr1 and
Esr10 (Fig. 3C,F) was
indistinguishable from that of the endogenous genes (compare
Fig. 3C,F with
Fig. 2A,B,D,E).
FL-Esr1 drove reporter expression in the neural tube, cranial ganglia
and brain (Fig. 3C).
FL-Esr10 also recapitulated neural expression of endogenous
Esr10 (Fig. 3F),
including tailbud expression, indicating that these sequences contain some
elements required for mesodermal expression. FL-Esr10 also drove
mesodermal GFP expression in somitomeric stripes, a pattern similar
to that observed with endogenous Hairy2 and Esr10. Finally,
a 516 bp Esr7 element drove robust GFP expression in a
pattern similar to the endogenous gene but was not further analyzed
(Table 1).
|
Esr1 and 10 enhancer elements are appropriately responsive to Xngnr1
Endogenous Esr1 and Esr10 can be induced ectopically by
misexpression of the proneural gene Xngnr1
(Koyano-Nakagawa et al., 1999
)
(Fig. 2C,F). Therefore, we
injected mRNA encoding Xngnr1 and a ß-galactosidase tracer into
one blastomere of two-cell embryos that were transgenic for Esr1/RV
or Esr10/Dra, and asked whether embryos showed ectopic GFP
expression. In both cases, GFP expression was expanded, although, in
general, Esr10/Dra showed broader expression on the injected side
than did Esr1/RV (Fig.
4A,C). We then asked whether Xngnr1 upregulated
GFP in Esr1/Hin3 and Esr10/Pst transgenic embryos,
which show attenuated GFP expression
(Fig. 4F). Neither
Esr1/Hin3 (Fig. 4B)
nor Esr10/Pst (Fig.
4D) exhibited ectopic GFP expression in response to
Xngnr1, indicating that sequences required for such a response are
upstream of Hin3 and Pst in Esr1 and Esr10, respectively.
These observations confirm that both elements contain neural enhancers
responsive to Xngnr1, and that elements responsive to Xngnr1
lie upstream of the SPS.
Data presented here (Fig.
2L) and by others (Glavic et
al., 2003
; Tsuji et al.,
2003
) strongly suggests that Xenopus Hairy2 inhibits
neurogenesis primarily through a prepattern function and is not responsive to
proneural genes. Therefore, we asked if the 500 bp Hairy2 proximal
genomic element, which drives Hairy2 expression in the anterior
neurectoderm and in the mesoderm (Davis et
al., 2001
), was upregulated by Xngnr1. Transgenic frog
embryos harboring the Hairy2-GFP construct and injected with
Xngnr1 mRNA showed no GFP upregulation
(Fig. 4E), in support of
results seen with the endogenous Hairy2 gene
(Fig. 2L). Thus, we propose
that in contrast to the element flanking Hairy2, Esr1/RV and
Esr10/Dra constitute proneural enhancers upregulated by bHLH proteins
during lateral inhibition.
|
|
By contrast, S2 diverges among Hes5-like genes and between Esr1 and 10, and S2 sites of several HES homologs constitute potentially suboptimal binding sites (Fig. 5I, right). Mutating the S2 G5 to C in Esr1/RV or Esr10/Dra revealed a significant difference between the two: mutating the Esr1 S2 (Fig. 5A,C) had no effect on GFP expression, while mutating the Esr10 S2 (Fig. 5E,G) strongly blocked GFP staining in neural tissue. These observations suggest that the Esr1 S2 is not a Su(H)-binding site in vivo and were supported by transfection analysis of Esr1/RV showing that mutant S2 had little effect on ICD-mediated transcription, while mutating S1 blocked activation (Fig. 5J). These findings indicate that S1 and S2 of Esr10 probably constitute a bona fide SPS, while analogous sequences of Esr1 resemble the SPS but contain only a single functional Su(H) site (S1). For the sake of simplicity, however, we refer to this motif in Esr1 as an `SPS' although it is technically a misnomer.
Loss of Esr1 and Esr10 enhancer activity following S1 mutation indicates that proneural expression of both requires direct Notch input through this site. Therefore, we asked whether enhancer activity of S1 mutants could be induced by ectopic Xngnr1. Xngnr1 injection into embryos transgenic with S1 mutants of Esr1/RV or Esr10/Dra did not drive GFP expression in either case (Fig. 5D,H), indicating that bHLH input and/or high levels of Notch signaling driven by Xngnr1 cannot rescue enhancer activity in the absence of S1 function.
The Esr10 neural enhancer requires intact E-boxes
The Esr1 or 10 SPS is necessary but not sufficient for
enhancer activity. To identify potential heterologous inputs, we searched for
motifs conserved between both enhancers or for candidate transcription factor
binding sites (using Matinspector from
www.genomatix.com).
Among the latter, we found E-boxes (CANNTG) (binding sites for bHLH proteins)
and several consensus sites for Sox and NF-Y factors. Mutating the latter
produced little effect (Table
1; data not shown). Therefore, we focused on E-boxes, as they are
required for proneural expression of several Drosophila E(spl) genes
(Kramatschek and Campos-Ortega,
1994
; Nellesen et al.,
1999
; Cooper et al.,
2000
; Cave et al.,
2005
; Reeves and Posakony,
2005
).
|
Next, we asked if intact E-boxes were required for expression in transgenics. E-box mutants of Esr10/Dra drove markedly reduced GFP expression relative to controls in neural tissue in vivo (Fig. 6B,C). Mutation of both sites also abrogated mesodermal GFP expression (Fig. 6C; data not shown). To confirm that E-boxes are required for enhancer activity, we misexpressed Xngnr1 in transgenic embryos and evaluated GFP expression in embryos harboring wild-type or mutant enhancers. Following Xngnr1 misexpression, mutant enhancer activity was greatly attenuated relative to controls (Fig. 6D,E), almost as severely as that of Esr10/Pst (see Fig. 3D), which lacks both E1 and E2. These results indicate that the insufficiency of Esr10/Pst is due in part to lack of E-box input and that high levels of proneural activity cannot compensate for that loss.
Finally, we asked whether proneural proteins bind in vitro to E-box
sequences present in Esr10/Dra. The sequence of Esr10 E2
(cCAGATGc) resembles the reported `high affinity' bHLH site (rCAGSTG) targeted
by Drosophila proneural proteins
(Nellesen et al., 1999
) and
exactly matches the required NeuroM/E47 binding site in the HB9 enhancer
(Lee and Pfaff, 2003
). EMSA
analysis showed a robust shift of an E2 oligonucleotide by Xngnr1/E47
heterodimers, which was specific and not competed by the mutant E2
oligonucleotide (Fig. 6F). We
also observed shifts of E2 by heterodimers containing the atonal homologs
mouse NeuroD and Xenopus Ath3 (data not shown). By contrast, under
identical conditions, heterodimers of Xngnr1/E did not shift an Esr10
E1 oligo nor did the E1 oligo efficiently compete for Xngnr1/E47 binding to E2
(data not shown). Taken together, these observations indicate that factors
encoded by proneural genes drive neural Esr10 expression both by
activating Notch signaling and through direct interaction with bHLH-binding
sites, most probably the E2 site.
|
We next asked whether Esr1/RV E-boxes were required in vivo. E1, E2 and E3 were mutated in Esr1/RV, and the construct (Esr1/RVmE1E2E3) assayed for GFP expression. In contrast to Esr10/Dra, GFP expression in frogs carrying Esr1/RVmE1E2E3 was equivalent to controls (Fig. 8A,B). Likewise, misexpressed Xngnr1 robustly upregulated activity of Esr1/RVmE1E2 (Fig. 8D), similar to controls (Fig. 8C). These observations show that intact E-boxes are not required for Esr1/RV expression, indicating that factors induced by Xngnr1 and directly activating the Esr1 enhancer are probably not bHLH proteins. Overall, these observations, together with the differential activities of the SPS motifs, indicate that although responsive to both Notch and Xngnr1, the activity of proneural enhancers of Esr1 and Esr10 differs mechanistically.
Neural Esr1 expression requires upstream Notch input
Loss of robust responsiveness to ICD seen with the Esr1/Hin3
deletion mutant (Fig. 7A,C)
suggests that ICD activates sequences between RV and H3. Three potential Su(H)
sites (S3-S5) are clustered in that region
(Fig. 7A). Mutating all three
(Esr1/RVmS3-S5) reduced luciferase activity in cultured cells to a
level comparable with that seen with Esr1/Hin3
(Fig. 7C), indicating that at
least one of them responds to ICD. Intact S3-S5 sites were also necessary in
vivo: transgenic frogs carrying S3-S5 mutations showed highly attenuated
GFP expression in neural tissue relative to controls
(Fig. 8E), again comparable
with the weak activity mediated by Esr1/Hin3
(Fig. 3E). Injection of
Xngnr1 mRNA into mS3-5 transgenic embryos failed to rescue
GFP expression (Fig.
8F).
Within the S3-S5 cluster, S4 is highly conserved in position and orientation in orthologous genes (Fig. 8H). Mutating S4 alone abrogated enhancer activity both in transfected cells (Fig. 7D) and in vivo (Fig. 8G), indicating that it is required for high levels of Notch-mediated transcription and for enhancer activity in vivo. Taken together, these observations indicate that the distal 216 bp of Esr1/RV are required for Xngnr1 to activate Esr1 enhancer activity. Failure of Xngnr1 to activate the mS3-5 or S4 construct indicates that at least some inputs to that region are activated Notch itself (see Discussion).
| Discussion |
|---|
|
|
|---|
|
80 nucleotides upstream of the
transcription start site, that contains an SPS, or remnant thereof, and an
upstream inverted CCAAT motif. This region is seen in both Hes1- and
Hes5-like family members in various vertebrate species
(Gajewski and Voolstra, 2002
Proneural enhancers of Esr1 and Esr10 exhibit structural hallmarks of Notch targets
Both Esr1 and Esr10 require at least two functional
Su(H)-binding sites for expression in neural precursors and to respond to
ectopic proneural activity, but differ in how these sites are arranged. In
Esr10, these two sites are configured in the classic inverted repeat
SPS motif located at 84, highlighting the importance of this motif to
Notch responsiveness. In this aspect, the Esr10 SPS resembles that of
Hairy2 (Davis et al.,
2001
), which also requires both S1 and S2 in the SPS for
mesodermal expression within somitomeres. Indeed, Esr10/Pst, which
consists primarily of an SPS, drives faint somitomeric reporter expression
reminiscent of Hairy2 (Fig.
3H, Fig. 4D), in
agreement with the findings of Davis et al.
(Davis et al., 2001
) that two
functioning Su(H) sites in an SPS configuration are sufficient for somitomeric
expression.
By contrast, the Esr1 SPS has diverged, such that S1 is conserved while S2 is predicted to not bind Su(H), to not be required for Notch activation in transient transfection assays (Fig. 5J) and to not be required for proneural enhancer activity (Fig. 5C). Instead, we found that an upstream Su(H) site (S4) among a cluster of three potential sites is required with S1 for Esr1 expression (Figs 7, 8) and to respond to proneural activity. Interestingly, S4 is spatially conserved relative to S1 in several Esr1/Hes5 orthologs (Fig. 8H). Furthermore, S2 of mouse Hes5, like that of Esr1, is potentially a suboptimal binding site (Fig. 5I, right), suggesting that Notch activation of Esr1 orthologs may require Su(H) sites in an S4-S1 configuration rather than in the `classical' SPS configuration. It will be of interest to determine whether the spacing and orientation of the S4-S1 Su(H)-binding sites are also crucial for response to Notch in other Hes5 orthologs.
Numerous vertebrate E(spl) genes, including Esr1, Esr7, Esr10,
Hairy2, and chick, mouse and fish homologs exhibit inverse CCAAT motifs
flanking the SPS, and Sox1 represses Hes1 promoter-dependent
luciferase activity in transfection assays through this site
(Kan et al., 2004
). Mutation
the Esr10 CCAAT resulted in GFP expression that was
extremely robust (Table 1,
mCAAT) but not quantifiably more so than controls. This discrepancy may
reflect differences in transcriptional regulation of Hes1 and
Esr10 or differences in assay sensitivity.
Esr10 and Esr1 are differentially regulated by bHLH proteins
Our data indicates that proneural bHLH input to the Esr10 enhancer
is both indirect (through Notch) and direct
(Fig. 6). ICD and Xngnr1
synergistically upregulate transcription in transfection assays, Xngnr1 binds
to the Esr10 downstream E-box in vitro, and the Esr10
proneural enhancer with mutant E-boxes shows marked loss of activity in vivo,
which cannot be rescued by exogenous Xngnr1. These findings extend
observations in Drosophila that proneural proteins synergize with
Notch in activating E(spl) genes in larval discs
(Kramatschek and Campos-Ortega,
1994
; Bailey and Posakony,
1995
; Cooper et al.,
2000
). Our data also support analysis of the Drosophila
E(spl) gene m8 (Cave et al.,
2005
). In that case, E boxes and Su(H) sites in only the
configuration of a classical SPS enabled synergy between ICD and bHLH
proteins, and enhancer activity was lost when one Su(H) site was mutant or
oriented incorrectly. The Esr10 proneural enhancer behaves similarly
in transgenics and provides the first example of such a required architecture
among vertebrate Notch targets.
By contrast, Esr1 is not directly regulated by proneural proteins.
Although Esr1/RV has three E-boxes, E3 is not conserved in
Xt, E1 is not conserved in the proneural enhancer of the closely
related Esr7 gene (E.L. and C.K., unpublished), and neither E1 nor E3
fits the RCAGSTG consensus required for high-affinity binding of
Drosophila proneural proteins to E-boxes (Van Doren, 1991). However,
the CACCTG motif seen in E2 is targeted by Drosophila proneural
proteins (Powell et al.,
2004
), a CACCTG E-box is required for retinal expression of
Xenopus Ath5 (Hutcheson et al.,
2005
), and CACCTG binds MyoD in vitro and in vivo
(Yutzey and Konieczny, 1992
).
Furthermore, E2 is embedded in a 13-base homology extending beyond the E-box
in numerous Hes5 orthologs, although it is not seen in the
Esr10 promoter. We mutated E2 using two strategies and saw no effect
on transgene expression in vivo (see Materials and methods and
Table 1 (oligos mE2a and mE2b).
Further mutation may be required to evaluate the contribution of this motif to
Esr1 expression. Nonetheless that E2 is contained within
Esr1/Hin3 (Fig. 6A)
rules out the possibility that any factor binding to E2 is sufficient (with
Notch acting through S1) to activate robust enhancer activity.
We have not identified sites required for proneural Esr1 expression other than Su(H) sites. Su(H) sites could be sufficient to activate Esr1, and tissue-specific responses to Notch might be due either to tissue-specific repressors or to the spacing of Su(H) sites providing a distinct platform for co-activators. Alternatively, Su(H) sites in the Esr1 enhancer could synergize with heterologous (non-bHLH) factors induced by Xngnr1, which, unlike direct bHLH input to either Esr10 or m8, interact with Notch through an S1-S4 configuration of Su(H) sites. Finally, enhancer activity could require input from both Notch (dependent on Xngnr1) and neural factors not dependent on Xngnr1. Although all three scenarios are possible, observation of attenuated but spatially appropriate GFP expression driven by Esr1/Hin3 argues against Su(H) site spacing as the sole determinant of specificity and suggests rather that tissue specific input to Esr1 requires sequences downstream of Hin3.
Why does transcriptional regulation of Esr1 and 10 differ?
Although regulation of Esr10 reflects Drosophila models
of E(spl) regulation, Esr1 represents a novel paradigm by
which effectors of lateral inhibition are regulated differently both in terms
of Su(H) configuration and direct bHLH input. The lack of dependence of the
Esr1 enhancer on direct E-box input may in fact indicate that the
S1-S4 configuration precludes interactions of Notch with E-box-binding
proteins. Why such similarly expressed genes should be differentially
regulated is unclear.
A fundamental difference between Esr1 and Esr10 is that
Esr10 is also expressed in the presomitic mesoderm. Our observations
and mechanistic analysis of Hairy2
(Davis et al., 2001
) indicates
that in these genes, enhancers responsible for expression in differing
developmental contexts are spatially intermixed on very short genomic
stretches rather than being entirely separable on dispersed elements.
Mesodermal Esr10 expression could also require combinatorial input
from bHLH factors and Notch. Data reported here indicates that tailbud
Esr10 expression is abolished in E-box mutants
(Fig. 6). We also observed
synergistic interaction of mesodermal bHLH proteins with ICD in luciferase
assays (E.L. and C.K., unpublished). Alternatively, E-box/Su(H)/Notch
interactions may be required for cyclic transcription of Esr10. In
either case, combinatorial interactions required for mesodermal Esr10
transcription could have been co-opted in neural contexts. Those same
interactions would not be necessary for genes such as Esr1, which are
expressed in a predominantly neural context.
Alternatively, Esr genes could play different roles in lateral inhibition.
Direct regulation of E(spl) genes by bHLH proteins is counterintuitive, given
that for a cell to be inhibited from adopting any fate requires downregulation
of factors regulating that fate (Heitzler
et al., 1996
). Therefore a different subset of Notch effectors
(such as Esr10) might be required to initiate an inhibited state,
while others (such as Esr1) could maintain it. Such a scenario is
analogous to the apparent sufficiency of low levels of bHLH activators to
broadly upregulate Delta prior to its restriction to selected cells
(Kooh et al., 1993
;
Karp and Greenwald, 2003
).
Support for this hypothesis will require a single-cell comparison of
Esr1 and Esr10 expression at high temporal resolution during
the process of lateral inhibition, a challenging problem technically.
Nonetheless, we observe differences in how Esr1 and Esr10
respond transcriptionally to both proneural and Notch input in transfection
assays (Fig. 6) and in animal
cap assays (Fig. 2). Further
analysis of these differences and how these enhancers are tuned to respond to
Notch will be important for ultimately understanding their function during
neurogenesis and segmentation.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Amaya, E. and Kroll, K. L. (1999). A method for generating transgenic frog embryos. Methods Mol. Biol. 97,393 -414.[Medline]
Bailey, A. and Posakony, J. W. (1995).
Suppressor of Hairless directly activates transcription of Enhancer of
split Complex genes in response to Notch receptor activity.
Genes Dev. 9,2609
-2622.
Barolo, S. and Posakony, J. W. (2002). Three
habits of highly effective signaling pathways: principles of transcriptional
control by developmental cell signaling. Genes Dev.
16,1167
-1181.
Cau, E., Casarosa, S. and Guillemot, F. (2002). Mash1 and Ngn1 control distinct steps of determination and differentiation in the olfactory sensory neuron lineage. Development 129,1871 -1880.
Cave, J. W., Loh, F., Surpris, J. W., Xia, L. and Caudy, M. A. (2005). A DNA transcription code for cell-specific gene activation by notch signaling. Curr. Biol. 15, 94-104.[CrossRef][Medline]
Chitnis, A., Henrique, D., Lewis, J., Ish-Horowicz, D. and Kintner, C. (1995). Primary neurogenesis in Xenopus embryos regulated by a homologue of the Drosophila neurogenic gene Delta. Nature 375,761 -766.[CrossRef][Medline]
Cooper, M. T. D., Tyler, D. M., Furriols, M., Chaldiadaki, A., Delidakis, C. and Bray, S. (2000). Spatially restricted factors cooperate with Notch in the regulation of Enhancer of split genes. Dev. Biol. 221,390 -403.[CrossRef][Medline]
Davis, R. L. and Turner, D. L. (2001). Vertebrate hairy and Enhancer of split related proteins: transcriptional repressors regulating cellular differentiation and embryonic patterning. Oncogene 20,8342 -8357.[CrossRef][Medline]
Davis, R., Turner, D., Evans, L. and Kirschner, M. (2001). Molecular targets of vertebrate segmentation: two mechanisms control segmental expression of Xenopus hairy2 during somite formation. Dev. Cell 1, 553-565.[CrossRef][Medline]
Deblandre, G. A., Wettstein, D. A., Koyano-Nakagawa, N. and Kintner, C. (1999). A two-step mechanism generates the spacing pattern of the ciliated cells in the skin of Xenopus embryos. Development 126,4715 -4728.[Abstract]
Fior, R. and Henrique, D. (2005). A novel hes5/hes6 circuitry of negative regulation controls Notch activity during neurogenesis. Dev. Biol. 281,318 -333.[CrossRef][Medline]
Fisher, A. and Caudy, M. (1998). The function of hairy-related bHLH proteins in cell fate decisions. BioEssays 20,298 -306.[CrossRef][Medline]
Fryer, C. J., Lamar, E., Turbachova, I., Kintner, C. and Jones,
K. A. (2002). Mastermind mediates chromatin-specific
transcription and turnover of the Notch enhancer complex. Genes
Dev. 16,1397
-1411.
Furriols, M. and Bray, S. (2001). A model Notch response element detects Suppressor of Hairless-dependent molecular switch. Curr. Biol. 11,60 -64.[CrossRef][Medline]
Gajewski, M. and Voolstra, C. (2002). Comparative analysis of somitogenesis related genes of the hairy/Enhancer of split class in Fugu and zebrafish. BMC Genomics 3, 21.[CrossRef][Medline]
Gawantka, V., Pollet, N., Delius, H., Vingron, M., Pfister, R., Nitsch, R., Blumenstock, C. and Niehrs, C. (1998). Gene expression screening in Xenopus identifies molecular pathways, predicts gene function and provides a global view of embryonic patterning. Mech. Dev. 77,95 -141.[CrossRef][Medline]
Glavic, A., Silva, F., Aybar, M. J., Bastidas, F. and Mayor, R. (2003). Interplay between Notch signaling and the homeoprotein Xiro1 is required for neural crest induction in Xenopus embryos. Development 131,347 -359.
Harland, R. (1991). In situ hybridization: an improved whole-mount method for Xenopus embryos. In Methods in Cell Biology, Vol.36 (ed. B. K. Kay and H. B. Peng), pp.685 -695. San Diego. CA: Academic Press.[Medline]
Hatakeyama, J., Bessho, Y., Katoh, K., Ookawara, S., Fujioka,
M., Guillemot, F. and Kageyama, R. (2004). Hes genes regulate
size, shape and histogenesis of the nervous system by control of the timing of
neural stem cell differentiation. Development
131,5539
-5550.
Heitzler, P. and Simpson, P. (1991). The choice of cell fate in the epidermis of Drosophila. Cell 64,1083 -1092.[CrossRef][Medline]
Heitzler, P., Bourouis, M., Ruel, C., Carteret, C. and Simpson, P. (1996). Genes of the Enhancer of split and achaete-scute complexes are required for a regulatory loop between Notch and Delta during lateral signalling in Drosophila. Development 122,161 -171.[Abstract]
Hutcheson, D. A., Hanson, M., Moore, K. B., Le, T., Brown, N.
and Vetter, M. L. (2005). bHLH-dependent and -independent
modes of Ath5 gene regulation during retinal development.
Development 132,829
-839.
Ishibashi, M., Ang, S.-L., Shiota, K., Nakanishi, S., Kageyama,
R. and Guillemot, F. (1995). Targeted disruption of mammalian
hairy and Enhancer of split homolog-1 (HES-1) leads
to up-regulation of neural helix-loop-helix factors, premature neurogenesis,
and severe neural tube defects. Genes Dev.
9,3136
-3148.
Jarriault, S., Brou, C., Logeat, F., Schroeter, E. H., Kopan, R. and Israel, A. (1995). Signalling downstream of activated mammalian Notch. Nature 377,355 -358.[CrossRef][Medline]
Jen, W. C., Wettstein, D., Turner, D., Chitnis, A. and Kintner, C. (1997). The Notch ligand, X-Delta-2, mediates segmentation of the paraxial mesoderm in Xenopus embryos. Development 124,1169 -1178.[Abstract]
Jouve, C., Palmeirim, I., Henrique, D., Beckers, J., Gossler, A., Ish-Horowicz, D. and Pourquie, O. (2000). Notch signalling is required for cyclic expression of the hairy-like gene HES1 in the presomitic mesoderm. Development 127,1421 -1429.[Abstract]
Kan, L., Israsena, N., Zhang, Z., Hu, M., Zhao, L. R., Jalali, A., Sahni, V. and Kessler, J. A. (2004). Sox1 acts through multiple independent pathways to promote neurogenesis. Dev. Biol. 269,580 -594.[CrossRef][Medline]
Karp, X. and Greenwald, I. (2003). Post
transcriptional regulation of the E/Daughterless ortholog HLH-2, negative
feedback, and birth order bias during AC/VU decision in C. elegans.
Genes Dev. 17,3100
-3111.
Kintner, C. (2003). Notch signaling in vertebrate development. In Handbook of Cell Signaling, pp. 813-826. San Diego, CA: Elsevier.
Knust, E., Schrons, H., Grawe, F. and Campos-Ortega, J. A. (1992). Seven genes of the Enhancer of split complex of Drosophila melanogaster encode helix-loop-helix proteins. Genetics 132,505 -518.[Abstract]
Kooh, P., Fehon, R. G. and Muskavitch, M. (1993). Implication of dynamic patterns of Delta and Notch expression for cellular interactions during Drosophila development. Development 117,493 -507.[Abstract]
Koyano-Nakagawa, N., Wettstein, D. and Kintner, C. (1999). Activation of Xenopus genes required for lateral inhibition and neuronal differentiation during primary neurogenesis. Mol. Cell. Neurosci. 14,327 -339.[CrossRef][Medline]
Koyano-Nakagawa, N., Kim, J., Anderson, D. and Kintner, C. (2000). Hes6 acts in a positive feedback loop with the neurogenins to promote neuronal differentiation. Development 127,4203 -4216.[Abstract]
Kramatschek, B. and Campos-Ortega, J. A. (1994). Neuroectodermal transcription of the Drosophila neurogenic genes E(spl) and HLH-m5 is regulated by proneural genes. Development 120,815 -826.[Abstract]
Kunisch, M., Haenlin, M. and Campos-Ortega, J. A.
(1994). Lateral inhibition mediated by the Drosophila
neurogenic gene delta is enhanced by proneural proteins. Proc.
Natl. Acad. Sci. USA 91,10139
-10143.
Lamar, E. and Kintner, C. (2003). Transcriptional activity of Notch and CSL proteins. In Handbook of Cell Signaling, pp. 149-159. San Diego, CA: Elsevier.
Lamar, E., Deblandre, G., Wettstein, D., Gawantka, V., Pollet,
N., Niehrs, C. and Kintner, C. (2001). Nrarp is a novel
ikntracellular component of the Notch signaling pathway. Genes
Dev. 15,1885
-1899.
Lee, S.-K. and Pfaff, S. L. (2003). Synchronization of neurogenesis and motor neuron specification by direct coupling of bHLH and homeodomain transcription factors. Neuron 38,731 -745.[CrossRef][Medline]
Li, Y., Fenger, U., Niehrs, C. and Pollet, N. (2003). Cyclic expression of esr9 gene in Xenopus presomitic mesoderm. Differentiation 71, 83-89.[CrossRef][Medline]
Ling, P., Hsieh, J., Ruf, D., Rawlins, D. and Hayward, S. D.
(1994). EBNA-2 upregulation of Epstein-Barr virus latency
promoters and the cellular CD23 promoter utilizes a common targeting
intermediate, CBF1. J. Virol.
68,5375
-5383.
Ma, Q., Kintner, C. and Anderson, D. J. (1996). Identification of neurogenin, a vertebrate neuronal determination gene. Cell 87,43 -52.[CrossRef][Medline]
Moreno, T. A. and Kintner, C. (2004). Regulation of segmental patterning by retinoic acid signaling during Xenopus somitogenesis. Dev. Cell 6, 205-218.[CrossRef][Medline]
Mui, S. H., Kim, J. W., Lemke, G. and Bertuzzi, S.
(2005). Vax genes ventralize the eye. Genes
Dev. 19,1249
-1259.
Nellesen, D. T., Lai, E. C. and Posakony, J. W. (1999). Discrete enhancer elements mediate selective responsiveness of Enhancer of split complex genes to common transcriptional activators. Dev. Biol. 213, 33-53.[CrossRef][Medline]
Nieuwkoop, P. D. and Faber, J. (1967).Normal Table of Xenopus laevis . Amsterdam, The Netherlands: North Holland.
Ohsako, S., Hyer, J., Panganiban, G., Oliver, I. and Caudy,
M. (1994). Hairy function as a DNA-binding helix-loop-helix
repressor of Drosophila sensory organ formation. Genes
Dev. 8,2743
-2755.
Ohtsuka, T., Ishibashi, M., Gradwohl, G., Nakanishi, S., Guillemot, F. and Kageyama, R. (1999). Hes1 and Hes5 as notch effectors in mammalian neuronal differentiation. EMBO J. 18,2196 -2207.[CrossRef][Medline]
Papalopulu, N. and Kintner, C. (1996). A posteriorising factor, retinoic acid, reveals that anteroposterior patterning controls the timing of neuronal differentiation in Xenopus neurectoderm. Development 122,3409 -3418.[Abstract]
Petcherski, A. and Kimble, J. (2000). LAG-3 is a putative transcriptional activator in the C. elegans Notch pathway. Nature 405,364 -368.[CrossRef][Medline]
Powell, L. M., Zur Lage, P. I., Prentice, D. R., Senthinathan,
B. and Jarman, A. P. (2004). The proneural proteins Atonal
and Scute regulate neural target genes through different E-box binding sites.
Mol. Cell. Biol. 24,9517
-9526.
Reeves, N. and Posakony, J. W. (2005). Genetic programs activated by proneural proteins in the developing Drosophila PNS. Dev. Cell 8,413 -425.[CrossRef][Medline]
Sasai, Y., Kageyama, R., Tagawa, Y., Shigemoto, R. and
Nakanishi, S. (1992). Two mammalian helix-loop-helix factors
structurally related to Drosophila hairy and Enhancer of
split. Genes Dev.
6,2620
-2634.
Seydoux, G. and Greenwald, I. (1989). Cell autonomy of lin-12 function in a cell fate decision in C. elegans. Cell 57,1237 -1245.[CrossRef][Medline]
Sparrow, D., Latinkic, B. and Mohun, T. (2000). A simplified method of generating transgenic Xenopus. Nucleic Acids Res. 28,E12 .
Stancheva, I., Collins, A. L., Van den Veyver, I. B., Zoghbi, H. and Meehan, R. R. (2003). A mutant form of MeCP2 protein associated with human Rett syndrome cannot be displaced from methylated DNA by notch in Xenopus embryos. Mol. Cell 12,425 -435.[CrossRef][Medline]
Takebayashi, K., Sasai, Y., Sakai, Y., Watanabe, T., Nakanishi,
S. and Kageyama, R. (1994). Structure, chromosomal locus, and
promoter analysis of the gene encoding the mouse helix-loop-helix factor
HES-1. J. Biol. Chem.
269,5150
-5156.
Takke, C., Dornseifer, P., V Weizacker, E. and Campos-Ortega, J. A. (1999). her4, a zebrafish homologue of the Drosophila neurogenic gene E(spl), is a target of NOTCH signalling. Development 126,1811 -1821.[Abstract]
Tsuji, S., Cho, K. W. and Hashimoto, C. (2003). Expression pattern of a basic helix-loop-helix transcription factor Xhairy2b during Xenopus laevis development. Dev. Genes Evol. 213,407 -411.[CrossRef][Medline]
Tun, T., Hamaguchi, Y., Matsunami, N., Furukawa, T., Honjo, T.
and Kawaichi, M. (1994). Recognition sequence of a highly
conserved DNA binding protein RBP-Jk. Nucleic Acids
Res. 22,965
-971.
Turner, D. L. and Weintraub, H. (1994).
Expression of achaete-scute homolog 3 in Xenopus embryos
converts ectodermal cells to a neural fate. Genes Dev.
8,1434
-1447.
Van Doren, M., Ellis, H. M. and Posakony, J. W. (1991). The Drosophila extramacrochaetae protein antagonizes sequence-specific DNA binding by daughterless/achaete-scute protein complexes. Development 113,245 -255.[Abstract]
Van Doren, M., Powell, P., Pasternak, D., Singson, A. and
Posakony, J. W. (1992). Spatial regulation of proneural gene
activity: Auto- and cross-activation of achaete is antagonized by
extramacrochaetae. Genes Dev.
6,2592
-2605.
Wettstein, D., Turner, D. and Kintner, C. (1997). The Xenopus homolog of Drosophila Suppressor of Hairless mediates Notch signaling during primary neurogenesis. Development 124,3693 -3702.[Abstract]
Yutzey, K. E. and Konieczny, S. F. (1992).
Different E-box regulatory sequences are functionally distinct when placed
within the context of the troponin I enhancer. Nucleic Acids
Res. 20,5105
-5113.
This article has been cited by other articles:
![]() |
R. Blewitt Enhancer of split-related-2 mRNA shows cyclic expression during somitogenesis in Xenopus laevis Bioscience Horizons, March 1, 2009; 2(1): 22 - 31. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Nam, P. Sliz, W. S. Pear, J. C. Aster, and S. C. Blacklow Cooperative assembly of higher-order Notch complexes functions as a switch to induce transcription PNAS, February 13, 2007; 104(7): 2103 - 2108. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Solter, M. Locker, S. Boy, V. Taelman, E. J. Bellefroid, M. Perron, and T. Pieler Characterization and function of the bHLH-O protein XHes2: insight into the mechanisms controlling retinal cell fate decision Development, October 15, 2006; 133(20): 4097 - 4108. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Stubbs, L. Davidson, R. Keller, and C. Kintner Radial intercalation of ciliated cells during Xenopus skin development Development, July 1, 2006; 133(13): 2507 - 2515. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||