|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online August 2, 2005
doi: 10.1242/10.1242/dev.01936


1 Department of Developmental and Cell Biology, University of California, 5438
McGaugh Hall, Irvine, CA 92697-2300, USA
2 Zebrafish Neurogenetics Junior Research Group, Institute of Virology,
Technical University-Munich, Trogerstrasse 4b, D-81675 Munich, Germany
3 GSF-National Research Center for Environment and Health, Institute of
Developmental Genetics, Ingolstaedter Landstrasse 1, D-85764 Neuherberg,
Germany
Author for correspondence (e-mail:
tschilli{at}uci.edu)
Accepted 13 June 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Epibranchial, Placode, Zebrafish, Neural crest, Endoderm, Pharyngeal arches, Pharyngeal pouches, BMP, Segmentation
| Introduction |
|---|
|
|
|---|
Neurogenic placodes can be split into two groups, dorsolateral (trigeminal
and vestibular) and epibranchial (including the facial or geniculate, VII;
glossopharyngeal or petrosal, IX; vagal or nodose, X), which innervate taste
buds, the heart and other visceral organs. Neural progenitors within the
placodes are first specified by the expression of the basic helix-loop-helix
(bHLH) transcription factors neurogenin 1 (ngn1;
neurog1 Zebrafish Information Network), neurogenin 2
(ngn2; neurog3 Zebrafish Information Network) and
neurod (Sommer et al.,
1996
; Anderson,
1999
; Andermann et al.,
2002
; Begbie et al.,
2002
). Distinct subsets of placodes express these factors in
different species (Schlosser and
Northcutt, 2000
), and each is required at an early stage in the
specification of neural progenitors. Targeted inactivation of Ngn2
specifically disrupts epibranchials (Fode
et al., 1998
), while Ngn1 is required in dorsolateral
placodes in mice (Ma et al.,
1998
), and in all neurogenic placodes in zebrafish
(Andermann et al., 2002
),
further suggesting that separate mechanisms control dorsolateral and
epibranchial development. The paired homeodomain transcription factors
Phox2a and Phox2b are also required for epibranchial
differentiation and survival (Tiveron et
al., 1996
; Valarche et al.,
1993
). Thus placodes are distinguished by unique patterns of
neurogenesis, and these may reflect their responses to different signals.
Pharyngeal pouches in the endoderm are thought to induce neurogenesis in
the epibranchial placodes through expression of bone morphogenetic protein 7
(BMP7), a member of the transforming growth factor beta (TGFß)
superfamily (Begbie et al.,
1999
; Luo et al.,
1995
). Both endoderm and exogenous BMP7 protein can induce neural
progenitors in ectodermal explants in culture. Once epibranchial sensory
neurons have established their axonal connections, their survival depends upon
glial-derived neurotrophic factor (GDNF), which is also a member of the
TGFß superfamily (Buj-Bello et al.,
1995
). By contrast, a signal from the prospective
midbrain-hindbrain boundary (MHB), possibly a fibroblast growth factor (FGF)
is thought to induce the trigeminal (Stark
et al., 1997
; Baker et al.,
1999
), and the otic placode depends on FGF signaling from the
hindbrain (Phillips et al.,
2001
). These studies suggest that epibranchial and dorsolateral
placodes are induced by different signals depending on their proximity to the
endoderm or neural tube.
Pharyngeal endoderm also physically interacts with neural crest mesenchyme
that forms cartilage and bone, and promotes skeletal differentiation
(Hall, 1980
;
Le Douarin, 1982
). Recent
evidence suggests that, in this context, the endoderm plays an instructive
role in anteroposterior (AP) patterning, as removing and reinserting the
pharyngeal endoderm in a reversed AP orientation can cause mandibular
duplications (Couly et al.,
2002
). Zebrafish casanova (cas; sox32
Zebrafish Information Network)
(Kikuchi et al., 2000
;
Dickmeis et al., 2001
)
mutants, which lack all endoderm, fail to form pharyngeal cartilages due to a
lack of local cartilage-inducing signals
(David et al., 2002
). The
pharyngeal pouches appear to play a crucial role in this interaction, because
in van gogh (vgo; tbx1 Zebrafish
Information Network) mutants, as well as mutants that lack integrin alpha
5 function, defects in pouch formation correlate with subsequent
cartilage malformations (Piotrowski and
Nusslein-Volhard, 2000
;
Piotrowski et al., 2003
;
Crump et al., 2004a
). The
primary defect in all of these cases lies in the endoderm, as reintroduction
of endodermal cells into mutants rescues cartilage formation and pharyngeal
patterning.
Here, we report that the pharyngeal endoderm is required for the induction of the epibranchial nervous system in zebrafish, and that BMPs play an important role in this process. The sequential formation of pharyngeal pouches correlates precisely with the onset of neurogenesis in the epibranchial placodes, which we show by following endodermal morphogenesis in the living embryo. Mutants that disrupt pouch formation, such as cas and vgo, have corresponding defects in epibranchial, but not dorsolateral, placodes. We further show that the reintroduction of wild-type endoderm can rescue epibranchial development in cas mutants. Several lines of evidence suggest that this interaction depends on BMP signaling, including endoderm-specific inhibition of BMPs, as well as exogenous application of BMP proteins or BMP inhibitors. These are the first studies to show that the endoderm is required to induce neurogenesis in epibranchial placodes (but not dorsolateral placodes) in vivo, and that BMPs other than BMP7 are involved. In addition, they go beyond previous work in demonstrating that endodermal segmentation (pouch formation) controls the spatial patterning of sensory neurogenesis in the embryo.
| Materials and methods |
|---|
|
|
|---|
Transgenics
A fragment containing 700 bp of her5 upstream sequence driving
egfp (0.7her5:egfp) was obtained by PCR from a larger
construct containing 3650 bp (her5PAC:egfp), as described previously
(Tallafuss and Bally-Cuif,
2003
). This was purified and injected as a linear fragment into
fertilized eggs at the one-cell stage at a concentration of 50 ng/µl.
Embryos were then raised to adulthood and mated with wild-type adults. F1
embryos expressing egfp were identified and mated with wild types to
establish the transgenic lines. Homozygous her5:egfp transgenic fish
were then generated in natural matings, and expression verified over at least
three generations.
Confocal imaging
For analysis of pouch formation, pharyngeal endoderm was labeled by the
her5:egfp transgene starting at 14-15 hpf. Transgenic embryos were
manually dechorionated and anesthetized with ethyl-m-aminobenzoate methane
sulfanate (Westerfield, 1995
),
transferred to 0.5% agarose in embryo medium and then mounted on a coverslip.
Approximately 80 µm Z-stacks at 6 µm intervals were captured using a
Zeiss LSM510 Meta confocal fluorescence microscope.
Cell transplantation
Cell transplantations were targeted to the endoderm using either an
injection of mRNA encoding the activated Taram-A receptor (tar*), as
previously described (Aoki et al.,
2002a
; Aoki et al.,
2002b
; David et al.,
2002
), or cas (sox32) mRNA
(Dickmeis et al., 2001
).
Briefly, wild-type donor embryos were injected at the one-cell stage with a
mixture of 2% tetramethylrhodamine-isothiocyanate dextran and 3%
lysine-fixable biotin dextran (10,000 Mr, Molecular
Probes) together with 1 ng cas or 1 pg tar* RNA (cas/dextran
or tar*/dextran, respectively). At late blastula stages, cells from these
RNA-injected donors were transplanted to the margins of wild-type or
cas mutant hosts. The resulting mosaic embryos were selected using a
Leica fluorescence stereomicroscope for those containing large numbers of
transplanted cells in the pharyngeal endoderm. Such transplants were typically
restricted to one side of the pharynx or to individual pouches, with the
contralateral side serving as a control and allowing the identification of
rescued cas mutants.
Morpholino studies
Morpholino oligomers targeted to the translation start sites of bmp2b,
bmp7 (Imai and Talbot,
2002
) and bmp5 (GenBank #NM 201051
CCACAGAAGTTCCAAATGTTCTCAT) were obtained from Gene Tools, diluted in
1xDanieau's buffer and injected together with the tar*/dextran or
cas/dextran mixtures. Volumes injected were calculated for each
microinjection needle at a particular injection pressure, using a micrometer
imprinted on a glass slide to measure the diameter of a droplet produced at
its tip with a single injection pulse. Amounts injected per embryo were then
chosen for each morpholino that phenocopied loss-of-function mutations: 300 pg
of bmp2b MO phenocopies swirl mutants; 900 pg of
bmp7 MO phenocopies snailhouse mutants
(Imai and Talbot, 2002
). For
bmp5, we found that 1 ng of the bmp5-MO caused a slight
reduction in head size, but otherwise no clear phenotype on its own, but
effectively reduced epibranchials when injected into endoderm. A similar
result was obtained using a second, non-overlapping bmp5-MO.
Bead implantation
Human recombinant BMP4, BMP5, BMP7 and Noggin proteins (R&D Systems)
were used for bead implantation experiments. CM-Affi-Gel Blue beads (diameter:
70-100 µm, Bio-Rad) were incubated in each protein solution (BMPs, 1-10
µg/ml; NOGGIN, 100-500 µg/ml) at 4°C for 1 hour. Using a tungsten
needle, a small slit was made anterior to the otic vesicle on one side of the
head at 20 hpf. A protein-coated bead was inserted into the hole, and
positioned beneath the ectoderm. Embryos were raised to 48 hpf, and fixed for
phox2b analysis by in situ hybridization. As controls, we used beads
coated in 1% BSA-PBS.
Histology
In situ hybridization was carried out as described previously
(Thisse et al., 1993
). Probes
used were: bmp2a, bmp2b and bmp4
(Martinez-Barbera et al.,
1997
), bmp7 (Dick et
al., 2000
), neurod
(Korzh et al., 1998
),
foxi1 (Nissen et al.,
2003
; Solomon et al.,
2003
) and phox2a (Guo
et al., 1999
). A cDNA encoding bmp5 was isolated from a
gridded zebrafish pharyngula-stage (24 hpf) library using human BMP7 as a
probe, cloned into the pSPORT vector. To generate a bmp5 probe for in
situ hybridization, we linearized with EcoRI and transcribed with
SP6. To generate a probe specific for phox2b expression, we amplified
by RT-PCR the complete coding sequence of zebrafish phox2b (GenBank
#AY166856), using primers designed from phox2b genomic sequence
(Sanger Centre, Hinxton, UK). The PCR product was cloned into the pBS-KS
vector and verified by sequencing. To generate the probe containing the
phox2b complete coding sequence, we linearized with Kpn1 and
transcribed with T3 polymerase.
Immunolabeling with the anti-Hu and Zn-8 antibodies was done as described
previously (Marusich et al.,
1994
; Trevarrow et al.,
1990
). After incubation in the primary antibodies, embryos were
incubated with biotin-conjugated secondary antibodies using the Vectastain
Kit, following the manufacturers instructions. For double staining, standard
in situ hybridization was followed by three washes for 5 minutes each in 0.1 M
glycine buffer (pH 2) before proceeding with immunohistochemistry.
For sectioning, embryos labeled by in situ hybridization or immunohistochemistry were embedded in 1 ml of gelatin-albumin (0.025 g gelatin, 1.3 g BSA, 0.9 g saccharose, in 4.5 ml PBS) for 1 hour at room temperature. This mixture was then replaced with 1 ml of gelatine-albumin + 35 µl of 50% gluteraldehyde. The embedding mixture was allowed to harden overnight at 4°C. Sections were cut at 10-20 µm with a vibratome (VT1000S, Leica), and mounted in Glyergel (Dako).
| Results |
|---|
|
|
|---|
-Hu) antibody
(Fig. 1A,B) (Raible and Kruse,
2000). By 48 hpf, all six epibranchial ganglia have formed and enlarged
dramatically (Fig. 1C,D). To
examine the sequence of neuronal maturation in these ganglia more precisely,
we performed double staining with in situ hybridization for neurod or
phox2b combined with anti-Hu immunohistochemistry. We found that
although neurod and Hu are co-expressed in dorsolateral placodes
(trigeminal, auditory, vestibular, lateral line;
Fig. 1A), they only partially
overlap in the emerging glossopharyngeal/petrosal (gIX) and vagal/nodose
(gX1-4) ganglia. Distal cells within each ganglion express
neurod, whereas more proximal cells express Hu, and this pattern
persists at 48 and 72 hpf, suggesting that neuroblasts are generated distally
and become displaced proximally as they mature
(Fig. 1C,C',E).
Consistent with this hypothesis, phox2b mRNA and Hu antigen
co-localize in proximal cells in each epibranchial ganglion
(Fig. 1D,D',F). Based on
these studies, we can define three distinct cell populations within an
epibranchial ganglion in a distal to proximal order: (1) distal cells
expressing neurod alone; (2) intermediate cells expressing Hu
antigen, phox2a, phox2b and neurod; and (3) proximal cells
expressing Hu, phox2a and phox2b, but not neurod.
Thus, newly generated neurod+ neural progenitors are born directly
adjacent to the dorsal ends of the pharyngeal pouches, and then downregulate
neurod and express phox2b as they mature within the ganglion
and are displaced proximally (Fig.
1G). Labeling of placodal cells in the chick has demonstrated a
similar proximal displacement (Begbie and
Graham, 2001
|
To correlate the time at which a pouch contacts the ectoderm more directly with the specification of neural progenitors in the adjacent placode, pouches were imaged with confocal microscopy in individual her5:egfp transgenic embryos, and then immediately fixed and analyzed for neurod expression by in situ hybridization (Fig. 2H,J). In most cases (17/20) the number of neurod+ ganglia closely matched the number of fully formed pouches. This suggests that neurogenesis in the ectoderm occurs within a few hours of endodermal contact, consistent with a direct interaction.
Defects in epibranchial development in endodermal mutants
Pharyngeal endoderm promotes neurogenesis in ectodermal explants
(Begbie et al., 1999
) but
whether or not it is required in vivo remains unclear. Thus, we examined
markers of epibranchial neurons in casanova (cas, sox23) and
van gogh (vgo, tbx1) mutants, which are defective in
endoderm. cas mutants lack all endoderm at 48 hpf, including the
pharyngeal endoderm, as shown by immunolabeling with the zn-8 antibody, which
recognizes DM-GRASP (Fig.
3A,B). To determine whether epibranchial sensory neurons
differentiate in the absence of endoderm we used the
-Hu antibody.
cas mutants also lack virtually the entire epibranchial nervous
system at 48 hpf, including gVII, gIX and the distal portions of
gX1-4 (Fig. 3C,D).
Consistent with a defect in placodal neurogenesis, mutants also lacked any
expression of neurod or phox2b in these ganglia
(Fig. 3E,F). By contrast,
neurons derived from dorsolateral placodes, including the trigeminal (gV) and
posterior lateral line (gP) ganglia, as well as the proximal portion of the
vagal (gX), appeared to be unaffected in cas mutants, and some
additional scattered Hu-immunoreactive cells were detected ventral to gP
(Fig. 3D). To determine whether
earlier placodal specification is disrupted in cas mutants, we
analyzed expression of foxi1, which marks the placodal field during
somitogenesis (Fig. 6)
(Lee et al., 2003
;
Nissen et al., 2003
;
Solomon et al., 2003
). No
defects were detected in embryos derived from cas+/
heterozygotes at 20 hpf (Fig.
6A,B; n=50), but, by 48 hpf, foxi1 expression
was no longer detected in either the epibranchials or in the pouches in
cas/ mutants
(Fig. 6C,D). These results
suggest that endoderm is required specifically for neurogenesis in
epibranchial, and not dorsolateral, placodes.
|
|
Restoration of endoderm rescues cranial ganglia in cas mutants
Wild-type cells can form endoderm when transplanted into a cas
mutant, because cas acts downstream of Nodal signaling
(Aoki et al., 2002a
;
Aoki et al., 2002b
). Using this
approach, we tested whether the reintroduction of endoderm into cas
mutants was sufficient to restore epibranchial formation. Cells transplanted
into the blastula margin in zebrafish contribute to the mesodermal layer, but
rarely to the endoderm. However, we can drive cells into the endoderm and
rescue the formation of pouches by injecting the donors with an activated form
of the Nodal receptor TaramA (tar*) (David
et al., 2002
). Injections of cas mRNA itself also drives
donor cells to the endoderm, demonstrating that this is not simply due to the
presence of tar* (Fig. 4B).
cas or tar* RNA was co-injected into wild-type donor embryos together
with rhodamine and biotin-conjugated dextrans (10,000 Mr;
Molecular Probes) as lineage tracers at the 1-cell stage, and cells were
transplanted at early blastula stages into host embryos derived from two
cas+/ heterozygotes
(Fig. 4A). We then analyzed
phox2b and neurod expression at 40 hpf and compared it with
the locations of grafted cells. Transplants of this type form clones of
endoderm in various positions, including the pouches
(Fig. 4 C-E). Injection of
cas or tar* alone caused no defects in epibranchial ganglia
(Fig. 4B; Fig. 7A).
Grafting of cas- or tar*-injected wild-type cells into cas mutant hosts efficiently restored phox2b (and neurod) expression in epibranchial placodes wherever endodermal cells formed pouches (Fig. 4C-E; 100%; n=29; Table 1). No rescue was observed when transplanted cells were located medially in the endoderm or outside of the pharynx. Confocal imaging of several grafts, revealed a close correlation between the organized movements of endodermal cells into pouches and the locations of phox2b+ cells, further suggesting that pouch formation in these mosaics is crucial for rescue. These results demonstrate that the restoration of endodermal pharyngeal pouches in cas mutant embryos rescues epibranchial development.
|
In addition, we identified a zebrafish bmp5 gene that has not been described previously and that is also expressed in the pouches (Fig. 5D,H). Amino acid identities of mature bmp5 are 84% to mouse and human BMP5, 67% to zebrafish bmp7, 74% to human BMP7, 54% to zebrafish bmp4, and 52% to bmp2a and bmp2b. Furthermore, bmp5 is not expressed during gastrula or early segmentation stages, unlike its close zebrafish relatives bmp2b and bmp7, which are required for early dorsoventral patterning. Expression is first detected in sensory patches within the otic placode, and in the pharyngeal region at 22 and 30 hpf (Fig. 5D,H). Pharyngeal expression of bmp5 includes both arch mesenchyme and pharyngeal pouches, with expression becoming restricted to the dorsal- and ventral-most pouches by 30-40 hpf (Fig. 5H,L).
Consistent with their endodermal defects, expression of all four BMP family members is reduced in cas mutants by 40 hpf (Fig. 5I-P). Expression is still present but the pattern is variably disorganized in vgo mutants (data not shown). Thus, several BMPs are expressed in the pouches at the appropriate place and time to influence epibranchial neurogenesis, and loss of expression correlates with epibranchial defects in mutants.
|
Therefore, to test more local requirements for BMPs in epibranchial
development, we blocked BMP signaling focally in the endoderm by co-injecting
cas or tar* mRNA and mRNA encoding the Xenopus form of the
BMP inhibitor noggin (nog)
(Smith and Harland, 1992
),
into wild-type donors and transplanting these cells into either wild-type or
cas mutant hosts. As a control for activity, we showed that injection
of 500 pg of nog mRNA at the one-cell stage was capable of
dorsalizing zebrafish embryos, and we used similar or slightly lower amounts
for co-injection with cas or tar* (hereafter referred to as
cas/nog or tar*/nog). Such nog-injected
transplanted cells contributed to pharyngeal pouches in equal numbers to cells
injected with cas or tar* alone, and were generally located on only
one side of the pharynx, leaving the contralateral side as an internal control
(see Fig. 4). We found that
cells co-expressing cas/nog or tar*/nog caused
reductions in the number of phox2b-expressing cells in adjacent
epibranchial ganglia on the same side in wild-type hosts at 48 hpf (37%,
n=26; Fig. 7B-D;
Table 1). Furthermore, similar
transplants into cas mutants were completely unable to rescue
epibranchial development, even when pharyngeal pouches were clearly restored
on the transplanted side (93%, n=15;
Fig. 7H,I; Table 1). These results
indicate that BMP signaling is required locally to specify the locations of
epibranchial placodes, and further suggest that the crucial source of the
signal is the endoderm.
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
|
Our results support those of Begbie et al.
(Begbie et al., 1999
), who
performed explant studies in chick and showed that Phox2b+ neural
progenitors form in ectodermal explants when co-cultured with endoderm in
collagen gels. From these studies, however, it remained unclear whether such
interactions occur in vivo, or are necessary for neurogenesis. We have used
genetic ablation and reintroduction of endoderm in zebrafish to demonstrate an
in vivo requirement. Whether or not this induction is direct, or requires an
intermediate signal via neighboring tissues remains unclear. However, the
close spatial proximity between pharyngeal pouches and epibranchial placodes
within an arch, as well as the coincidence between early epibranchial defects
in cas and vgo mutants, supports the idea of a direct signal
(Fig. 9). Because these
endodermal mutants only show defects in epibranchial and not dorsolateral
placodes, our results also support the model proposing that these two groups
of sensory neurons are induced by different signals
(Graham and Begbie, 2000
).
This would also help to explain the presence of additional placodes associated
with the ventral regions of the pouches in some species, such as the
hypobranchial ganglia in Xenopus
(Schlosser, 2003
).
To visualize this interaction between the pouches and placodes, we followed
the expression of her5:egfp in the pharyngeal endoderm in living
embryos (Tallafuss and Bally-Cuif,
2003
). Confocal time-lapse analysis of her5:egfp
expression revealed dramatic and rapid changes in endodermal cell shape during
pouch morphogenesis. Lateral endodermal cells of the pharynx align
mediolaterally to form pouches and extend filopodia toward the surface,
eventually contacting the overlying ectoderm. This contact occurs at almost
exactly the same stage at which we could detect the first signs of
epibranchial neurogenesis, with contact occurring a few hours prior to the
onset of neurod expression in most cases. These results further
reinforce the idea that pouches regulate both the spatial and temporal
formation of neural progenitors in the placodes. Consistent with this
hypothesis, we show that ectopic epibranchials in vgo mutants are
associated with abnormal extensions of pouches
(Piotrowski and Nusslein-Volhard,
2000
). In addition, ectopic neurod expression was induced
by endodermal transplants into cas mutants that formed ectopic
contacts with the ectoderm. These results indicate that a broader region of
pharyngeal ectoderm is competent to form placodal neurons, but only does so in
response to endoderm.
Epibranchial neurogenesis: neural crest versus placodes
Many cranial sensory ganglia have a dual embryonic origin from both neural
crest and placodes, in contrast to those of the trunk, which are purely crest
derived. Crest cells form the proximal epibranchial ganglia in chick, whereas
placodally derived cells lie further distally, and the proportions of these
differ in each ganglion (Ayer LeLievre and
LeDouarin, 1982
;
D'Amico-Martel and Noden,
1983
; Webb and Noden,
1993
). Placodally derived neurons differentiate early and
establish the first peripheral and central axonal projections of the sensory
nerves. Epibranchial neurons also are displaced inwards along neural crest
migratory pathways as they mature, and require the crest to establish their
appropriate innervation in the hindbrain
(Begbie and Graham, 2001
). Our
analyses of gene expression within the epibranchial ganglia in zebrafish
confirm that there is a similar proximodistal sequence of neurogenesis within
the placodally derived neurons in zebrafish, in which newborn neurod+
neurons form adjacent to the pharyngeal pouch and older phox2b and
Hu+ neurons lie further proximally (Fig.
8).
Both cas and vgo mutants disrupt distal neurogenesis in
the vagal ganglion complex (gX1-4), but retain a more proximal
population of neural progenitors that develops independently of endodermal
influences. These may be the neural crest-derived equivalent in fish of the
proximal nodose ganglion (gX) in chick. Consistent with this hypothesis,
proximal gX is less affected than other epibranchial ganglia in
Ngn2/
(Fode et al., 1998
) and
Phox2a/
(Morin et al., 1997
) mutant
mice, as well as in foxi1/ mutant zebrafish
(Lee et al., 2003
). Future
cell tracing studies are necessary to determine which portions of these
ganglia are derived from neural crest in zebrafish, but our previous lineage
studies suggest that at least some of the proximal neurons are crest derived
(Schilling and Kimmel, 1994
).
Our results suggest that these proximal epibranchial neurons are
BMP-independent or, alternatively, may be induced by BMPs from other sources,
such as the otic vesicle.
BMP signals are both necessary and sufficient for placode specification
We also show a requirement for BMP signaling in the control of epibranchial
neurogenesis, and specifically implicate bmp2b and bmp5 in
this process in zebrafish. This is based on several lines of evidence: (1)
bmp2b and bmp5 are expressed in the pouches as they form;
(2) targeted knockdown of bmp2b and bmp5 expression with
morpholinos specifically in the endoderm locally disrupts placode induction;
and (3) the BMP inhibitor NOGGIN locally disrupts epibranchial ganglia while
misexpression of BMP proteins using beads induces ectopic neurons. Begbie et
al. (Begbie et al., 1999
)
showed that Bmp7 in the chick is expressed in the pharyngeal endoderm
and that recombinant BMP7 protein was sufficient to induce neurogenesis in
ectodermal explants. They also found that Follistatin blocks the induction of
neurogenesis by endoderm in these cultures, further indicating a role for
TGFß signaling in this process. Our results are the first to demonstrate
a specific requirement for BMP signaling in vivo, and suggest that multiple
members of this family, including bmp2b and bmp5, are
essential.
Bmp4 (a close relative of bmp2b) and Bmp7 have
been implicated in many aspects of neurogenesis and peripheral nervous system
(PNS) development. For example, they mediate interactions between the neural
plate and epidermal ectoderm that induce neural crest cells, as well as
secondary sensory neurons within the spinal cord
(Liem et al., 1995
). Later,
the same two BMPs are secreted by the dorsal aorta and promote a subset of
adjacent neural crest cells to express Phox2a and to form sympathetic
neurons (Reissmann et al.,
1996
). Yet, Bmp4/ mutant mice
die prior to PNS formation and no PNS defects have been described in
Bmp7/ mutants. Our results may help to
explain this apparent discrepancy by showing that at least two BMPs,
bmp2b and bmp5, are partially redundant for this
process.
Other signaling molecules have been implicated in neurogenic placode
induction, and it is important to understand how their functions relate to
those of BMPs. Foremost among these are the FGFs. For example, signals from
the MHB (possibly FGF8) are thought to induce the trigeminal (gV), a
dorsolateral placode that we have shown does not require endodermal BMP
signals in zebrafish. FGF3 and FGF8 produced in the hindbrain are involved in
induction of the otic placode (Phillips et
al., 2001
), which also develops independently of endoderm. Both
fgf3 and fgf8 are expressed in both the pharyngeal endoderm
and ectoderm, and potentially act together with BMPs in epibranchial induction
(David et al., 2002
;
Crump et al., 2004b
). However,
in the chick Fgf8 is only expressed in a ventral, posterior domain
within each pouch, which abuts the domain of Bmp7 and is not in
contact with the placode (Graham and
Begbie, 2000
), suggesting that Fgf8 and Bmp7
interact to define territories of expression within the endoderm. Recent
evidence in zebrafish has implicated fgf3 in epibranchial development
(D. Raible, personal communication). Thus, it will be interesting to determine
whether Fgfs act synergistically with BMPs in this interaction, or if
different growth factors give qualitatively different responses in placodal
cells. BMP2 and FGF act synergistically to induce neuronal differentiation of
PC12 cells (Hayashi et al.,
2001
). The augmentation of FGF-induced differentiation by BMP2
occurs through the upregulation of FGFR1 several hours after BMP2 expression
(Hayashi et al., 2003
).
Similarly, BMPs might also commit epibranchial progenitor cells to neuronal
differentiation induced by FGFs. The combined actions of different growth
factors may underlie differences not only between types of placode (e.g. FGF
in dorsolaterals, BMP in epibranchials), but also in the specification of the
distinct types of neurons that form in each ganglion within a class
(Vogel and Davies, 1993
).
A central role for the endoderm in patterning head segments
Segmentation of the foregut into pouches is a fundamental feature of the
head and there is growing evidence that this plays a crucial patterning role.
The segmental characteristics of the pharyngeal pouches develop independently
of the presence of neural crest cells
(Veitch et al., 1999
).
Pharyngeal slits are also found in non-vertebrate chordates, such as
amphioxus, suggesting that their appearance predated that of placodes or
neural crest during evolution. The formation of pouches during embryogenesis
coincides with and affects the segmental development of many cell types within
the pharyngeal arches, including both neurogenic placodes and neural crest
(Begbie et al., 1999
;
LeDouarin, 1982
;
David et al., 2002
;
Couly et al., 2002
). Endoderm
may provide some guidance cues for neural crest migration; however, most
evidence suggests that it plays a more important role later, in local
interactions between pouches and immediately adjacent neural or skeletal
progenitors, and our results are consistent with this. The size, shape and
orientation of neural crest-derived cartilages are prefigured in the shapes of
certain pouches, both in fish (Crump et
al., 2004a
; Crump et al.,
2004b
) and in chick (Couly et
al., 2002
). Likewise, we have shown that the location and size of
epibranchial sensory ganglia are prefigured by contacts between pouches and
the surface ectoderm. Defects in these endoderm-dependent processes appear to
underlie human craniofacial malformations such as DiGeorge syndrome (often
caused by mutations in TBX1), and our results would suggest that some cranial
sensory nerve deficits in humans might also reflect defects in endoderm. Our
studies establish a genetic context in zebrafish in which to now examine how
these signals control sensory neurogenesis.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Present address: Institute of Neuroscience, 1254 University of Oregon,
Eugene, OR 97403-1254, USA ![]()
| REFERENCES |
|---|
|
|
|---|
Andermann, P., Ungos, J. and Raible, D. W.
(2002). Neurogenin1 defines zebrafish cranial sensory ganglia
precursors. Dev. Biol.
251, 45-58.[CrossRef][Medline]
Anderson, D. J. (1999). Lineages and
transcription factors in the specification of vertebrate primary sensory
neurons. Curr. Opin. Neurol.
9, 517-524.
Aoki, T., Mathieu, J., Saint-Etienne, L., Peyreiras, N. and
Rosa, F. (2002a). Regulation of Nodal signaling and
mesendoderm formation by TARAM-A, a TGFb-related type I receptor.
Dev. Biol. 241,273
-288.[CrossRef][Medline]
Aoki, T. O., David, N. B., Minchiotti, G., Saint-Etienne, L.,
Dickmeis, T., Persico, G. M., Strahle, U., Mourrain, P. and Rosa, F.
M. (2002b). Molecular integration of casanova in the
Nodal signalling pathway controlling endoderm formation.
Development 129,275
-286.
Ayer-LeLievre, C. S. and LeDouarin, N. M.
(1982). The early development of cranial sensory ganglia and the
potentialities of their component cells studied in quail-chick chimeras.
Dev. Biol. 94,291
-310.[CrossRef][Medline]
Baker, C. V. H. and Bronner-Fraser, M. (2001).
Vertebrate cranial placodes. I. Embryonic induction. Dev.
Biol. 232,1
-61.[CrossRef][Medline]
Baker, C. V., Stark, M. R., Marcelle, C. and Bronner-Fraser,
M. (1999). Competence, specification and induction of Pax-3
in the trigeminal placode. Development
126,147
-156.[Abstract]
Bally-Cuif, L., Goutel, C., Wassef, M., Wurst, W. and Rosa,
F. (2000). Coregulation of anterior and posterior
mesendodermal development by a hairy-related transcriptional repressor.
Genes Dev. 14,1664
-1677.
Begbie, J. and Graham, A. (2001). Integration
between the epibranchial placodes and the hindbrain.
Science 294,595
-598.
Begbie, J., Brunet, J. F., Rubenstein, J. and Graham, A.
(1999). Induction of the epibranchial placodes.
Development 126,895
-902.[Abstract]
Begbie, J., Ballivet, M. and Graham, A. (2002).
Early steps in the production of sensory neurons by the neurogenic placodes.
Mol. Cel. Neurosci. 21,502
-511.[CrossRef][Medline]
Buj-Bello, A., Buchman, V. L., Horton, A., Rosenthal, A. and
Davies, A. M. (1995). GDNF is an age-specific survival
factor for sensory and autonomic neurons. Neuron
15,821
-828.[CrossRef][Medline]
Couly, G., Creuzet, S., Bennaceur, S., Vincent, C. and Le
Douarin, N. M. (2002). Interactions between Hox-negative
cephalic neural crest cells and the foregut endoderm in patterning the facial
skeleton in the vertebrate head. Development
129,1061
-1073.
Crump, J. G., Swartz, M. E. and Kimmel, C. B.
(2004a). An integrin-dependent role of pouch endoderm in hyoid
cartilage development. PloS Biol.E244
.
Crump, J. G., Maves, L., Lawson, N. D., Weinstein, B. M. and
Kimmel, C. B. (2004b). An essential role for Fgfs in
endodermal pouch formation influences later craniofacial skeletal pattern.
Development 131,5703
-5716.
D'Amico-Martel, A. and Noden, D. M. (1983).
Contributions of placodal and neural crest cells to avian cranial peripheral
ganglia. Am. J. Anat.
166,445
-468.[CrossRef][Medline]
David, N. B., Saint-Etienne, L., Tsang, M., Schilling, T. F. and
Rosa, F. M. (2002). Requirement for endoderm and FGF3 in
ventral head skeleton formation. Development
129,4457
-4468.
Dick, A., Hild, M., Bauer, H., Imai, Y., Maifeld, H., Schier, A.
F., Talbot, W. S., Bouwmeester, T. and Hammerschmidt, M.
(2000). Essential role of Bmp7 (snailhouse) and its
prodomain in dorsoventral patterning of the zebrafish embryo.
Development 127,343
-354.[Abstract]
Dickmeis, T., Mourrain, P., Saint-Etienne, L., Fischer, N.,
Aanstad, P., Clark, M., Strahle, U. and Rosa, F.
(2001). A crucial component of the endoderm formation pathway,
CASANOVA, is encoded by a novel sox-related gene. Genes
Dev. 15,1487
-1492.
Fode, C., Gradwohl, G., Morin, X., Dierich, A., LeMeur, M.,
Goridis, C. and Guillemot, F. (1998). The bHLH protein
Neurogenin-2 is a determination factor for epibranchial placode-derived
sensory neurons. Neuron
20,483
-494.[CrossRef][Medline]
Goodrich, E. (1930). Studies on the
Structure and Development of Vertebrates. London: MacMillan
(Reprinted in 1958 by Dover Publications, New York and Constable,
London).
Graham, A. and Begbie, J. (2000). Neurogenic
placodes: a common front. Trends Neurosci.
23,313
-316.[CrossRef][Medline]
Guo, S., Brush, J., Teraoka, H., Goddard, A., Wilson, S. W.,
Mullins, M. C. and Rosenthal, A. (1999). Development
of noradrenergic neurons in the zebrafish hindbrain requires BMP, FGF8, and
the homeodomain protein soulless/Phox2a. Neuron
24,555
-566.[CrossRef][Medline]
Hall, B. K. (1980). Tissue interactions and the
initiation of osteogenesis and chondrogenesis in the neural crest-derived
mandibular skeleton of the embryonic mouse as seen in isolated murine tissues
and recombinations of murine and avian tissue. J. Embryol. Exp.
Morphol. 58,251
-264.[Medline]
Hayashi, H., Ishisaki, A., Suzuki, M. and Imamura, T.
(2001). BMP-2 augments FGF-induced differentiation of PC12 cells
through upregulation of FGF receptor-1 expression. J. Cell
Sci. 114,1387
-1395.[Abstract]
Hayashi, H., Ishisaki, A. and Imamura, T.
(2003). Smad mediates BMP-2-induced upregulation of FGF-evoked
PC12 cell differentiation. FEBS Lett.
536, 30-34.[CrossRef][Medline]
Imai, Y. and Talbot, W. S. (2002). Morpholino
phenocopies of the bmp2b/swirl and bmp7/snailhouse
mutations. Genesis 30,160
-163.
Kikuchi, Y., Agathon, A., Alexander, J., Thisse, C., Waldron,
S., Yelon, D., Thisse, B. and Stainier, D. Y. (2000).
Casanova encodes a novel Sox-related protein necessary and sufficient for
early endoderm formation in zebrafish. Genes Dev.
15,1493
-1505.
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and
Schilling, T. F. (1995). Stages of embryonic
development of the zebrafish. Dev. Dyn.
203,253
-310.[Medline]
Korzh, V., Sleptsova, I., Liao, J., He, J. and Gong, Z.
(1998). Expression of zebrafish bHLH genes ngn1 and nrd defines
distinct stages of neural differentiation. Dev. Dyn.
213,92
-104.[CrossRef][Medline]
Le Douarin, N. M. (1982). The Neural
Crest. Cambridge, UK: Cambridge University Press.
Lee, S. A., Shen, E. L., Fiser, A., Sali, A. and Guo, S.
(2003). The zebrafish forkhead transcription factor foxi1
specifies epibranchial placode-derived sensory neurons.
Development 130,2669
-2679.
Liem, K. F., Tremml, G., Roelink, H. and Jessell, T. M.
(1995). Dorsal differentiation of neural plate cells induced by
Bmp-mediated signals from the epidermal ectoderm. Cell
82,969
-979.[CrossRef][Medline]
Luo, G., Hofmann, C., Bronckers, A. L., Sohocki, M., Bradley, A.
and Karsenty, G. (1995). Bmp-7 is an inducer of
nephrogenesis, and is also required for eye development and skeletal
patterning. Genes Dev.
9,2808
-2820.
Ma, Q., Chen, Z., del Barco Barrantes, I., de la Pompa, J. L.
and Anderson D. J. (1998). Neurogenin-1 is essential
for the determination of neuronal precursors for proximal cranial sensory
ganglia. Neuron 20,469
-482.[CrossRef][Medline]
Martinez-Barbera, J. P., Toresson, H., Da Rocha, S. and Krauss,
S. (1997). Cloning and expression of three members of the
zebrafish Bmp family, bmp2a, bmp2b and bmp4. Gene
198, 53-59.[CrossRef][Medline]
Marusich, M. F., Furneaux, H. M., Henion, P. and Weston, J.
A. (1994). Hu neuronal proteins are expressed in
proliferating neurogenic cells. J. Neurobiol.
25,143
-155.[CrossRef][Medline]
Morin, X., Cremer, H., Hirsch, M. R., Kapur, R. P., Goridis, C.
and Brunet, J. F. (1997). Defects in sensory and
autonomic ganglia and absence of locus coeruleus in mice deficient for the
homeobox gene Phox2a. Neuron
18,411
-423.[CrossRef][Medline]
Nissen, R. M., Yan, J., Amsterdam, A., Hopkins, N. and Burgess,
S. M. (2003). Zebrafish foxi one modulates cellular response
to fgf signaling required for the integrity of ear and jaw patterning.
Development 130,2543
-2554.
Phillips, B. T., Bolding, K. and Riley, B. B.
(2001). Zebrafish fgf3 and fgf8 encode redundant functions for
otic placode formation. Dev. Biol.
235,351
-365.[CrossRef][Medline]
Piotrowski, T. and Nusslein-Volhard, C. (2000).
The endoderm plays an important role in patterning the segmented pharyngeal
region in zebrafish (Danio rerio). Dev. Biol.
225,339
-356.[CrossRef][Medline]
Piotrowski, T., Schilling, T. F., Brand, M., Jiang, Y. J.,
Heisenberg, C. P., Beuchle, D., Grandel, H., van Eeden, F. J.,
Furutani-Seiki, M., Granato, M. et al. (1996). Jaw and
branchial arch mutants in zebrafish. II. Anterior arches and cartilage
differentiation. Development
123,345
-356.[Abstract]
Piotrowski, T., Ahn, D., Schilling, T. F., Nair, S., Ruvinsky,
I., Geisler, R., Rauch, G.-J., Haffter, P., Zon, L. I., Zhou, Y. et
al. (2003). The zebrafish van gogh mutation disrupts
tbx1, which is involved in the DiGeorge deletion syndrome in humans.
Development 130,5043
-5052.
Reissmann, E., Ernsberger, U., Francis-West, P. H., Brickell, P.
D. and Rohrer, H. (1996). Involvement of bone
morphogenetic protein-4 and bone morphogenetic protein-7 in the
differentiation of the adrenergic phenotype in developing sympathetic neurons.
Development 122,2079
-2088.[Abstract]
Schilling, T. F. and Kimmel, C. B. (1994).
Segment and cell type lineage restrictions during pharyngeal arch development
in the zebrafish embryo. Development
120,483
-494.[Abstract]
Schlosser, G. (2003). Hypobranchial placodes in
Xenopus laevis give rise to hypobranchial ganglia, a novel type of cranial
ganglia. Cell Tissue Res.
312, 21-29.[Medline]
Schlosser, G. and Northcutt, R. G. (2000).
Development of neurogenic placodes in Xenopus laevis. J. Comp.
Neurol. 418,121
-146.[CrossRef][Medline]
Smith, W. C. and Harland, R. M. (1992).
Expression cloning of noggin, a new dorsalizing factor localized to the
Spemann organizer in Xenopus embryos. Cell
70,829
-840.[CrossRef][Medline]
Solomon, K. S., Kudoh, T., Dawid, I. G. and Fritz, A.
(2003). Zebrafish foxi1 mediates placode formation and jaw
development. Development
130,929
-940.
Sommer, L., Ma, Q. and Anderson, D. J. (1996).
Neurogenins, a novel family of atonal-related bHLH transcription factors, are
putative mammalian neuronal determination genes that reveal progenitor cell
heterogeneity in the developing CNS and PNS. Mol. Cell.
Neurosci. 8,221
-241.[CrossRef][Medline]
Stark, M. R., Sechrist, J., Bronner-Fraser, M. and Marcelle,
C. (1997). Neural tube-ectoderm interactions are required for
trigeminal placode formation. Development
124,4287
-4295.[Abstract]
Tallafuss, A. and Bally-Cuif, L. (2003).
Tracing of her5 progeny in zebrafish transgenics reveals the dynamics of
midbrain-hindbrain neurogenesis and maintenance.
Development 130,4307
-4323.
Thisse, C., Thisse, B., Schilling, T. F. and Postlethwait, J.
H. (1993). Structure of the zebrafish snail gene and its
expression in wild-type, spadetail and no tail mutant embryos.
Development 119,1203
-1215.[Abstract]
Tiveron, M. C., Hirsch, M. R. and Brunet, J. F.
(1996). The expression pattern of the transcription factor Phox2a
delineates synaptic pathways of the autonomic nervous system. J.
Neurosci. 16,7649
-7660.
Trevarrow, B., Marks, D. L. and Kimmel, C. B.
(1990). Organization of hindbrain segments in the zebrafish
embryo. Neuron 4,669
-679.[CrossRef][Medline]
Valarche, I., Tissier-Seta, J., Hirsch, M., Martinez, S.,
Goridis, C. and Brunet, J. F. (1993). The mouse
homeodomain protein Phox2 regulates Ncam promoter activity in concert with
Cucx/CDP and is a putative determinant of neurotransmitter phenotype.
Development 119,881
-896.
Veitch, E., Begbie, J., Schilling, T. F., Smith, M. M. and
Graham, A. (1999). Pharyngeal arch patterning in the absence
of neural crest. Curr. Biol.
9,1481
-1484.[CrossRef][Medline]
Vogel, K. S. and Davies, A. M. (1993).
Heterotopic transplantation of presumptive placodal ectoderm changes the fates
of sensory neuron precursors. Development
119,263
-276.[Abstract]
Webb, J. F. and Noden, D. M. (1993). Ectodermal
placodes: contributions to the development of the vertebrate head.
Amer. Zool. 33,434
-447.
Westerfield, M. (1995). The
Zebrafish Book. A Guide for the Laboratory Use of Zebrafish
(Danio rerio), 3rd edn. Eugene, OR: University of Oregon Press.
This article has been cited by other articles:
![]() |
S. Kuratani Is the vertebrate head segmented?--evolutionary and developmental considerations Integr. Comp. Biol., November 1, 2008; 48(5): 647 - 657. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Nechiporuk, T. Linbo, K. D. Poss, and D. W. Raible Specification of epibranchial placodes in zebrafish Development, February 1, 2007; 134(3): 611 - 623. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Pietsch, J.-M. Delalande, B. Jakaitis, J. D. Stensby, S. Dohle, W. S. Talbot, D. W. Raible, and I. T. Shepherd lessen encodes a zebrafish trap100 required for enteric nervous system development Development, February 1, 2006; 133(3): 395 - 406. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||