|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 14 July 2005
doi: 10.1242/dev.01935
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Cellular and Molecular Medicine, Glycobiology Research and
Training Center, University of California San Diego, 9500 Gilman Drive, La
Jolla, CA 92093-0687, USA
2 Department of General Zoology and Genetics, Westfälische
Wilhelms-Universität Münster, Schlossplatz 5, 48149 Münster,
Germany
3 The Burnham Institute, 10901 North Torrey Pines Road, La Jolla, CA 92037,
USA
* Author for correspondence (e-mail: kgrobe{at}uni-muenster.de)
Accepted 9 June 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Cerebral hypoplasia, Heparan sulfate, Fibroblast growth factor, Sonic hedgehog, Mouse development
| Introduction |
|---|
|
|
|---|
1,4
residues, and undergoes modification by one or more of the four Ndst isozymes,
which remove acetyl groups from subsets of GlcNAc residues and add sulfate to
the free amino groups. In vertebrates, Ndst1 and Ndst2 mRNA
are expressed in all embryonic and adult tissues examined, whereas
Ndst3 and Ndst4 transcripts are predominantly expressed
during embryonic development and in the adult brain
(Aikawa et al., 2001
Many growth factors and morphogens bind to HS. In some cases, HS
proteoglycans are thought to act as co-receptors for these ligands. Studies in
Drosophila melanogaster demonstrated that HS is crucial for embryonic
development (Perrimon and Bernfield,
2000
) and that the fly Ndst ortholog, Sulfateless, affects
signalling mediated by Wingless (Wg), Hedgehog (Hh) and Fibroblast Growth
Factor (Fgf) (Lin et al.,
1999
; Lin and Perrimon,
1999
; The et al.,
1999
). The ability of HS to regulate the activity of morphogens
and growth factors is currently best understood for the Fgfs. HS was found to
be a necessary component of Fgf-Fgf receptor binding and assembly
(Schlessinger et al., 2000
),
and global changes in HS expression regulate Fgf and Fgf receptor assembly
during mouse development (Allen and
Rapraeger, 2003
). Owing to the multiple developmental processes
regulated by the 22 Fgfs, including those of the lung, limbs, heart, skeleton
and brain (reviewed by Ornitz and Itoh,
2001
), perturbed Fgf-HS interactions can be expected to result in
impaired morphogen signalling, resulting in a variety of developmental
defects.
Sonic hedgehog (Shh), a member of the multi-gene hedgehog family in
vertebrates, also binds HS (Rubin et al.,
2002
). Mice that lack Shh function show defective axial patterning
of the brain and eye, skeleton and limbs
(Chiang et al., 1996a
). Shh has
been demonstrated to be essential in craniofacial morphogenesis, survival of
craniofacial neural crest cells, and growth and patterning of the cerebellum
(for a review, see Ingham and McMahon,
2001
). Members of the Tgfß family and Tgfß-binding
proteins also bind HS. Additionally, HS proteoglycans in the extracellular
matrix and on cell surfaces can affect gradients of these various factors in
tissues.
In this paper, we ask which developmental processes are impaired by undermodified heparan sulfate in the mouse. Surprisingly, we found that decreased sulfation of HS due to Ndst1 deficiency leads to very specific developmental defects of the head and forebrain. We also found that Ndst1 is a modifier of Fgf- and Shh-dependent signalling in those tissues.
| Materials and methods |
|---|
|
|
|---|
Histology and in situ detection of RNA and protein expression
Embryos were fixed in 4% paraformaldehyde overnight, dehydrated, embedded
in paraffin and sectioned. Sections were stained with Haematoxylin and Eosin
for histological analysis. Cartilage and bone were stained with Alcian Blue
and Alizarin Red in whole embryos. For whole-mount in situ hybridization a 700
bp riboprobe against the most variable N-terminal region of Ndsts was
employed (DIG RNA Labeling Kit, Roche, Mannheim, Germany). Immunohistochemical
analysis of Ndst1 expression and western blotting was performed using an
anti-Ndst1 antiserum (Grobe and Esko,
2002
) followed by detection with goat anti-rabbit HRP-conjugated
antibodies (Zymed, San Francisco, USA).
Quantitation of apoptosis was performed on paraffin sections of three mutant and three wild-type E15.5 embryos, using the TUNEL Assay Kit (Roche, Mannheim, Germany). BrdU-labelled nuclei were quantified using anti-BrdU antibodies (Zymed) on three mutant and wild-type E15.5 and E17.5 embryos. BrdU (70 µg/g mouse) was injected intraperitoneally and mothers were sacrificed after 1 hour. The number of BrdU-labelled cells relative to nonlabelled cells in the VZ was determined. Two different horizontal levels of the embryonic brains, 250 µm apart, were assessed in each embryo. Eight serial sections per level, each of three wild type and three mutant E17.5 embryos, were analyzed in anterior, posterior, median and lateral forebrain positions.
Patched expression was detected using anti-Ptch1 antiserum (Acris Antibodies, Hiddenhausen, Germany) and secondary FITC-labelled goat anti rabbit antibodies (Dianova, Hamburg, Germany) on three mutant and wild-type embryos. Images were taken on a Zeiss Axiophot microscope employing a 10x/0.3, a 20x/0.5 and a 63x/1.25 Zeiss objective, and a Leica DFC280 camera. Leica software was used for image capturing and Photoshop 7 software run on Macintosh computers for the generation of figures. Contrast and brightness were adjusted for whole images during figure assembly.
Preparation of HS
Three mutant, heterozygous and wild-type E15.5 embryos were pooled,
digested with 2 mg/ml pronase in 320 mM NaCl, 100 mM sodium acetate (pH 5.5)
overnight at 40°C, diluted 1:3 in water and applied to a 2.5 ml column of
DEAE Sephacel. After washing the column with 0.3 M NaCl, the
glycosaminoglycans were eluted with 1 M NaCl. For disaccharide analysis, the
GAG pool was ß-eliminated overnight at 4°C (0.5 M NaOH, 1 M
NaBH4), neutralized with acetic acid until the pH was
6 and
applied to a PD-10 (Sephadex G25) column (Pharmacia, Uppsala, Sweden).
Glycosaminoglycans eluting in the void volume were lyophilized, purified on
DEAE as described above, again applied to a PD-10 column and lyophilized. The
sample was digested using Heparin-lyase I, II and III and the resulting
disaccharides were separated from undigested CS using a 3 kDa spin-column
(Centricon, Bedford, USA) followed by HPLC analysis using Carbopac PA1 columns
(Dionex, Sunnyvale, USA). HS preparations from pooled embryos were
independently analyzed twice and statistical analysis was performed using
Student's t-test in Microsoft Excel.
Analysis of Fgf2-dependent Mapk pathway activation was performed using anti-Erk1/2 and anti-phospho-Erk1/2 polyclonal antibodies (Promega, Madison, USA). Fibroblasts derived from the heads of E14.5 wild-type and mutant embryos (n=4) were cultured in DMEM+10% FBS, starved for 20 hours in DMEM without FBS, incubated in complete medium, DMEM without FBS or 10 ng/ml Fgf2 in DMEM without FBS for 5 minutes, and lysed. Analyses were carried out in duplicate.
To generate soluble alkaline phosphatase-Shh fusion proteins, the N-terminal sequence of Shh (amino acids 25-198, Shh-N) was produced by PCR (sense primer, 5'AGATATCAATGTGGGCCCGGCAGGGGGTTTG3'; antisense primer, 5'ATCTAGAAGCCGCCGGATTTGGCCGCC3'), ligated into pGEM (Promega) and sequenced. Shh-N was ligated into pWIZ (Gene Therapy Systems, San Diego, USA) after limited HpaI and subsequent XbaI restriction of the vector, and EcoRV and XbaI restriction of the Shh PCR product. After transfection of B16/F1 cells, the secreted protein was bound to heparin and eluted as a single-peak with 0.6 M NaCl (Pharmacia, Uppsala, Sweden). The biological activity of the recombinant AP-Shh was confirmed by Shh-dependent alkaline phosphatase induction in C3H10T1/2 cells using the method described below. About 200 µg of purified lyophilized glycosaminoglycans (see above) derived from E14.5 mutant and wild-type embryos were covalently coupled to Affi-Gel 10 (BioRad) according to the manufacturers instructions, and the extent of coupling was determined by carbazole reaction. The supernatant of AP-Shh transfected B16/F1 cells was applied to the columns at a final concentration of 0.5 M salt to prevent unspecific binding and bound material was eluted with a NaCl gradient from 0-1 M in 0.1 M sodium acetate buffer (pH 6.0). AP activity was measured at 405 nm by addition of 120 mM p-nitrophenyl phosphate (pNPP, Sigma) in 0.1 M glycine buffer, pH 10.4. Integration of elution peaks was performed employing Origin software (Origin Lab, Northampton, USA).
| Results |
|---|
|
|
|---|
Ndst1 expression and HS composition in the mouse embryo
Whole-mount in situ hybridization was performed to elucidate expression of
Ndst1 in the developing embryo. By E11.5, Ndst1 expression
was strongest in the developing brain and frontonasal process, as well as
distal limb structures (Fig.
1F,H). As Ndst proteins are known to be translationally regulated
(Grobe and Esko, 2002
), we
also investigated Ndst1 expression on the protein level in E16.5 mice. Strong
expression was observed in the frontonasal process (FNP) and maxillary
prominences of the face, especially in hair follicles
(Fig. 1J). Ndst1 protein
expression was also detected in the forebrain, with highest levels in the
cortical plate and the ventricular layer
(Fig. 1L). Specificity of the
Ndst1 antiserum was confirmed by using Ndst1 mutant embryo sections
as controls (Fig. 1K,M).
|
|
Histological analysis revealed that the development of the brain was affected in Ndst1/ embryos (Figs 2F,H and 3D). One group of embryos had an only mildly affected external appearance, but the forebrain showed patterning defects and typically lacked olfactory bulbs. Moreover, the anterior and hippocampal commissures were absent or hypoplastic in all cases (arrowheads, Fig. 2F,J). Coronal sections revealed a hypoplastic pituitary in mutant embryos (not shown). A second group were severely affected (Fig. 3D). The size of the diencephalon and telencephalon was extremely reduced, whereas other brain regions surprisingly showed no strong dysmorphology. Forebrain-derived structures were also missing in these embryos. The neural crest-derived neurocranium and viscerocranium were almost completely absent, whereas the mesoderm-derived skeleton of the body appeared to be normal, with the exception of delayed ossification in the digits and vertebrae (Fig. 3E,F). Ndst1 heterozygous mice were normal.
Ndst1 is a regulator of Shh and Fgf signalling in the developing frontonasal process and maxillary prominences
The phenotype of severely affected Ndst1/
embryos strongly resembles chick embryos deficient in Fgf8 and Shh signalling
(Schneider et al., 2001
), and
mouse embryos carrying neural crest specific deletions of Shh
(Jeong et al., 2004
) and
Fgf8 (Trumpp et al.,
1999
). Thus, we decided to test Ndst1 mutant mice for
impaired Shh and Fgf signalling as possible causes for the observed
developmental defects.
|
|
Next, we investigated impaired Shh signalling by assessing the expression
of the Shh receptor patched (Ptch1) immunohistochemically in E15.5 embryos
(Fig. 4F,G). Ptch1-expression
was strongly reduced in the developing face (n=3), an area that was
strongly affected in the mutant and was previously found to express
Ndst1 at high levels (Fig.
1F,H,J). Last, binding of a soluble fusion protein consisting of
alkaline phosphatase and Shh (AP-Shh) to
Ndst1/ derived HS was performed to
demonstrate whether reduced Ptch1 expression in the mutant embryo, as well as
the enhanced phenotypic defects in Ndst1; Shh compound mutant mice,
could possibly be explained by impaired Shh-HS interactions. Indeed, binding
of AP-Shh was reduced to 39% and 45% compared with binding to wild-type HS
(n=2, Fig. 4H). The
AP-Shh protein was expressed in a functional form, because it induced
expression of alkaline phosphatase in C3H10T1/2 cells (not shown). Moreover,
AP-Shh bound to heparin-sepharose and required 0.6 M NaCl to elute (not
shown). Similar results were described for binding and elution of recombinant
Shh consisting of residues 25-198 expressed in E. coli
(Roelink et al., 1995
).
Taken together, the genetic interaction between Ndst1 and Shh, the reduced binding of recombinant AP-Shh to mutant HS and the alteration in Ptch1 expression in Ndst1 mutant embryos all suggest that impaired signalling via Shh contributes to the observed phenotypes in Ndst1/ embryos.
We next investigated if impaired Fgf signalling contributed to the observed
phenotypes. About 25% of Ndst1/ mice showed
agnathia and other facial defects (Fig.
4I) strongly reminiscent of mice carrying a conditional, neural
crest and neuron-specific Fgf8 deletion
(Trumpp et al., 1999
). To test
whether impaired Fgf receptor signalling and mitogen activated protein (Map)
kinase activity contributed to the phenotype, fibroblasts were derived from
facial mesenchyme of two wild-type and two mutant E14.5 embryos. The cells
were starved from serum for 20 hours and then stimulated with 10 ng Fgf2 or
complete growth medium containing serum
(Fig. 4J). Erk1/2
phosphorylation was strongly stimulated in fibroblasts derived from both
wild-type embryos in response to Fgf2 or serum. By contrast, Erk1/2
phosphorylation in Ndst1/ fibroblasts was
unchanged in response to Fgf2. Erk1/2 was not affected per se, as the same
level of Erk protein was present and serum stimulation activated
phosphorylation in the mutant. These findings indicate that mutant HS in cells
derived from the developing face was less effective as a Fgf co-receptor.
Thus, the craniofacial phenotype in the mutant could also result from
defective Fgf signalling.
|
| Discussion |
|---|
|
|
|---|
|
As an underlying reason, we assumed possible impairment of the two
HS-binding factors Shh and Fgf based on a number of published observations.
First, the phenotype of the most strongly affected Ndst1 mutant
embryos strongly resembles chick embryos made deficient in Shh and Fgf8
signalling (Schneider et al.,
2001
). Oligodendrocyte lineage specification also depends on Fgf
and Shh (Tekki-Kessaris et al.,
2001
) and oligodendrocyte precursors express highly sulfated,
heparin-like HS (Stringer et al.,
1999
), which possibly explains the finding that the number of glia
was found to be reduced in the telencephalon of Ndst1 mutant embryos.
Moreover, the single Ndst ortholog in the fly, Sulfateless,
is known to affect signalling mediated by Wingless, Hedgehog and Fgf
(Lin et al., 1999
;
Lin and Perrimon, 1999
;
The et al., 1999
). Thus,
multiple pathways might be affected by altering Ndst1 expression
throughout the brain and face.
Sonic hedgehog binds HS (Rubin et al.,
2002
), and mice lacking Shh function show defective axial
patterning of the brain, eye, skeleton and limbs
(Chiang et al., 1996a
). Shh is
also necessary for frontonasal, pituitary and brain development after initial
patterning takes place (Ahlgren and
Bronner-Fraser, 1999
; Britto et
al., 2002
; Hu and Helms,
1999
; Jeong et al.,
2004
; Treier et al.,
2001
). All of these developmental processes were found to be
affected in Ndst1 mutant embryos, suggesting that the observed
phenotypes could be explained in part by impaired Shh signalling. Facial and
eye defects in 50% of Ndst1+/;
Shh+/ (n=4), like those found in 86% of
Ndst1/ (n=61) embryos, was
consistent with this hypothesis. In addition,
Ndst1/; Shh+/ embryos
closely resemble reported phenotypes in which Shh signalling was inhibited
after the initial patterning events occur, resulting in small head and brain
size, craniofacial abnormalities, defects in all neural crest derived bones of
the skull, lack of a tongue, and abnormal folding and collapse of the
forebrain (Ahlgren and Bronner-Fraser,
1999
; Britto et al.,
2002
; Hu and Helms,
1999
; Jeong et al.,
2004
). Together, these results demonstrate a likely function of
Ndst1 as a modifier of Shh signalling in the developing face. The simplest
interpretation is that a decrease in sulfation of HS decreases the interaction
of Shh with matrix and cell surface HS-proteoglycans expressed in the
developing face, which in turn affects Shh gradient formation/signalling.
Consistent with this idea, we found that AP-Shh binding to mutant HS was
reduced by more than 50% in vitro. As the total amount of HS in E14.5 mutant
embryos and wild-type littermates was found to be similar, a reduced number of
Shh binding sites present on the undersulfated HS may be the most likely
reason for this observation (Fig.
4H).
Loss of Shh signalling and mutations in other genes of the Shh signalling
pathway, including patched, Gli2 and dispatched, cause
holoprosencephaly (HPE) (Ma et al.,
2002
; Ming et al.,
2002
; Muenke and Beachy,
2000
), the most common human forebrain defect with an incidence of
1:250 in embryos and 1:16,000 in newborn infants
(Muenke and Beachy, 2000
;
Muenke and Cohen, 2000
).
Severe, alobar HPE is characterized by severe facial dysmorphism and the
presence of a small monoventricular cerebrum, whereas the body is not strongly
affected. In semilobar HPE, rudimentary cerebral lobes are present but the
interhemispheric fissure is not complete, and olfactory tracts and bulbs are
absent or hypoplastic. In mild lobar HPE, the brain may be cleaved and of
normal size, but midline cleavage of the thalami and corpora striata may be
incomplete, pituitary anomalies may be present and the eyes can be small.
Olfactory tracts and bulbs may be absent as well. Various gradations of facial
dysmorphism are commonly associated with HPE, including median cleft lip,
midfacial hypoplasia and iris coloboma.
(Muenke and Cohen, 2000
). All
mildly affected Ndst1 mutant mice
(Fig. 2) show defects
reminiscent of semilobar and lobar HPE, such as midfacial hypoplasia, reduced
cerebral size, median cleft lip and palate, lack of olfactory bulbs, iris
coloboma, a hypoplastic pituitary and commissural defects. In addition, the
lack of neural crest cell derived skeletal structures commonly seen in the
Ndst1 mutant has also been described in severe cases of HPE
(Chiang et al., 1996b
;
Hu and Helms, 1999
;
Roessler et al., 1996
;
Schneider et al., 2001
). This
is supported by the finding that a partial loss of Ext function,
another enzyme involved in HS synthesis, also leads to an HPE-like phenotype
(Mitchell et al., 2001
).
The following explanations may account for the finding that
Ndst1/ embryos do not completely phenocopy
Shh mutant mice. First, only partial impairment of Shh signalling in
these mice might occur based on the finding that sulfation of HS is not
completely diminished (Table
1). Second, a variation in HS sulfation in the mutant might occur
temporally and spatially, thus affecting developmental programs and tissues
differentially. Modification of the Shh signalling pathway at different times
of human embryonic development has been described to possibly account for the
wide phenotypic spectrum of HPE (Cordero
et al., 2004
), and differences in Shh binding to HS derived from
E14.5 and E17.5 mouse embryos have been observed in vitro (S.R.P. and K.G.,
unpublished), indicating that HS-coregulation of Shh signalling might depend
on a specific chemical structure of HS. A third possibility explaining the
variable phenotype of Ndst1 mutant embryos may be the dynamic
expression of the other three Ndst isoforms (e.g. in the brain and
developing face) that might account for a variable partial compensation of
Ndst1 deficiency and thus the different degree in which specific
tissues are affected.
Perhaps, the most intriguing explanation for the observed phenotypic
variation is the impairment of different combinations of HS-binding growth
factors, e.g. Wnt proteins, bone morphogenetic proteins (Bmps), Hh proteins
and Fgf proteins. For example, Shh and Fgf8 act synergistically in cartilage
outgrowth during cranial development in the chick
(Abzhanov and Tabin, 2004
).
Simultaneous impairment of two soluble factors and their respective signal
transduction pathways could result in a greater variation and severity of the
resulting phenotypes that cannot be attributed to any of one of these factors
acting independently. Wnt signalling might also contribute to some of the
observed defects in Ndst1-mutant embryos, as developmental defects of
the viscerocranium and neurocranium reminiscent of those found in the
Ndst1/ embryos
(Fig. 3F) were described in
ß-catenin mutant embryos (Brault et
al., 2001
). Interestingly, these alterations are comparable with
those found in severe HPE cases that include absence of most crest
cell-derived skeletal structures (Chiang
et al., 1996b
; Hu and Helms,
1999
; Roessler et al.,
1996
; Schneider et al.,
2001
). Last, HS is described to be required for axon guidance by
interacting biochemically with known axon guidance molecules. Slit2, a
repulsive guidance molecule, was purified in part by its binding to heparin
(Wang et al., 1999
) and
mammalian Slits were isolated in a search for brain proteins that bind the HS
proteoglycan glypican (Glp1) (Liang et
al., 1999
). Here, the HS chains of Glp1 mediate its binding to the
Slits (Ronca et al., 2001
). In
Drosophila cell extracts, the HS proteoglycan Syndecan (Sdc)
co-immunoprecipitates both with Slit and its receptor Robo
(Johnson et al., 2004
), and
HS-Slit interaction was also shown to occur in mice
(Inatani et al., 2003
). In
vitro, heparin was also shown to bind both netrin 1 and its receptor Dcc,
which mediate attractive and repulsive responses
(Bennett et al., 1997
;
Serafini et al., 1994
). The
axon guidance deficiencies found in Ndst1 mutant mice might thus have
originated from affected molecules involved in attractive or repulsive axon
guidance in the developing brain.
We also investigated Fgf activity in the Ndst1 mutant embryos. Fgf
family members as well as their receptors are known to require HS for the
formation of high affinity Fgf and Fgf receptor complexes and subsequent
signalling (Rapraeger et al.,
1991
; Yayon et al.,
1991
). In addition, a crucial role of the Ndst homolog Sulfateless
in the generation of Fgf-binding sites has been described in
Drosophila (Lin et al.,
1999
) and in cell culture
(Ishihara et al., 1993
), which
was confirmed by recent work showing that Fgf2 and Fgf8 signalling is affected
in the developing mouse brain deficient in Ext1 function
(Inatani et al., 2003
). Thus,
we assumed Fgfs to be affected in the Ndst1 mutant embryo as well,
possibly contributing to some of the observed phenotypes. Relatively little
expansion of either the mandibular or maxillary primordia, both being derived
from the developing first branchial arch and resulting in agnathia,
microglossia (small tongue) and forebrain defects were found in neural- and
neural crest-specific Fgf8 mutant mouse embryos
(Trumpp et al., 1999
). Similar
defects were also observed in 25% of Ndst1/
embryos (Fig. 4I). Interestingly, agnathia alone occurs rarely but is often associated with
forebrain defects such as holoprosencephaly, a combination also present in
many severely affected Ndst1 mutant embryos. Additionally, the
reduced cortex size and compression of the cortical layers seen in all
Ndst1 mutant embryos has also been described in Fgf2 mutant
mice (Dono et al., 1998
;
Raballo et al., 2000
;
Vaccarino et al., 1999
). Fgf2
dependent activation of the Mapk pathway was strongly reduced in fibroblasts
derived from facial mesenchyme of E14.5 mutant embryos
(Fig. 4J), demonstrating that
Ndst1 may modify Fgf signalling at least in facial primordia, but possibly
also in the developing nervous system. Last, Fgfs play important roles in
neurogenesis, axon growth, differentiation and neuronal survival
(Reuss and von Bohlen und Halbach,
2003
), all of which are affected in Ndst1-deficient
embryos.
From this work, we conclude that Ndst1 is a crucial regulator of mammalian forebrain and facial development, that properly modified HS is necessary for neuronal, glia and neural crest development, and that impaired Shh and Fgf signalling (probably in combination with other soluble HS-binding factors) contributes to the observed phenotypes. Last, our findings imply that mutations in HS synthesizing genes, notably the Ext and Ndst genes, might contribute to developmental defects of the brain and face in humans, including defects of the mandible that are associated with more than 130 syndromes and thus are among the most common malformations.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Abzhanov, A. and Tabin, C. J. (2004). Shh and Fgf8 act synergistically to drive cartilage outgrowth during cranial development. Dev. Biol. 273,134 -148.[CrossRef][Medline]
Ahlgren, S. C. and Bronner-Fraser, M. (1999). Inhibition of sonic hedgehog signaling in vivo results in craniofacial neural crest cell death. Curr. Biol. 9,1304 -1314.[CrossRef][Medline]
Aikawa, J., Grobe, K., Tsujimoto, M. and Esko, J. D.
(2001). Multiple Isozymes of Heparan Sulfate/Heparin GlcNAc
N-Deacetylase/N-Sulfotransferase: Structure and Activity of the Fourth Member,
NDST4. J. Biol. Chem.
276,5876
-5882.
Allen, B. L. and Rapraeger, A. C. (2003).
Spatial and temporal expression of heparan sulfate in mouse development
regulates FGF and FGF receptor assembly. J. Cell Biol.
163,637
-648.
Bennett, K. L., Bradshaw, J., Youngman, T., Rodgers, J.,
Greenfield, B., Aruffo, A. and Linsley, P. S. (1997).
Deleted in colorectal carcinoma (DCC) binds heparin via its fifth
fibronectin type III domain. J. Biol. Chem.
272,26940
-26946.
Brault, V., Moore, R., Kutsch, S., Ishibashi, M., Rowitch, D. H., McMahon, A. P., Sommer, L., Boussadia, O. and Kemler, R. (2001). Inactivation of the beta-catenin gene by Wnt1-Cre-mediated deletion results in dramatic brain malformation and failure of craniofacial development. Development 128,1253 -1264.[Abstract]
Britto, J., Tannahill, D. and Keynes, R. (2002). A critical role for sonic hedgehog signaling in the early expansion of the developing brain. Nat. Neurosci. 5, 103-110.[CrossRef][Medline]
Bullock, S. L., Fletcher, J. M., Beddington, R. S. P. and
Wilson, V. A. (1998). Renal agenesis in mice homozygous for a
gene trap mutation in the gene encoding heparan sulfate 2-sulfotransferase.
Genes Dev. 12,1894
-1906.
Chiang, C., Litingtung, Y., Lee, E., Young, K. E., Corden, J. L., Westphal, H. and Beachy, P. A. (1996a). Cyclopia and defective axial patterning in mice lacking Sonic hedgehog gene function. Nature 383,407 -413.[CrossRef][Medline]
Chiang, C., Litingtung, Y., Lee, E., Young, K. E., Corden, J. L., Westphal, H. and Beachy, P. A. (1996b). Cyclopia and defective axial patterning in mice lacking Sonic hedgehog gene function. Nature 383,407 -413.
Cordero, D., Marcucio, R., Hu, D., Gaffield, W., Tapadia, M. and Helms, J. A. (2004). Temporal perturbations in sonic hedgehog signaling elicit the spectrum of holoprosencephaly phenotypes. J. Clin. Invest. 114,485 -494.[CrossRef][Medline]
Dono, R., Texido, G., Dussel, R., Ehmke, H. and Zeller, R. (1998). Impaired cerebral cortex development and blood pressure regulation in FGF-2-deficient mice. EMBO J. 17,4213 -4225.[CrossRef][Medline]
Esko, J. D. and Lindahl, U. (2001). Molecular diversity of heparan sulfate. J. Clin. Invest. 108,169 -173.[CrossRef][Medline]
Esko, J. D. and Selleck, S. B. (2002). Order out of chaos: Assembly of ligand binding sites in heparan sulfate. Annu. Rev. Biochem. 71,435 -471.[CrossRef][Medline]
Fan, G., Xiao, L., Cheng, L., Wang, X., Sun, B. and Hu, G. (2000). Targeted disruption of NDST-1 gene leads to pulmonary hypoplasia and neonatal respiratory distress in mice. FEBS Lett. 467,7 -11.[CrossRef][Medline]
Grobe, K. and Esko, J. D. (2002). Regulated
translation of heparan sulfate N-acetylglucosamine
N-deacetylase/N-sulfotransferase isozymes by structured 5'-untranslated
regions and internal ribosome entry sites. J. Biol.
Chem. 277,30699
-30706.
Holmborn, K., Ledin, J., Smeds, E., Eriksson, I.,
Kusche-Gullberg, M. and Kjellen, L. (2004). Heparan
sulfate synthesized by mouse embryonic stem cells deficient in NDST1 and NDST2
is 6-O-sulfated but contains no N-sulfate groups. J. Biol.
Chem. 279,42355
-42358.
Hu, D. and Helms, J. A. (1999). The role of sonic hedgehog in normal and abnormal craniofacial morphogenesis. Development 126,4873 -4884.[Abstract]
Inatani, M., Irie, F., Plump, A. S., Tessier-Lavigne, M. and
Yamaguchi, Y. (2003). Mammalian brain morphogenesis and
midline axon guidance require heparan sulfate. Science
302,1044
-1046.
Ingham, P. W. and McMahon, A. P. (2001).
Hedgehog signaling in animal development: paradigms and principles.
Genes Dev. 15,3059
-3087.
Ishihara, M., Guo, Y., Wei, Z., Yang, Z., Swiedler, S. J.,
Orellana, A. and Hirschberg, C. B. (1993). Regulation
of biosynthesis of the basic fibroblast growth factor binding domains of
heparan sulfate by heparan sulfate-N-deacetylase/N-sulfotransferase
expression. J. Biol. Chem.
268,20091
-20095.
Jeong, J., Mao, J., Tenzen, T., Kottmann, A. H. and McMahon, A.
P. (2004). Hedgehog signaling in the neural crest cells
regulates the patterning and growth of facial primordia. Genes
Dev. 18,937
-951.
Johnson, K. G., Ghose, A., Epstein, E., Lincecum, J., O'Connor, M. B. and Van Vactor, D. (2004). Axonal heparan sulfate proteoglycans regulate the distribution and efficiency of the repellent slit during midline axon guidance. Curr. Biol. 14,499 -504.[CrossRef][Medline]
Ledin, J., Staatz, W., Li, J. P., Gotte, M., Selleck, S.,
Kjellen, L. and Spillmann, D. (2004). Heparan sulfate
structure in mice with genetically modified heparan sulfate production.
J. Biol. Chem. 279,42732
-42741.
Li, J. P., Gong, F., Hagner-McWhirter, A., Forsberg, E., Abrink,
M., Kisilevsky, R., Zhang, X. and Lindahl, U. (2003).
Targeted disruption of a murine glucuronyl C5-epimerase gene results in
heparan sulfate lacking L-iduronic acid and in neonatal lethality.
J. Biol. Chem. 278,28363
-28366.
Liang, Y., Annan, R. S., Carr, S. K., Popp, S., Mevissen, M.,
Margolis, R. K. and Margolis, R. U. (1999). Mammalian
homologues of the Drosophila slit protein are ligands of the heparan
sulfate proteoglycan glypican-1 in brain. J. Biol.
Chem. 274,17885
-17892.
Lin, X. H. and Perrimon, N. (1999). Daily cooperates with Drosophila Frizzled 2 to transduce Wingless signalling. Nature 400,281 -284.[CrossRef][Medline]
Lin, X. H., Buff, E. M., Perrimon, N. and Michelson, A. M. (1999). Heparan sulfate proteoglycans are essential for FGF receptor signaling during Drosophila embryonic development. Development 126,3715 -3723.[Abstract]
Lindahl, U., Kusche-Gullberg, M. and Kjellén, L.
(1998). Regulated diversity of heparan sulfate. J.
Biol. Chem. 273,24979
-24982.
Ma, Y., Erkner, A., Gong, R., Yao, S., Taipale, J., Basler, K. and Beachy, P. (2002). Hedgehog-mediated patterning of the mammalian embryo requires transporter-like function of dispatched. Cell 111,63 -75.[CrossRef][Medline]
McLaughlin, D., Karlsson, F., Tian, N., Pratt, T., Bullock, S. L., Wilson, V. A., Price, D. J. and Mason, J. O. (2003). Specific modification of heparan sulphate is required for normal cerebral cortical development. Mech. Dev. 120,1481 -1488.[CrossRef][Medline]
Ming, J. E., Kaupas, M. E., Roessler, E., Brunner, H. G., Golabi, M., Tekin, M., Stratton, R. F., Sujansky, E., Bale, S. J. and Muenke, M. (2002). Mutations in PATCHED-1, the receptor for SONIC HEDGEHOG, are associated with holoprosencephaly. Hum. Genet. 110,297 -301.[CrossRef][Medline]
Mitchell, K. J., Pinson, K. I., Kelly, O. G., Brennan, J., Zupicich, J., Scherz, P., Leighton, P. A., Goodrich, L. V., Lu, X., Avery, B. J. et al. (2001). Functional analysis of secreted and transmembrane proteins critical to mouse development. Nat. Genet. 28,241 -249.[CrossRef][Medline]
Muenke, M. and Beachy, P. A. (2000). Genetics of ventral forebrain development and holoprosencephaly. Curr. Opin. Genet. Dev. 10,262 -269.[CrossRef][Medline]
Muenke, M. and Cohen, M. M., Jr (2000). Genetic approaches to understanding brain development: holoprosencephaly as a model. Ment. Retard. Dev. Disabil. Res. Rev. 6, 15-21.[CrossRef][Medline]
Ornitz, D. M. and Itoh, N. (2001). Fibroblast growth factors. Genome Biol. 2,3005 .1-3005.12.
Perrimon, N. and Bernfield, M. (2000). Specificities of heparan sulphate proteoglycans in developmental processes. Nature 404,725 -728.[CrossRef][Medline]
Raballo, R., Rhee, J., Lyn-Cook, R., Leckman, J. F., Schwartz,
M. L. and Vaccarino, F. M. (2000). Basic fibroblast
growth factor (Fgf2) is necessary for cell proliferation and neurogenesis in
the developing cerebral cortex. J. Neurosci.
20,5012
-5023.
Rapraeger, A. C., Krufka, A. and Olwin, B. B.
(1991). Requirement of heparan sulfate for bFGF-mediated
fibroblast growth and myoblast differentiation.
Science 252,1705
-1708.
Reuss, B. and von Bohlen und Halbach, O. (2003). Fibroblast growth factors and their receptors in the central nervous system. Cell Tissue Res. 313,139 -157.[CrossRef][Medline]
Ringvall, M., Ledin, J., Holmborn, K., Van Kuppevelt, T., Ellin,
F., Eriksson, I., Olofsson, A. M., Kjellén, L. and Forsberg,
E. (2000). Defective heparan sulfate biosynthesis and
neonatal lethality in mice lacking
N-deacetylase/N-sulfotransferase-1. J. Biol.
Chem. 275,25926
-25930.
Roelink, H., Porter, J. A., Chiang, C., Tanabe, Y., Chang, D. T., Beachy, P. A. and Jessell, T. M. (1995). Floor plate and motor neuron induction by different concentrations of the amino-terminal cleavage product of sonic hedgehog autoproteolysis. Cell 81,445 -455.[CrossRef][Medline]
Roessler, E., Belloni, E., Gaudenz, K., Jay, P., Berta, P., Scherer, S. W., Tsui, L. C. and Muenke, M. (1996). Mutations in the human Sonic Hedgehog gene cause holoprosencephaly. Nat. Genet. 14,357 -360.[CrossRef][Medline]
Ronca, F., Andersen, J. S., Paech, V. and Margolis, R. U.
(2001). Characterization of Slit protein interactions with
glypican-1. J. Biol. Chem.
276,29141
-29147.
Rubin, J. B., Choi, Y. and Segal, R. A. (2002).
Cerebellar proteoglycans regulate sonic hedgehog responses during development.
Development 129,2223
-2232.
Schlessinger, J., Plotnikov, A. N., Ibrahimi, O. A., Eliseenkova, A. V., Yeh, B. K., Yayon, A., Linhardt, R. J. and Mohammadi, M. (2000). Crystal structure of a ternary FGF-FGFR-heparin complex reveals a dual role for heparin in FGFR binding and dimerization. Mol. Cell 6, 743-750.[CrossRef][Medline]
Schneider, R. A., Hu, D., Rubenstein, J. L., Maden, M. and Helms, J. A. (2001). Local retinoid signaling coordinates forebrain and facial morphogenesis by maintaining FGF8 and SHH. Development 128,2755 -2767.
Serafini, T., Kennedy, T. E., Galko, M. J., Mirzayan, C., Jessell, T. M. and Tessier-Lavigne, M. (1994). The netrins define a family of axon outgrowth-promoting proteins homologous to C. elegans UNC-6. Cell 78,409 -424.[CrossRef][Medline]
Stringer, S. E., Mayer-Proschel, M., Kalyani, A., Rao, M. and
Gallagher, J. T. (1999). Heparin is a unique marker of
progenitors in the glial cell lineage. J. Biol. Chem.
274,25455
-25460.
Tekki-Kessaris, N., Woodruff, R., Hall, A. C., Gaffield, W.,
Kimura, S., Stiles, C. D., Rowitch, D. H. and Richardson, W. D.
(2001). Hedgehog-dependent oligodendrocyte lineage specification
in the telencephalon. Development
128,2545
-2554.
The, I., Bellaiche, Y. and Perrimon, N. (1999). Hedgehog movement is regulated through tout velu-dependent synthesis of a heparan sulfate proteoglycan. Mol. Cell 4, 633-639.[CrossRef][Medline]
Treier, M., O'Connell, S., Gleiberman, A., Price, J., Szeto, D. P., Burgess, R., Chuang, P. T., McMahon, A. P. and Rosenfeld, M. G. (2001). Hedgehog signaling is required for pituitary gland development. Development 128,377 -386.[Abstract]
Trumpp, A., Depew, M. J., Rubenstein, J. L., Bishop, J. M. and
Martin, G. R. (1999). Cre-mediated gene inactivation
demonstrates that FGF8 is required for cell survival and patterning of the
first branchial arch. Genes Dev.
13,3136
-3148.
Vaccarino, F. M., Schwartz, M. L., Raballo, R., Nilsen, J., Rhee, J., Zhou, M., Doetschman, T., Coffin, J. D., Wyland, J. J. and Hung, Y. T. (1999). Changes in cerebral cortex size are governed by fibroblast growth factor during embryogenesis. Nat. Neurosci. 2,848 .[Medline]
Wang, K. H., Brose, K., Arnott, D., Kidd, T., Goodman, C. S., Henzel, W. and Tessier-Lavigne, M. (1999). Biochemical purification of a mammalian slit protein as a positive regulator of sensory axon elongation and branching. Cell 96,771 -784.[CrossRef][Medline]
Yayon, A., Klagsbrun, M., Esko, J. D., Leder, P. and Ornitz, D. M. (1991). Cell surface, heparin-like molecules are required for binding of basic fibroblast growth factor to its high affinity receptor. Cell 64,841 -848.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
S. R. Pallerla, R. Lawrence, L. Lewejohann, Y. Pan, T. Fischer, U. Schlomann, X. Zhang, J. D. Esko, and K. Grobe Altered Heparan Sulfate Structure in Mice with Deleted NDST3 Gene Function J. Biol. Chem., June 13, 2008; 283(24): 16885 - 16894. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Pan, C. Carbe, A. Powers, E. E. Zhang, J. D. Esko, K. Grobe, G.-S. Feng, and X. Zhang Bud specific N-sulfation of heparan sulfate regulates Shp2-dependent FGF signaling during lacrimal gland induction Development, January 15, 2008; 135(2): 301 - 310. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Habuchi, N. Nagai, N. Sugaya, F. Atsumi, R. L. Stevens, and K. Kimata Mice Deficient in Heparan Sulfate 6-O-Sulfotransferase-1 Exhibit Defective Heparan Sulfate Biosynthesis, Abnormal Placentation, and Late Embryonic Lethality J. Biol. Chem., May 25, 2007; 282(21): 15578 - 15588. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Fuster, L. Wang, J. Castagnola, L. Sikora, K. Reddi, P. H.A. Lee, K. A. Radek, M. Schuksz, J. R. Bishop, R. L. Gallo, et al. Genetic alteration of endothelial heparan sulfate selectively inhibits tumor angiogenesis J. Cell Biol., May 7, 2007; 177(3): 539 - 549. [Abstract] [Full Text] [PDF] |
||||