|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 3 August 2005
doi: 10.1242/dev.01946
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Psychiatry, Mount Sinai School of Medicine, New York, NY 10029,
USA
2 Psychiatry Service, Bronx VA Medical Center, Bronx, NY 10468, USA
3 Department of Neuroscience, Mount Sinai School of Medicine, New York, NY
10029, USA
4 Department of Geriatrics and Adult Development, Mount Sinai School of
Medicine, New York, NY 10029, USA
* Author for correspondence (e-mail: gregory.elder{at}mssm.edu)
Accepted 17 June 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Cortical development, CNS hemorrhages, Familial Alzheimer's disease, Neural progenitor cells, Presenilin 1 (PS1, Psen1), Transgenic mice, Vascular development
| Introduction |
|---|
|
|
|---|
In adult brain, Psen1 is expressed primarily in neurons
(Elder et al., 1996
), although
neural progenitor cells in adult hippocampus express Psen1
(Wen et al., 2002a
) and its
expression can be induced in reactive astrocytes
(Cribbs et al., 1996
),
including those surrounding senile plaques
(Weggen et al., 1998
).
Developmentally, Psen1 expression is found as early as the preimplantation
embryo (Jeong et al., 2000
)
and Psen1 is prominently expressed in neural progenitor cells in the
ventricular zone of embryonic rodents
(Moreno-Flores et al., 1999
)
and humans (Kostyszyn et al.,
2001
). Mice with a null mutation of the Psen1 gene
(Psen1/) die during late intrauterine life
or shortly after birth, and exhibit multiple CNS and non-CNS abnormalities,
including cerebral hemorrhages and altered cortical development
(Hartmann et al., 1999
;
Shen et al., 1997
;
Wong et al., 1997
).
The cellular and molecular basis for the developmental effects of Psen1
remain incompletely understood. In particular, the role that Psen1 plays in
different cell types remains unknown. Recently, we generated transgenic mice
with either neuron-specific (Wen et al.,
2002b
) or neural progenitor-specific expression of Psen1 (this
paper). We show by crossing these transgenes onto the
Psen1/ background that neither
neuron-specific nor neural progenitor-specific expression of Psen1 rescues the
embryonic lethality of the Psen1/ embryo.
Indeed, neuron-specific expression ameliorates none of the abnormalities in
the Psen1/ embryo. However, Psen1 expression
in neural progenitors rescues cortical development in
Psen1/ embryos, including normalizing
cortical lamination patterns and eliminating the cerebral hemorrhages.
| Materials and methods |
|---|
|
|
|---|
Transgenic mice were produced by pronuclear injection using C57Bl/6J xC3H (B6C3) as a source of fertilized eggs. Genotypes were determined by PCR on DNA isolated from tail biopsies or from regions of the embryos or yolk sac. The NesPsen1 transgene was identified with primers homologous to the tk promoter (5'CACGCAGATGCAGTCGGG3') and the human Psen1 cDNA (5'GTGTTCTCCTCCAGGCCAAG3') that yield a 287 bp product. Primers to the Cre cDNA (5'GTCGAGCGATGGATTTCCGTCT3' and 5'GCTTGCATGATCTCCGGTATT3') were used to identify a 274 bp product from the NesCrenls transgene. cActXStopXEGFP transgenic mice were identified with the primers 5'CGTAAACGGCCACAAGTTCAG3' and 5'ATGCCGTTCTTCTGCTTGTCG3' that amplify a 420 bp product from the EGFP cDNA. Lines were maintained by breeding transgenic animals to C57Bl/6 wild-type mice.
The Z/EG transgenic line (Novak et al.,
2000
) was obtained from Jackson laboratories (Bar Harbor, MA, USA;
stock name Tg(ACTB-Bgeo/GFP); stock number 003920).
Psen1/ mice were obtained from Dr Huntington
Potter (University of South Florida, Tampa FL, USA) and are those generated by
Shen et al. (Shen et al.,
1997
). These animals were provided on a mixed genetic background
and have been maintained by breeding to C57Bl/6 wild-type mice. Genotypes were
determined as described by Shen et al.
(Shen et al., 1997
). Owing to
the mixed genetic background of both the
Psen1/ and the Psen1 transgenic animals,
non-transgenic littermates were used as controls in all studies
Animals were housed on 12-hour light/dark cycles and received food and water ad libitum. All procedures were approved by the Mount Sinai School of Medicine Institutional Animal Care and Use Committee and were in conformance with the National Institutes of Health `Guide for the Care and Use of Laboratory Animals'.
Western blotting
Western blotting was performed as previously described
(Wen et al., 2002b
).
BrdU injections
5'-bromo-2'-deoxyuridine (BrdU; Sigma, St Louis, MO, USA) was
dissolved in 0.9% NaCl at a concentration of 10 mg/ml and sterilized through
an 0.45 µm filter. Mice received one intraperitoneal injection (50 µg/gm
of body weight).
Histology and immunohistochemistry
Timed pregnant female mice were euthanized with carbon dioxide. The day of
vaginal plug was designated as E0.5. Embryos were fixed in 4% paraformaldehyde
overnight and embedded in paraffin wax. Brains were cut into 6-8 µm coronal
or horizontal sections. Adult animals were perfused transcardially and the
tissues processed as previously described
(Wen et al., 2002b
).
Histological sections were stained with Cresyl Violet and a standard set of at least five sections per embryo was examined. For horizontally sectioned embryos, a series centered through the lateral ventricle above the level of the caudate/putamen was used. A series centered at the level of the medial septal nucleus was examined in coronally sectioned embryos.
For immunohistochemical staining sections were blocked with PBS/0.1% Triton
X-100/5% goat serum (TBS-TGS) for 30 minutes and primary antibodies were
applied in TBS-TGS at room temperature overnight. The primary antibodies used
were Rat 401, a mouse monoclonal anti-rat nestin (1:500, Chemicon, Temecula,
CA, USA); CS56, a mouse monoclonal anti-chondroitin sulfate proteoglycan
(1:400, Sigma); G10, a mouse monoclonal anti-reelin (1:500, Chemicon); a
rabbit polyclonal anti-EGFP (1:1500, Molecular Probes, Eugene, OR, USA); a
rabbit polyclonal anti-von Willebrand factor (1:200, Sigma); and a rabbit
polyclonal anti-fibronectin (1:400, Sigma). Immunofluorescence staining was
detected with species-specific Alexa Fluor secondary antibody conjugates
(1:400, Molecular Probes) applied for 2 hours; sections were mounted using
Gel/Mount (Biomeda, Foster City, CA, USA). BrdU immunohistochemistry was
performed as previously described (Wen et
al., 2002b
).
Vascular staining with Griffonia simplicifolia isolectin B4 was performed
using methods similar to those described in Ashwell
(Ashwell, 1991
). Deparaffinized
sections were incubated for 20 minutes at 90°C in 10 mM Na citrate buffer
(pH 8.6) and allowed to cool to room temperature. After blocking with TBS
containing 0.02% Triton X-100, 1 mM MgCl2, 1 mM CaCl2
and 1 mM MnCl2 for 1 hour at room temperature, biotinylated
Isolectin B4 (Sigma, 10 µg/ml in the above buffer) was added and sections
incubated overnight at 4°C. To detect lectin binding, sections were
incubated with Streptavidin-Alexa 488 (Molecular Probes, 1:300 diluted in TBS)
for 2 hours at room temperature. When Isolectin B4 staining was combined with
immunohistochemistry, lectin staining was performed after the
immunostaining.
Images were collected using a Zeiss Axiophot microscope (Zeiss, Thornwood, NY, USA) or a Nikon Eclipse E400 connected to a DXC-390 CCD camera (Nikon, Melville, NY, USA). Images were color balanced and merged using Adobe Photoshop 7.0 (Adobe Systems, San Jose, CA, USA).
When spontaneous EGFP fluorescence was imaged and combined with aquaporin immunohistochemistry, Vibratome sections (200 µm) were immunostained with a polyclonal anti-aquaporin 4 antibody (1:100, Chemicon) followed by Texas Red-conjugated secondary antibodies (Vector Laboratories, Burlingame, CA, USA). Spontaneous EGFP fluorescence and Texas Red immunofluorescence were imaged with a Radiance 2000 MP system (Bio-Rad, Hercules, CA, USA) equipped with a Mira 900F Ti: sapphire laser (tuned to 860 nm) and a Verdi 10-W pump laser (Coherent, Santa Clara, CA, USA).
In situ hybridization
E12.5-E13.5 embryos were immersion fixed for 2 hours in 4% paraformaldehyde
dissolved in diethylpyrocarbonate (DEPC)-treated PBS, equilibrated
sequentially in 10%, 20% and 30% sucrose and embedded in OCT compound (Tissue
Tek, Elkhart, IN, USA). Cryosections (15 µm) were cut, air dried for 20
minutes and fixed in 4% paraformaldehyde in PBS-DEPC. Sections were treated
with 1 µg/ml proteinase K for 5 minutes at room temperature and fixed in
paraformaldehyde for an additional 20 minutes. After several washes with
PBS-DEPC, sections were acetylated with acetic anhydride in the presence of
triethanolamine. The sections were then prehybridized for 2 hours in 50%
formamide, 5 x SSC, 5 x Denhardt's solution, 250 µg/ml yeast
RNA, 500 µg/ml herring sperm DNA and hybridized at 55°C for 16 hours
with 400 ng/ml of a heat denatured (80°C) digoxigenin-labeled antisense
RNA probe complementary to a 260 bp sequence in the human PSEN1
3' untranslated region (nucleotides 1854-2114 in GenBank Accession
Number BC011729). Probes were labeled by random incorporation of
digoxigenin-labeled deoxyuridine triphosphate using a commercially available
kit (Roche, Indianapolis, IN, USA). Slides were washed for 1 hour in 0.2
x SSC at 70°C and subsequently with 50 mM Tris-HCl (pH 8.0), 0.15 M
NaCl (TBS) at room temperature. After blocking with 10% heat-inactivated goat
serum in TBS at room temperature, sections were incubated overnight with a
1:250 dilution of anti-digoxigenin antibodies at 4°C (Roche). Following
several washes with TBS, slides were equilibrated in alkaline phosphatase
buffer [0.1 M Tris-HCl (pH 9.5), 0.1 M NaCl, 50 mM MgCl2, 0.01%
Tween-20, 0.25 mg/ml levamisole] for 30 minutes followed by staining with 0.4
mg/ml nitro tetrazolium blue chloride, 0.19 mg/ml
5-bromo-4-chloro-3-indolyl-phosphate in the same solution for 72 hours at
4°C. E16.5 embryos were hybridized in an identical manner except that the
brains were dissected and frozen directly in OCT compound without prior
fixation. Additionally, the proteinase K digestion step was omitted and the
hybridization was performed at 60°C.
| Results |
|---|
|
|
|---|
In the present studies, two lines (9 and 14) with similar patterns of transgene expression were used. Western blotting of E12.5 brain with a human specific anti-Psen1 antibody showed that in both lines the human Psen1 protein could be detected in transgenic brain while no signal was found in non-transgenic controls (Fig. 1). In addition, western blotting with a Psen1 antibody that reacts with both the mouse and human proteins gave an approximately threefold higher signal in the transgenic embryos (Fig. 1). To establish the cell type specificity of transgene expression, we performed in situ hybridization on E13.5 embryos using a human Psen1-specific cRNA probe. In nestin-Psen1 line 9 there was prominent human Psen1 expression in the ventricular zone of the telencephalon as expected for a nestin-driven transgene (see Fig. S1 in the supplementary material; see Fig. 8).
Neither neural progenitor nor neuron specific expression of Psen1 rescues the embryonic lethality of Psen1/ mice
Hemizygous nestin-Psen1 transgenic mice were indistinguishable from
wild-type littermates with regard to behavior and physical appearance. To
determine whether selective expression of Psen1 in neural progenitor cells
could rescue the embryonic lethality of
Psen1/ animals, we bred the nestin-Psen1
transgene onto the Psen1/ background. For
this purpose, hemizygous transgenic/heterozygous
Psen1+/ animals were created and crossed with
Psen1+/ mice. From such matings one out of eight
offspring should be Psen1/ if rescue is
possible. We were not able to rescue live born
Psen1/ animals from matings with either
nestin-Psen1 line 9 or 14 in over 40 pups generated from these matings
(P=0.004 that no Psen1/ would be
born).
|
To determine if neuron-specific expression of Psen1 could rescue the embryonic lethality of Psen1/ mice we bred NSE-Psen1 line 30 onto the Psen1/ background. Again, we were unable to rescue live born Psen1/ mice in over 20 pups born from these matings (P=0.06). Thus, neither neuron-specific nor neural progenitor-specific expression of Psen1 can rescue the embryonic lethality of the Psen1/ mouse.
|
|
None of six embryos with the nestin-Psen1 transgene on
Psen1/ background derived from four separate
litters showed microscopic evidence of hemorrhage and the cortical lamination
pattern appeared identical to wild-type embryos
(Fig. 5). Rescued embryos also
showed no heterotopias in the marginal zone and the leptomeninges showed
neither the gaps nor fibrosis seen in Psen1/
embryos (see Fig. S2 in the supplementary material). Likewise, the previously
described loss of chondroitin sulfate proteoglycan staining in the marginal
zone (Hartmann et al., 1999
)
was normalized (see Fig. S3 in the supplementary material), and reelin
immunostaining (see Fig. S4 in the supplementary material) showed that
Cajal-Retzius cells were as easily identified in the marginal zone of rescued
animals as in wild-type embryos, showing no evidence for the loss of these
cells that occurs in latter stage Psen1/
embryos (Hartmann et al.,
1999
; Kilb et al.,
2004
; Wines-Samuelson et al.,
2005
). Indeed, except for pure
Psen1/ embryos, there were no differences
between wild-type embryos and any of the genotypes that were generated in
these crosses (i.e. Psen1+/ or nestin-Psen1
transgene on mouse Psen1+/+,
Psen1+/ or Psen1/
backgrounds) Thus, neural progenitor specific expression of Psen1 is
sufficient to normalize cortical lamination patterns as well as prevent
cerebral hemorrhages in Psen1/ embryos.
|
|
|
|
|
As leakage of the transgene into mesodermal- or possibly neural
crest-derived cephalic mesenchymal cells would provide a trivial explanation
for the rescue of the cerebral hemorrhages, we re-examined transgene
expression pattern in E12.5 brain by in situ hybridization, with particular
attention as to whether the transgenic human PSEN1 was expressed in the
overlying cephalic mesenchyme. As expected, strong hybridization was seen
within the brain parenchyma of the transgenic specimen, with the signal being
especially prominent in cells surrounding the ventricular zone
(Fig. 8). Owing to the
resolution of the digoxigenin detection system, it was difficult to determine
unequivocally whether hybridization product was present in endothelial cells
within brain parenchyma. However, no hybridization was apparent in any region
of the overlying cephalic mesenchyme, including blood vessels and perivascular
cells within this structure (Fig.
8) indicating that the transgene is not expressed in mesoderm or
in neural crest-derived elements that migrate into this region
(Etchevers et al., 1999
).
We have also generated transgenic mice expressing Cre recombinase under the
control of the nestin intron 2 enhancer/tk promoter (NesCrenls mice). Cre
expression in these lines has been verified by both western blotting and by
immunohistochemistry on E13.5 mouse brain (data not shown). Because low-level
transgene expression could be missed by in situ hybridization, as an
additional test of nestin intron 2 enhancer activity, we crossed NesCrenls
transgenic mice to two lines of Cre reporter mice, a technique that should be
sensitive to even low levels of nestin intron 2 enhancer activity. NesCrenls
line 27 mice were firstly crossed with a Cre/loxP reporter line
cActXstopXEGFP44. This line serves as an indicator of Cre expression in that
Cre removes a loxP flanked stop cassette sequence and activates EGFP
expression. Spontaneous EGFP fluorescence was imaged and combined with
immunohistochemistry for aquaporin 4, which is expressed in astrocytic foot
processes that surround blood vessels and thus serves as an effective vascular
marker (Verkman, 2002
). EGFP
expression from the hippocampal CA1 region of an adult double transgenic mouse
is shown in Fig. 9, where
prominent expression of EGFP is seen in CA1 pyramidal cells while no EGFP
expression is seen in the aquaporin outlined vessels.
As an independent test of nestin intron 2/tk promoter activity, we also
crossed NesCrenls lines 27 and 13 mice with the Z/EG reporter line
(Novak et al., 2000
). In this
line, Cre-mediated recombination removes a lacZ gene and activates
expression of an EGFP reporter under the control of CMV/chicken ß-actin
promoter. These mice have been used in several recent studies to follow
Cre-mediated excision in both early embryonic and adult tissues
(Guo et al., 2002
;
Malatesta et al., 2003
;
Novak et al., 2000
). Crosses
with both NesCrenls lines gave similar results in showing widespread EGFP
activation in adult brain but no activation in or around brain vessels.
Immunohistochemical staining for EGFP combined with staining for von
Willebrand factor as an endothelial cell marker
(Costa et al., 2001
) is shown
in Fig. 9, where EGFP labeled
cells can be seen to the left and right of a large penetrating vessel at the
cortical surface, while no EGFP expression is apparent in the von Willebrand
factor stained vessel. In these same sections, we have also been unable to
detect EGFP activation in either aquaporin 4- or
fibronectin-(Peters and Hynes,
1996
) labeled vessels (data not shown). Thus, collectively, these
studies show that the nestin intron 2 enhancer is not active in vascular
endothelial cells or in vascular progenitor cells at any stage of
development.
|
During cerebral angiogenesis, endothelial cells form close contacts with
perivascular mural cells or pericytes (Beck
and D'Amore, 1997
), and once within the neuroectoderm,
endothelial/pericyte complexes make close contacts with brain cells, including
radial glia (Bass et al.,
1992
). To address whether defective interactions between
neuroepithelial cells and developing vessels might be occurring in
Psen1/ embryos, we used nestin
immunostaining as a marker of neuroepithelial cells and isolectin B4 staining
as a vascular marker. Nestin staining in E12.5
Psen1/ telencephalon appeared similar to
wild-type embryos, with many radially distributed processes extending
throughout the telencephalic wall (data not shown). At E18.5, nestin staining
in wild-type controls continued to show many radially distributed processes
extending throughout the full thickness of the cerebral hemispheres
(Fig. 10) with some
nestin-stained processes traversing near cerebral vessels. By contrast, in
E18.5 Psen1/ animals, nestin staining was
largely absent in the cerebral hemispheres with at most sparse fibers that
failed to extend through the full thickness of the cerebral wall, a pattern
that was evident even in areas that lacked cerebral hemorrhages.
Interestingly, the nestin staining that was present in
Psen1/ brains was concentrated around and
possibly within distorted cerebral vessels. Similar patterns were observed in
both the cerebral hemispheres (Fig.
10) and the developing caudate/putamen (data not shown) of
Psen1/ embryos. However, in embryos with the
nestin-Psen1 transgene on the Psen1/
background, many radially directed processes were nestin stained, and these
processes associated with brain vessels in a pattern that was identical to
wild-type controls (Fig.
10).
| Discussion |
|---|
|
|
|---|
|
Several studies have suggested that vascular endothelial cells, including
embryonic blood vessels in brain as well as pericytes and periendothelial
cells may express nestin based on immunostaining with antibodies such as Rat
401 (Alliot et al., 1999
;
Mokry and Nemecek, 1998
;
Mokry and Nemecek, 1999
;
Tohyama et al., 1992
).
However, we found no evidence by in situ hybridization of transgene expression
in the overlying cephalic mesenchyme, including blood vessels contained within
this region and there was also no evidence for activity of the nestin intron 2
enhancer in endothelial cells or vascular progenitor cells when this enhancer
was used to drive Cre recombinase and crossed to Cre reporter lines. Thus,
leakage of the transgene into cephalic mesenchymal elements, whether
mesodermal or neural crest derived does not appear to be the basis for the
rescue of the vascular abnormalities. The failure of the nestin-Psen1
transgene to rescue the caudal defects in the
Psen1/ mouse also argues against mesodermal
expression. Several other studies have also failed to detect vascular activity
of the nestin intron 2 enhancer in transgenic mice when it was used to drive
EGFP directly (Filippov et al.,
2003
; Kawaguchi et al.,
2001
; Mignone et al.,
2004
; Yamaguchi et al.,
2000
).
In addition, another study
(Wines-Samuelson et al., 2005
)
recently reported the production of a conditional knockout of Psen1 in neural
progenitor cells by crossing a nestin-Cre transgene onto a floxed
Psen1 background. Although the cortical phenotype in these mice was
milder than a pure Psen1-null mutant, the conditional knockout mice
exhibited widespread intracranial hemorrhages that were thought to be a
proximal cause of postnatal death in these animals. This study is thus
consistent with our results suggesting that neural progenitor specific
expression of Psen1 is necessary for the development of a competent
vasculature.
Collectively, these results argue that Psen1 is essential for
neural-derived signals that are necessary for formation of a normal
vasculature. The disturbed nestin staining pattern in
Psen1/ embryos points to an abnormal
association of neuroepithelial cells with brain blood vessels. In this
context, two recent studies have also reported abnormal radial glial
development in Psen1/ embryos
(Louvi et al., 2004
;
Wines-Samuelson et al., 2005
).
At the molecular level, it remains unclear how Psen1 expression in neural
progenitor might mediate this effect. Psen1 influences a variety of pathways
known to be important developmentally (Koo
and Kopan, 2004
). Yet whatever the mechanisms of action of Psen1,
the studies described here show that Psen1 expression in neural progenitor
cells is sufficient to rescue completely the brain abnormalities found in
Psen1/ mice, including the unexpected rescue
of the vascular defects. As such, the combination of nestin-Psen1 transgenic
mice and the Psen1-null mutant provide a model for dissecting the
specific molecular pathways that Psen1 influences in neural progenitor
cells.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/132/17/3873/DC1
| REFERENCES |
|---|
|
|
|---|
Alliot, F., Rutin, J., Leenen, P. J. and Pessac, B. (1999). Pericytes and periendothelial cells of brain parenchyma vessels co-express aminopeptidase N, aminopeptidase A, and nestin. J. Neurosci. Res. 58,367 -378.[CrossRef][Medline]
Aoki, Y., Huang, Z., Thomas, S. S., Bhide, P. G., Huang, I.,
Moskowitz, M. A. and Reeves, S. A. (2000). Increased
susceptibility to ischemia-induced brain damage in transgenic mice
overexpressing a dominant negative form of SHP2. FASEB
J. 14,1965
-1973.
Ashwell, K. (1991). The distribution of microglia and cell death in the fetal rat forebrain. Dev. Brain Res. 58,1 -12.[CrossRef][Medline]
Bass, T., Singer, G., Slusser, J. and Liuzzi, F. J. (1992). Radial glial interaction with cerebral germinal matrix capillaries in the fetal baboon. Exp. Neurol. 118,126 -132.[CrossRef][Medline]
Beck, L., Jr and D'Amore, P. A. (1997). Vascular development: cellular and molecular regulation. FASEB J. 11,365 -373.[Abstract]
Costa, C., Harding, B. and Copp, A. J. (2001).
Neuronal migration defects in the Dreher (Lmx1a) mutant mouse: role of
disorders of the glial limiting membrane. Cereb.
Cortex 11,498
-505.
Cribbs, D. H., Chen, L. S., Cotman, C. W. and LaFerla, F. M. (1996). Injury induces presenilin-1 gene expression in mouse brain. NeuroReport 7,1773 -1776.[Medline]
Cruts, M., van Duijn, C. M., Backhovens, H., Van den Broeck,
M., Wehnert, A., Serneels, S., Sherrington, R., Hutton, M., Hardy, J.,
St George-Hyslop, P. H. et al. (1998). Estimation of the
genetic contribution of presenilin-1 and -2 mutations in a population-based
study of presenile Alzheimer disease. Hum. Mol. Genet.
7, 43-51.
Elder, G. A., Tezapsidis, N., Carter, J., Shioi, J., Bouras, C., Li, H.-C., Johnston, J. M., Efthimiopoulos, S., Friedrich, V. L. and Robakis, N. K. (1996). Identification and neuron specific expression of the S182/presenilin I protein in human and rodent brains. J. Neurosci. Res. 45,308 -320.[CrossRef][Medline]
Etchevers, H. C., Couly, G., Vincent, C. and Le Douarin, N. M. (1999). Anterior cephalic neural crest is required for forebrain viability. Development 126,3533 -3543.[Abstract]
Filippov, V., Kronenberg, G., Pivneva, T., Reuter, K., Steiner, B., Wang, L. P., Yamaguchi, M., Kettenmann, H. and Kempermann, G. (2003). Subpopulation of nestin-expressing progenitor cells in the adult murine hippocampus shows electrophysiological and morphological characteristics of astrocytes. Mol. Cell. Neurosci. 23,373 -382.[CrossRef][Medline]
Frisen, J., Johansson, C. B., Lothian, C. and Lendahl, U. (1998). Central nervous system stem cells in the embryo and adult. Cell Mol. Life Sci. 54,935 -945.[CrossRef][Medline]
Guo, C., Yang, W. and Lobe, C. G. (2002). A cre recombinase transgene with mosaic, widespread tamoxifen-inducible action. Genesis 32,8 -18.[CrossRef][Medline]
Handler, M., Yang, X. and Shen, J. (2000). Presenilin-1 regulates neuronal differentiation during neurogenesis. Development 127,2593 -2606.[Abstract]
Harrigan, M. R. (2003). Angiogenic factors in the central nervous system. Neurosurgery 53,639 -660.[CrossRef][Medline]
Hartmann, D., De Strooper, B. and Saftig, P. (1999). Presenilin-1 deficiency leads to loss of Cajal-Retzius neurons and cortical dysplasia similar to human type 2 lissencephaly. Curr. Biol. 9,719 -727.[CrossRef][Medline]
Jeong, S. J., Kim, H. S., Chang, K. A., Geum, D. H., Park, C.
H., Seo, J. H., Rah, J. C., Lee, J. H., Choi, S. H., Lee, S. G. et
al. (2000). Subcellular localization of presenilins during
mouse preimplantation development. FASEB J.
14,2171
-2176.
Josephson, R., Muller, T., Pickel, J., Okabe, S., Reynolds, K., Turner, P. A., Zimmer, A. and McKay, R. D. (1998). POU transcription factors control expression of CNS stem cell-specific genes. Development 125,3087 -3100.[Abstract]
Kawaguchi, A., Miyata, T., Sawamoto, K., Takashita, N., Murayama, A., Akamatsu, W., Ogawa, M., Okabe, M., Tano, Y., Goldman, S. A. et al. (2001). Nestin-EGFP transgenic mice: visualization of the self-renewal and multipotency of CNS stem cells. Mol. Cell. Neurosci. 17,259 -273.[CrossRef][Medline]
Kilb, W., Hartmann, D., Saftig, P. and Luhmann, H. J. (2004). Altered morphological and electrophysiological properties of Cajal-Retzius cells in cerebral cortex of embryonic presenilin-1 knockout mice. Eur. J. Neurosci. 20,2749 -2756.[Medline]
Koo, E. H. and Kopan, R. (2004). Potential role of presenilin-regulated signaling pathways in sporadic neurodegeneration. Nat. Med. 10,S26 -S33.
Kostyszyn, B., Cowburn, R. F., Seiger, A., Kj, A. A. and Sundstrom, E. (2001). Expression of presenilin-1 and notch-1 receptor in human embryonic CNS. Neuroscience 103,885 -898.[Medline]
Lakso, M., Sauer, B., Mosinger, B., Jr, Lee, E. J., Manning, R.
W., Yu, S. H., Mulder, K. L. and Westphal, H. (1992).
Targeted oncogene activation by site-specific recombination in transgenic
mice. Proc. Natl. Acad. Sci. USA
89,6232
-6236.
Lendahl, U., Zimmerman, L. B. and McKay, R. D. (1990). CNS stem cells express a new class of intermediate filament protein. Cell 60,585 -595.[CrossRef][Medline]
Lleo, A., Berezovska, O., Growdon, J. H. and Hyman, B. T. (2004). Clinical, pathological, and biochemical spectrum of Alzheimer disease associated with PS-1 mutations. Am. J. Geriatr. Psychiat. 12,146 -156.
Louvi, A., Sisodia, S. S. and Grove, E. A.
(2004). Presenilin 1 in migration and morphogenesis in the
central nervous system. Development
131,3093
-3105.
Malatesta, P., Hack, M. A., Hartfuss, E., Kettenmann, H., Klinkert, W., Kirchhoff, F. and Gotz, M. (2003). Neuronal or glial progeny: regional differences in radial glia fate. Neuron 37,751 -764.[CrossRef][Medline]
Marin-Padilla, M. (1985). Early vascularization of the embryonic cerebral cortex: Golgi and electron microscopic studies. J. Comp. Neurol. 241,237 -249.[CrossRef][Medline]
McKay, R. (1997). Stem cells in the central
nervous system. Science
276, 66-71.
Mignone, J. L., Kukekov, V., Chiang, A. S., Steindler, D. and Enikolopov, G. (2004). Neural stem and progenitor cells in nestin-GFP transgenic mice. J. Comp. Neurol. 469,311 -324.[CrossRef][Medline]
Mokry, J. and Nemecek, S. (1998). Angiogenesis of extra- and intraembryonic blood vessels is associated with expression of nestin in endothelial cells. Folia Biol. (Praha) 44,155 -161.
Mokry, J. and Nemecek, S. (1999). Cerebral angiogenesis shows nestin expression in endothelial cells. Gen. Physiol. Biophys. 18,25 -29.
Moreno-Flores, M. T., Medina, M. and Wandosell, F. (1999). Expression of presenilin 1 in nervous system during rat development. J. Comp. Neurol. 410,556 -570.[CrossRef][Medline]
Nakajima, M., Yuasa, S., Ueno, M., Takakura, N., Koseki, H. and Shirasawa, T. (2003). Abnormal blood vessel development in mice lacking presenilin-1. Mech. Dev. 120,657 -667.[CrossRef][Medline]
Novak, A., Guo, C., Yang, W., Nagy, A. and Lobe, C. G. (2000). Z/EG, a double reporter mouse line that expresses enhanced green fluorescent protein upon cre-mediated excision. Genesis 28,147 -155.[CrossRef][Medline]
O'Gorman, S., Dagenais, N. A., Qian, M. and Marchuk, Y.
(1997). Protamine-Cre recombinase transgenes efficiently
recombine target sequences in the male germline of mice, but not in embryonic
stem cells. Proc. Natl. Acad. Sci. USA
94,14602
-14607.
Peters, J. H. and Hynes, R. O. (1996). Fibronectin isoform distribution in the mouse. I. The alternatively spliced EIIIB, EIIIA, and V segments show widespread codistribution in the developing mouse embryo. Cell Adhes. Commun. 4, 103-125.[Medline]
Shen, J., Bronson, R. T., Chen, D. F., Xia, W., Selkoe, D. J. and Tonegawa, S. (1997). Skeletal and CNS defects in presenilin-1-deficient mice. Cell 89,629 -639.[CrossRef][Medline]
Tohyama, T., Lee, V. M., Rorke, L. B., Marvin, M., McKay, R. D. and Trojanowski, J. Q. (1992). Nestin expression in embryonic human neuroepithelium and in human neuroepithelial tumor cells. Lab. Invest. 66,303 -313.[Medline]
Verkman, A. S. (2002). Aquaporin water channels and endothelial cell function. J. Anat. 200,617 -627.[CrossRef][Medline]
Weggen, S., Diehlmann, A., Buslei, R., Beyreuther, K. and Bayer, T. A. (1998). Prominent expression of presenilin-1 in senile plaques and reactive astrocytes in Alzheimer's disease brain. NeuroReport 9,3279 -3283.[Medline]
Wen, P. H., Friedrich, V. L., Jr, Shioi, J., Robakis, N. K. and Elder, G. A. (2002a). Presenilin-1 is expressed in neural progenitor cells in the hippocampus of adult mice. Neurosci. Lett. 318,53 -56.[CrossRef][Medline]
Wen, P. H., Shao, X., Shao, Z., Hof, P. R., Wisniewski, T., Kelley, K., Friedrich, V. L., Jr, Ho, L., Pasinetti, G. M., Shioi, J. et al. (2002b). Overexpression of wild type but not an FAD mutant presenilin-1 promotes neurogenesis in the hippocampus of adult mice. Neurobiol. Dis. 10,8 -19.[CrossRef][Medline]
Wen, P. H., De Gasperi, R., Gama Sosa, M. A. and Elder, G. A. (2004a). Neural progenitor cells do not differentiate prematurely in presenilin-1 null mutant mice. Neurosci. Lett. 371,249 -254.[Medline]
Wen, P. H., Hof, P. R., Chen, X., Gluck, K., Austin, G., Younkin, S. G., Younkin, L. H., DeGasperi, R., Gama Sosa, M. A., Robakis, N. K. et al. (2004b). The presenilin-1 familial Alzheimer disease mutant P117L impairs neurogenesis in the hippocampus of adult mice. Exp. Neurol. 188,224 -237.[CrossRef][Medline]
Wines-Samuelson, M., Handler, M. and Shen, J. (2005). Role of presenilin-1 in cortical lamination and survival of Cajal-Retzius neurons. Dev. Biol. 277,332 -346.[CrossRef][Medline]
Wong, P. C., Zheng, H., Chen, H., Becher, M. W., Sirinathsinghji, D. J., Trumbauer, M. E., Chen, H. Y., Price, D. L., Van der Ploeg, L. H. and Sisodia, S. S. (1997). Presenilin 1 is required for notch1 and DII1 expression in the paraxial mesoderm. Nature 387,288 -292.[CrossRef][Medline]
Yamaguchi, M., Saito, H., Suzuki, M. and Mori, K. (2000). Visualization of neurogenesis in the central nervous system using nestin promoter-GFP transgenic mice. NeuroReport 11,1991 -1996.[Medline]
Yuasa, S., Nakajima, M., Aizawa, H., Sahara, N., Koizumi, K., Sakai, T., Usami, M., Kobayashi, S., Kuroyanagi, H., Mori, H. et al. (2002). Impaired cell cycle control of neuronal precursor cells in the neocortical primordium of presenilin-1-deficient mice. J. Neurosci. Res. 70,501 -513.[CrossRef][Medline]
Zimmerman, L., Parr, B., Lendahl, U., Cunningham, M., McKay, R., Gavin, B., Mann, J., Vassileva, G. and McMahon, A. (1994). Independent regulatory elements in the nestin gene direct transgene expression to neural stem cells or muscle precursors. Neuron 12,11 -24.[CrossRef][Medline]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||