|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 3 August 2005
doi: 10.1242/dev.01959
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Organogenesis and Neurogenesis Group, Center for Developmental Biology, RIKEN, Kobe 650-0047, Japan
* Author for correspondence (e-mail: sasaicdb{at}mub.biglobe.ne.jp)
Accepted 28 June 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Xenopus, Foxi1a, Ectoderm, CNS
| Introduction |
|---|
|
|
|---|
Along the anteroposterior (AP) axis, the neural plate is finely
regionalized into the forebrain, midbrain, hindbrain and spinal cord. Recent
molecular studies implicated Wnts, Nodal, Fgfs and RA in the AP
regionalization of the CNS (McGrew et al.,
1995
; Kengaku and Okamoto,
1995
; Piccolo et al.,
1999
; Gavalas and Krumlauf,
2000
; Kiecker and Niehrs,
2001
; Kudoh et al.,
2002
; Onai et al.,
2004
).
In contrast to the CNS, relatively little is known about the AP
specification of the non-CNS (intermediate and epidermal) ectoderm. In
Xenopus, the non-CNS ectoderm of the head region (referred to as
`cephalic non-neural ectoderm' hereafter) has several characteristic features.
For example, unlike that of the trunk, the non-neural ectoderm of the cephalic
region differentiates into the cranial placodes and special exocrine glands
such as the cement gland and hatching gland, in addition to the epidermis and
neural crest. The cranial placodes, which develop within the preplacodal field
of the head intermediate ectoderm, give rise to a number of sensory tissues
(reviewed by Baker and Bronner-Fraser,
2001
). To date, the molecular mechanism underlying the
determination of the cephalic non-neural ectoderm (versus the CNS and the
trunk ectoderm) remains largely to be elucidated.
In this study, we have investigated the molecular control of the initial
specification of the cephalic non-neural ectoderm by focusing on the roles of
a Foxi1 family gene in Xenopus. The winged-helix transcription factor
Foxi1 plays an essential role for the formation of placode-derived ectodermal
tissues such as the otic vesicle (Hulander
et al., 1998
; Nissen et al.,
2003
; Solomon et al.,
2003a
) in mice and zebrafish. In Xenopus, three
Foxi1-related genes have been reported: Xfoxi1a, Xfoxi1b
(pseudoalleles generated by the pseudotetraploidy of Xenopus laevis,
see alignment of Xfoxi1a and Xfoxi1b in
Fig. 1M) and Xfoxi1c
(which is not an Xfoxi1a pseudoallele) are expressed in the
preplacodal area at the neurula stage (Lef
et al., 1994
; Pohl et al.,
2002
).
Interestingly, Xfoxi1a and Xfoxi1b are also expressed
even earlier than the establishment of the preplacodal expression at the
neurula stage; they are expressed widely in the animal side of the embryo at
the late blastula stage and in the anteroventral ectoderm at the late gastrula
stage. By contrast, Xfoxi1c is expressed only after the gastrula
stage and not during the blastula and gastrula stages
(Pohl et al., 2002
). The
expression of a foxi1 gene in a broad domain of the gastrula ectoderm
has been reported also in zebrafish
(Nissen et al., 2003
;
Riley and Phillips, 2003
;
Solomon et al., 2003a
).
However, the role of the Foxi1 family genes during the gastrula stage has not
yet been elucidated. In addition, although several transcription factors have
been implicated in the development of the non-neural ectoderm in
Xenopus (e.g. Dlx3, Msx1, Gata1 and Xvent1/2)
(Onichtchouk et al., 1996
;
Suzuki et al., 1997
;
Ault et al., 1997
;
Onichtchouk et al., 1998
;
Feledy et al., 1999
;
Beanan and Sargent, 2000
;
Woda et al., 2003
), none of
them are expressed in a pattern limited to the cephalic non-neural ectoderm
during gastrulation. These facts led us to investigate the role of
Xfoxi1a (including that of the Xfoxi1b; the term
Xfoxi1a/b is used hereafter when the combined functions are
considered) in the head ectoderm of the Xenopus gastrula. By focusing
on the role at the early stage, we demonstrate that Xfoxi1a/b is
essential for the specification of the non-neural ectoderm in the head. We
also show that Xfoxi1a/b misexpression promotes epidermal
differentiation at the cost of neural tissues. We discuss a possible mode of
the Xfoxi1a/b action, focusing on the critical period of
Xfoxi1a/b-mediated ectodermal patterning.
| Materials and methods |
|---|
|
|
|---|
Embryonic manipulations
Eggs were collected from adult Xenopus laevis and fertilized in
vitro as described previously (Sasai et
al., 2001
). Embryos were staged according to Nieuwkoop and Faber
(Nieuwkoop and Faber, 1967
).
After dejellying the embryo by treatment with 2% cysteine (pH 7.8),
microinjection was carried out in 1x Barth's solution. Embryos were
grown in 0.1x Barth's solution until sibling embryos reached the desired
stage. For animal cap assays, ectodermal explants were excised at stage 9 and
then cultured in 1x LCMR supplemented with 0.2% BSA until the stages
mentioned. For the treatment of the embryo with dexamethasone (Dex), Dex was
added to the 0.1x Barth's solution to a 10 µM final concentration at
stage 11 or 13, as described by Gammill and Sive
(Gammill and Sive, 1997
). The
embryos were harvested at the neurula stage.
Microinjection and whole-mount in situ hybridization
Capped mRNAs for the microinjection were synthesized by using an SP6
mMassage Machine kit (Ambion, Austin, TX) according to the
manufacturer's protocol. RNA was injected into all animal blastomeres or into
the unilateral blasomeres of eight-cell embryos. Morpholino antisense
oligonucleotides (Gene Tools, Philomath, OR) were designed against the
5' regions (see Fig. 3A) of Xfoxi1a (Xfoxi1a-MO,
5'-GATCAGCGGCTTCTGCTCTTTCCCA-3') and Xfoxi1b
(Xfoxi1b-MO, 5'-GGTTCATCTCGCTCACTGGCTAATC-3').
Oligonucleotides with five mismatches (5-mis-Xfoxi1a,
5'-GATCAcCGGgTTCTcCTgTTTCgCA-3'; 5-mis-Xfoxi1b,
5'-GGTTgATgTCGCTgACTcGCTAtTC-3') were used as negative controls.
For the rescue experiment, wild-type Xfoxi1a mRNA lacking the
5'-UTR sequence was co-injected with Xfoxi1a-MO (containing no
complimentary sequence). After fixing the embryo with MEMFA at the appropriate
stage, whole-mount in situ hybridization was performed as described previously
(Sasai et al., 2001
). For
double in situ hybridization, fluorescein-labeled probe was stained with BCIP
(Roche, Mannheim, Germany) and digoxigenin-labeled probe was stained with
BM-purple (Roche, Germany) or Magenta-Phos (Biosynth, Switzerland). All of the
injection experiments were carried out at least twice and gave reproducible
results.
RT-PCR analysis
RT-PCR was performed as described previously
(Mizuseki et al., 1998
;
Kuo et al., 1998
;
Tsuda et al., 2002
). The other
primers used first in this study were as follows: Dlx3
(Papalopulu and Kintner, 1993
;
Dirksen et al., 1994
) (forward
primer, ATGAGTGGCCCCTATGAGAAGAAG; reverse primer, GGTTCTCTGTAATGGACAAACGG);
Sox2 (Mizuseki et al.,
1998
) (forward primer, GAGGATGGACACTTATGCCCAC; reverse primer,
GGACATGCTGTAGGTAGGCGA), Bmp4 (Dale
et al., 1992
) (forward primer, GCATGTACGGATAAGTCGATC; reverse
primer, GATCTCAGACTCAACGGCAC), Xfoxi1a
(Lef et al., 1994
) (forward
primer, CCAGAACTGAAATCTTAGCAA; reverse primer, TAACAAAGATAAAGCCAGAGGT),
MyoD (Hopwood et al.,
1989
) (forward primer, AGGTCCAACTGCTCCGACGGCATGAA; reverse primer,
AGGAGAGAATCCAGTTGATGGAAACA), H4
(Perry et al., 1985
) (forward
primer, CGGGATAACATTCAGGGTATCACT; reverse primer,
ATCCATGGCGGTAACTGTCTTCCT).
Western blot
Animal caps were lysed in the extraction buffer [20 mM HEPES (pH 7.9), 420
mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5% NP-40, 1:100 dilution of
protease inhibitor cocktail; Cytoskeleton, Denver, CO] and cleared by
micro-centrifugation at 20,000 g for 10 minutes. Aliquots of
10-30 µg proteins were resolved by 10% SDS-PAGE and then blotted on to a
PVDF membrane filter (Millipore, MA). For the primary antibody, anti-FLAG M2
mouse monoclonal antibody (1:1000, Sigma) was used. For the secondary
antibody, an anti-mouse IgG horseradish peroxidase linked F(ab')2
fragment (1:5000, Amersham) was used. Signals were detected with ECL reagents
(Amersham).
| Results |
|---|
|
|
|---|
|
Bmp and anti-Wnt signals induce Xfoxi1a expression
The in situ hybridization analysis above shows that Xfoxi1a is
expressed specifically in the anteroventral (or cephalic non-neural) ectoderm
during the mid-gastrula and early neurula stages. We next investigated
patterning signals that controlled the spatial expression of Xfoxi1a
during these stages, by focusing on the roles of Bmp and Wnt signals. When
Bmp4 (2.5 pg of the expression plasmid DNA per cell)
(Dale et al., 1992
) was
injected into all animal blastomeres at the eight-cell stage, Xfoxi1a
expression significantly expanded into the dorsal ectoderm at stage 12 (77%,
n=13; Fig. 2B),
whereas overexpression of the Bmp antagonist Chd (50 pg RNA/cell)
(Sasai et al., 1995
)
suppressed Xfoxi1a expression (83%, n=12;
Fig. 2C). We then performed
experiments using the ectodermal explants (animal cap assay) to distinguish
direct effects on the ectoderm from secondary effects via the mesoderm.
Consistent with the in vivo observation, Xfoxi1a expression was
diminished by Chd injection in the animal cap assay
(Fig. 2K-M,O,P), but its
expression was rescued by co-injection of Bmp4
(Fig. 2K, lane 4), indicating
that Bmp signaling positively regulates Xfoxi1a expression by
directly acting in the ectoderm.
We next studied the role of Wnt signaling in Xfoxi1a expression.
Microinjection of a Wnt1-expression plasmid (2.5 pg DNA/cell) into
the animal blastomeres markedly reduced Xfoxi1a expression (100%,
n=14; Fig. 2D). By
contrast, overexpression of the Wnt inhibitor gene Dkk1 (125 pg/cell)
(Glinka et al., 1998
) resulted
in the expansion of Xfoxi1a expression into the posteroventral
ectoderm (38%, n=16; Fig.
2E). Consistent with this, the animal cap assay showed that
Wnt1 suppressed Xfoxi1a expression in ectodermal explants
(100%, n=30; Fig.
2L,N), without inducing Sox2
(Fig. 2O,Q).
These findings suggest that Xfoxi1a expression in the gastrula ectoderm is regulated positively by Bmp signals and negatively by Wnt signals; this regulation presumably occurs as a consequence of the modifications that specify the DV (ventralization by Bmp4) and AP (posteriorization by Wnt) ectodermal identities. Consistent with this idea, Xfoxi1a expression in the neurula ectoderm (Fig. 2F) was suppressed by Chd (93.8%, n=16; Fig. 2H) and by pCS2Wnt1 (93.8%, n=16; Fig. 2I), and upregulated by Dkk1 (100%, n=15; Fig. 2J). In contrast to the effect on the gastrula ectoderm (Fig. 2B), injection of pCS2Bmp4 did not cause expansion of Xfoxi1a in the neurula head ectoderm (n=16; Fig. 2G), suggesting that late Xfoxi1a expression requires finer local regulation in the neurula ectoderm.
|
|
|
|
In the animal cap assay (Fig.
5F), the co-injection of Xfoxi1a suppressed the
Chd-induced Sox2 expression (lanes 3 and 4), while the
expressions of the epidermal/non-neural ectodermal markers (XK81, Dlx3,
Msx1 and Xfoxi1a), which were suppressed by Chd, were
rescued. The mesodermal marker MyoD was not induced regardless of the
mRNA injection. Next, we further analyzed the relationship between
Xfoxi1a and Bmp signaling by co-injecting with the dominant-negative
Bmp receptor (dnBMPR) (Suzuki et
al., 1994
). Neural differentiation caused by dnBMPR
injection in the animal cap was suppressed by co-injecting Xfoxi1a
(Fig. 5G). Although Bmp
signaling was blocked at the receptor level, Sox2 was suppressed by
Xfoxi1a, while the non-neural ectodermal marker XK81 was
induced (lanes 3 and 4). These suggest that Xfoxi1a does not act
upstream of BMPR, but rather functions downstream and/or in a parallel
fashion. Taken together, these findings indicate that Xfoxi1a
promotes epidermal differentiation at the cost of neural differentiation both
in vivo and in vitro.
Xfoxi1a overexpression in the embryo suppressed the intermediate ectodermal markers FoxD3 and Six1 (67%, n=43, 59%, n=59, respectively; Fig. 5D,E). These phenotypes were similar to those with the loss-of Xfoxi1a function (Fig. 3H,J), suggesting the possibility that the inhibition by Xfoxi1a overexpression involves certain indirect effects on the specification of the intermediate ectoderm.
|
| Discussion |
|---|
|
|
|---|
The present work has introduced a new role for a Foxi1 family member, Xfoxi1a/b, in the ventral specification of the early head ectoderm during gastrulation. During the mid- and late gastrula stages, Xfoxi1a/b is expressed in the anteroventral ectoderm. This gastrula expression is complementary to that of Sox2, indicating that all of the head ectoderm except for the neural plate tissues expresses Xfoxi1a (Fig. 1). Consistently, the loss-of-function study has demonstrated that Xfoxi1a/b is essential for the proper development of the non-neural domain of the head ectoderm (epidermis, cement gland, neural crest and placodes) and for suppression of the ectopic expansion of the neural plate (Fig. 3). Conversely, misexpression of Xfoxi1a induces ectopic keratin expression and suppresses Sox2 expression in the neural plate region (Fig. 5). This activity of Xfoxi1a is limited to the gastrula stage (Fig. 6). These results indicate that Xfoxi1a/b plays a pivotal role for the `neural versus non-neural' decision of the head ectoderm during gastrulation.
In the animal cap study, overexpression of Xfoxi1a inhibits neural differentiation caused by the injection of Chd (Fig. 5D) or dnBMPR (Fig. 5G), demonstrating that Xfoxi1a can exert an anti-neuralizing activity in the isolated ectodermal tissue. In addition, as the effect of dnBMPR is reversed by Xfoxi1a, it is likely that Xfoxi1a does not act upstream of Bmpr (although Xfoxi1a weakly induces Bmp4 in the animal cap; Fig. 5G, lane 4), but rather acts downstream of Bmpr or in parallel.
Interestingly, Xfoxi1a/b-MO injection (at the amount sufficient
for keratin suppression and Sox2 expansion in vivo) suppresses the
epidermal markers (XK81, Msx1 and Dlx3) but does not induce
the neural marker Sox2 in the animal cap explant
(Fig. 4). This suggests the
possibility that the expansion of Sox2 expression by
Xfoxi1a/b-MO in vivo (Fig.
3) depends on some additional factors, although Xfoxi1a/b
regulates the epidermal fate determination in a tissue-autonomous manner. This
idea is supported by our preliminary observation that the ectopic
Sox2 expression in the embryo is always limited to the lateral region
of the head ectoderm and not found in the more ventral region. One candidate
factor may be Fgf signals, as a recent report
(Delaune et al., 2005
) has
shown that Fgf signaling is required for anti-Bmp factors to induce ectopic
Sox2 expression in the ventral-most part of the ectoderm.
The molecular mechanism underlying the regulation of ventral specification
of the head ectoderm by Xfoxi1a/b remains elusive. Dlx3 and
Msx1, which are required for non-neural ectodermal development
(Suzuki et al., 1997
;
Feledy et al., 1999
;
Beanan and Sargent, 2000
;
Woda et al., 2003
), may be
among candidate mediators of Xfoxi1a/b activities as their expression
is positively regulated by Xfoxi1a (Figs
3,
4,
5 and data not shown). The
exact relationship between these factors and Xfoxi1a should be
carefully analyzed along the temporal axis by using the combination of MOs and
inducible constructs in future investigation. Our preliminary study has shown
that Xfoxi1a-MO injection (which causes the expansion of
Sox2 expression) does not significantly suppress Bmp4
expression in the head region (data not shown). This suggests that the effect
of Xfoxi1a-MO is not primarily mediated by the inhibition of
Bmp4 expression, consistent with the dnBMPR study. In
future, it will be important to systematically identify downstream target
genes (and possible co-factors) of Xfoxi1a in the ventral
specification.
Roles of Xfoxi1a/b in the patterning of the intermediate head ectoderm
This study has mainly focused on the role of the early Xfoxi1a/b
function in the ventral specification of the head ectoderm during
gastrulation. Later, by the mid-neurula stage, Xfoxi1a expression
fades in the ventralmost area of the head ectoderm and becomes limited to the
preplacodal region (Fig. 1).
Although this late expression pattern of Xfoxi1a/b seems relevant to
the requirement of the Foxi1 family genes for proper development of
the head placodes of other species
(Hulander et al., 1998
;
Lee et al., 2003
;
Nissen et al., 2003
;
Solomon et al., 2003a
), the
exact role of Xfoxi1a/b in late ectodermal patterning requires more
careful interpretation. The intermediate head ectoderm (which gives rise to
the neural crest, cement gland and preplacodal region) is complex and contains
considerable heterogeneity even within the preplacodal region
(Schlosser and Ahrens,
2004
).
An intriguing but slightly puzzling observation regarding the role in the
regulation of intermediate ectodermal genes is that the phenotypes caused by
Xfoxi1a overexpression are basically the same as those with the
loss-of Xfoxi1a function; both result in suppression of
FoxD3 and Six1 (Figs
3 and
5). This is in contrast to the
situation of the regulation of Sox2 and XK81 by
Xfoxi1a/b, in which gain- and loss-of-function experiments show the
opposite phenotypes (Figs 3 and
5). One interpretation of this
discrepancy is that Xfoxi1a affects the development of the
intermediate head ectoderm in a non-cell-autonomous fashion; both augmentation
and attenuation of Xfoxi1a may interfere with the interactions
between the neural plate and epidermis, which are required for the proper
differentiation of the intermediate ectoderm
(Dickinson et al., 1995
;
Selleck and Bronner-Fraser,
1995
; Mancilla and Mayor,
1996
; LaBonne and
Bronner-Fraser, 1999
; Glavic
et al., 2004
). This idea is in agreement with the largely
non-overlapping expression patterns of Xfoxi1a and Six1 or
FoxD3 in the mid-neurula (Fig.
1H and data not shown). Alternatively, the role of
Xfoxi1a could be cell-autonomous, given that Xfoxi1a is
expressed throughput the Sox2-negative head ectoderm (which should
include the intermediate ectoderm) at the mid-gastrula stage
(Fig. 1D), unlike at the
mid-neurula stage (Fig. 1G). In
this case, the gain- and loss-of-function phenotypes in the intermediate head
ectoderm should be caused by distinct mechanisms.
The study with GR-Xfoxi1a suggests that the inhibitory effects of Xfoxi1a on the intermediate ectodermal markers are related to the Xfoxi1a activity before the late gastrula stage (Fig. 6). FoxD3 and Six1 expressions at the neurula stage are clearly suppressed when GR-Xfoxi1a-injected embryos are treated with Dex from stage 11 but not from stage 13 (Fig. 6G-L). However, as the neural plate marker Sox2 is affected in a similar manner (Fig. 6A-C), it remains to be clarified whether the suppression of FoxD3 and Six1 is directly or indirectly caused by Xfoxi1a.
Regulation of early Xfoxi1a expression
Early Xfoxi1a expression in the anteroventral ectoderm (stage 12)
is strongly influenced by Bmp and Wnt signals
(Fig. 2). Working as upstream
regulators, Bmp signaling positively controls Xfoxi1a expression in
the ectoderm whereas Wnt signaling has a negative effect. The role of Bmp in
the DV patterning of the cephalic non-neural ectoderm described here is in
agreement with a previous report (Wilson
et al., 1997
). Although Wnt signals are known to be crucial for
the AP patterning of the CNS (and of the mesoderm), experimental knowledge
about their roles in the AP patterning of the non-neural ectoderm has been
limited. Both our in vivo and in vitro analyses
(Fig. 2) have shown that Wnt
signaling suppresses Xfoxi1a, indicating a direct regulatory role of
Wnts in the determination of the cephalic non-neural ectoderm. A consistent
effect of Wnt signals on Xfoxi1a expression is also found in the
neurula embryo (Fig. 2I,J).
By contrast, the late Xfoxi1a expression at the neurula stage responds to Bmp4 in a slightly different manner. Although Xfoxi1a expression is also suppressed by Chd, injection of the Bmp-expression plasmid does not upregulate Xfoxi1a expression at this stage (Fig. 2G,H). This may be explained by the stage-dependent difference of the Xfoxi1a expression domains. In contrast to the wide expression domain in the anteroventral ectoderm at the late gastrula stage, Xfoxi1a expression at the mid-neurula stage is limited to a band in the head ectoderm, which is narrow in the dorsoventral direction (Fig. 1F). Therefore, it is likely that the late Xfoxi1a expression requires some additional positional information other than the ventralizing signal of Bmp4.
The present study suggests a role of Xfoxi1a/b as an important player that mediates early patterning signals (such as Bmp and Wnt) in the ventral specification of the head ectoderm. Further studies of the regulation and function of Xfoxi1a/b should improve our understanding of the molecular mechanisms that underlie the complex multiple-step patterning of the vertebrate head ectoderm.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Ault, K. T., Xu, R.-H, Kung, H.-F. and Jamrich, M.
(1997). The homeobox gene PV.1 mediates specification of
the prospective neural ectoderm in Xenopus embryos. Dev.
Biol. 192,162
-171.[CrossRef][Medline]
Baker, C. V. and Bronner-Fraser, M. (2001).
Vertebrate cranial placodes I. Embryonic induction. Dev.
Biol. 232,1
-61.[CrossRef][Medline]
Beanan, M. J. and Sargent, T. D. (2000).
Regulation and function of Dlx3 in vertebrate development. Dev.
Dyn. 218,545
-553.[CrossRef][Medline]
Dale, L., Howes, G., Price, B. M. and Smith, J. C.
(1992). Bone morphogenetic protein 4, a ventralizing
factor in early Xenopus development.
Development 115,573
-585.[Abstract]
David, R., Ahrens, K., Wedlich, D. and Schlosser, G.
(2001). Xenopus Eya1 demarcates all neurogenic placodes
as well as migrating hypaxial muscle precursors. Mech.
Dev. 103,189
-192.[CrossRef][Medline]
Delaune, E., Lemaire, P. and Kodjabachian, L.
(2005). Neural induction in Xenopus requires early FGF
signaling in addition to BMP inhibition. Development
132,299
-310.
Dickinson, M. E., Selleck, M. A., McMahon, A. P. and
Bronner-Fraser, M. (1995). Dorsalization of the neural tube
by the non-neural ectoderm. Development
121,2099
-2106.[Abstract]
Dirksen, M.-L., Marasso, M. I., Sargent, T. D. and Jamrich,
M. (1994). Diffrerential expression of a Distal-less
homeobox gene Xdll-2 in ectodermal cell lineages. Mech.
Dev. 46,63
-70.[CrossRef][Medline]
Feledy, J. A., Beanan, M. J., Sandoval, J. J., Goodrich, J. S.,
Lim, J. H., Matsuo-Takasaki, M., Sato, S. M. and Sargent, T. D.
(1999). Inhibitory patterning of the anterior neural plate in
Xenopus by homeodomain factors Dlx3 and Msx1. Dev.
Biol. 212,455
-464.[CrossRef][Medline]
Gammill, L. S. and Sive, H. (1997).
Identification of otx2 target genes and restrictions in ectodermal competence
during Xenopus cement gland formation.
Development 124,471
-481.[Abstract]
Gavalas, A. and Krumlauf, R. (2000). Retinoid
signalling and hindbrain patterning. Curr. Opin. Genet.
Dev. 10,380
-386.[CrossRef][Medline]
Ghanbari, H., Seo, H. C., Fjose, A. and Brandli, A. W.
(2001). Molecular cloning and embryonic expression of
Xenopus Six homeobox genes. Mech. Dev.
101,271
-277.[CrossRef][Medline]
Glavic, A., Maris Honore, S., Gloria Feijoo, C., Bastidas, F.,
Allende, M. L. and Mayor, R. (2004). Role of BMP
signaling and the homeoprotein Iroquois in the specification of the cranial
placodal field. Dev. Biol.
272,89
-103.[CrossRef][Medline]
Glinka, A., Wu, W., Delius, H., Monaghan, A. P., Blumenstock, C.
and Niehrs, C. (1998). Dickkopf-1 is a member of a new
family of secreted proteins and functions in head induction.
Nature 391,357
-362.[CrossRef][Medline]
Hollenberg, S. M., Weinberger, C., Ong, E. S., Cerelli, G., Oro,
A., Lebo, R., Thompson, E. B., Rosenfeld, M. G. and Evans, R. M.
(1985). Primary structure and expression of a functional human
glucocorticoid receptor cDNA. Nature
318,635
-641.[CrossRef][Medline]
Hollenberg, S. M., Cheng, P. F. and Weintraub, H.
(1993). Use of a conditional MyoD transcription factor in studies
of MyoD trans-activation and muscle determination. Proc. Natl.
Acad. Sci. USA 90,8028
-8032.
Hopwood, N. D., Pluck, A. and Gurdon, J. B.
(1989). MyoD expression in the forming somites is an early
response to mesoderm induction in Xenopus embryos. EMBO
J. 8,3409
-3417.[Medline]
Hulander, M., Wurst, W., Carlsson, P. and Enerback, S.
(1998). The winged helix transcription factor Fkh10 is required
for normal development of the inner ear. Nat. Genet.
20,374
-376.[CrossRef][Medline]
Jonas, E., Sargent, T. D. and Dawid, I. B.
(1985). Epidermal keratin gene expressed in embryos of
Xenopus laevis. Proc. Natl. Acad. Sci. USA
82,5413
-5417.
Kengaku, M. and Okamoto, H. (1995). bFGF as a
possible morphogen for the anterior axis of the central nervous system in
Xenopus. Development.
121,3121
-3130.[Abstract]
Kiecker, C. and Niehrs, C. (2001). A morphogen
gradient of Wnt/beta-catenin signalling regulates anteroposterior neural
patterning in Xenopus. Development
128,4189
-4201.
Kolm, P. J. and Sive, H. L. (1995). Efficient
hormone-inducible protein function in Xenopus laevis. Dev.
Biol. 171,267
-272.[CrossRef][Medline]
Kudoh, T., Wilson, S. W. and Dawid, I. B.
(2002). Distinct roles for Fgf, Wnt and retinoic acid in
posteriorizing the neural ectoderm. Development
129,4335
-4346.[Medline]
Kuo, J. S., Patel, M., Gamse, J., Merzdorf, C., Liu, X., Apekin,
V. and Sive, H. (1998). Opl: a zinc finger protein
that regulates neural determination and patterning in Xenopus.Development 125,2867
-2882.[Abstract]
LaBonne, C. and Bronner-Fraser, M. (1998).
Neural crest induction in Xenopus: evidence for a two-signal model.
Development 125,2403
-2414.[Abstract]
LaBonne, C. and Bronner-Fraser, M. (1999)
Molecular mechanisms of neural crest formation. Annu. Rev. Cell
Dev. Biol. 15,81
-112.[CrossRef][Medline]
Lee, S. A., Shen, E. L., Fiser, A. M., Sali, A. and Guo, S.
(2003). The zebrafish forkhead transcription factor Foxi1
specifies epibranchial placode-derived sensory neurons.
Development 130,2669
-2679.
Lef, J., Clement, J. H., Oschwald, R., Köster, M. and
Knöchel, W. (1994). Spatial and temporal transcription
patterns of the forkhead related XFD-2/XFD-2' genes in Xenopus
laevis embryos. Mech. Dev.
45,117
-126.[CrossRef][Medline]
Mancilla, A. and Mayor, R. (1996). Neural crest
formation in Xenopus laevis: mechanisms of Xslug induction.
Dev. Biol. 177,580
-589.[CrossRef][Medline]
Marchant, L., Linker, C., Ruiz, P., Guerrero, N. and Mayor,
R. (1998). The inductive properties of mesoderm suggest that
the neural crest cells are specified by BMP gradient. Dev.
Biol. 198,319
-329.[Medline]
McGrew, L. L., Lai, C. J. and Moon, R. T.
(1995). Specification of the anteroposterior neural axis through
synergistic interaction of the Wnt signaling cascade with noggin and
follistatin. Dev. Biol.
172,337
-342.[CrossRef][Medline]
Mizuseki, K., Kishi, M., Matsui, M., Nakanishi, S. and Sasai,
Y. (1998). Xenopus Zic-related-1 and Sox-2, two
factors induced by chordin, have distinct activities in the initiation of
neural induction. Development
125,579
-587.[Abstract]
Nieuwkoop, P. D. and Faber, J. (1967).Nomal Table of Xenopus laevis
. North-Holland,
Amsterdam: Daudin.
Nissen, R. M., Yan, J., Amsterdam, A., Hopkins, N. and Burgess,
S. M. (2003). Zebrafish foxi one nodulates cellular
responses to Fgf signaling required for the integrity of ear and jaw
patterning. Development
130,2543
-2554.
Ohyama, T. and Groves, A. K. (2004). Expression
of mouse Foxi class genes in early craniofacial development. Dev.
Dyn. 231,640
-646.[CrossRef][Medline]
Onai, T., Sasai, N., Matsui, M. and Sasai, Y.
(2004). Xenopus XsalF: anterior neuroectodermal
specification by attenuating cellular responsiveness to Wnt signaling.
Dev. Cell 7,95
-106.[CrossRef][Medline]
Onichtchouk, D., Gawantka, V., Dosch, R., Delius, H.,
Hirschfeld, K., Blumenstock, C. and Niehrs, C. (1996). The
Xvent-2 homeobox gene is part of BMP-4 signalling pathway
controling dorsoventral patterning of Xenopus mesoderm.
Development 122,3045
-3053.[Abstract]
Onichtchouk, D., Glinka, A. and Niehrs, C.
(1998). Requirement for Xvent-1 and Xvent-2
gene function in dorsoventral patterning of Xenopus mesoderm.
Development 125,1447
-1456.[Abstract]
Pandur, P. D. and Moody, S. A. (2000).
Xenopus Six1 gene is expressed in neurogenic cranial placodes and
maintained in the differentiating lateral lines. Mech.
Dev. 96,253
-257.[CrossRef][Medline]
Papalopulu, N. and Kintner, C. (1993).
Xenopus Distal-less related homeobox genes are expressed in the
developing forebrain and are induced by planar signals.
Development 117,961
-975.[Abstract]
Perry, M., Thomsen, G. H. and Roeder, R. G.
(1985). Genomic organization and nucleotide sequence of two
distinct histone gene clusters from Xenopus laevis. Identification of
novel conserved upstream sequence elements. J. Mol.
Biol. 185,479
-499.[CrossRef][Medline]
Piccolo, S., Agius, E., Leyns, L., Bhattashayya, S., Grunz,
H., Bouwmeester, T. and De Robertis, E. M. (1999). The
head inducer is a multifunctional antagonist of Nodal, BMP and Wnt signals.
Nature 397,707
-710.[CrossRef][Medline]
Pohl, B. S., Knöchel, S., Dillinger, K. and Knöchel,
W. (2002). Sequence and expression of FoxB2 (XFD-5) and
FoxI1c (XFD-10) in Xenopus embryogenesis. Mech.
Dev. 117,283
-287.[CrossRef][Medline]
Riley, B. B. and Phillips, B. T. (2003).
Ringing in the new ear: resolution of cell interactions in otic development.
Dev. Biol. 261,289
-312.[CrossRef][Medline]
Sasai, N., Mizuseki, K. and Sasai, Y. (2001).
Requirement of FoxD3-class signaling for neural crest determination in
Xenopus. Development
128,2525
-2536.
Sasai, Y., Lu, B., Steinbeisser, H. and De Robertis, E. M.
(1995). Regulation of neural induction by the Chd and Bmp-4
antagonistic patterning signals in Xenopus. Nature
376,333
-336.[CrossRef][Medline]
Schlosser, G. and Northcutt, R. G. (2000).
Development of neurogenic placodes in Xenopus laevis. J. Comp.
Neurol. 418,121
-146.[CrossRef][Medline]
Schlosser, G. and Ahrens, K. (2004). Molecular
anatomy of placode development in Xenopus laevis. Dev.
Biol. 271,439
-466.[CrossRef][Medline]
Selleck, M. A. and Bronner-Fraser, M. (1995).
Origins of the avian neural crest: the role of neural plate-epidermal
interactions. Development
121,525
-538.[Abstract]
Sive, H. L., Hattori, K. and Weintraub, H.
(1989). Progressive determination during formation of the
anteroposterior axis in Xenopus laevis. Cell
58,171
-180.[CrossRef][Medline]
Solomon, K. S., Kudoh, T., Dawid, I. B. and Fritz, A.
(2003a). Zebrafish foxi1 mediates otic placode formation and jaw
development. Development
130,929
-940.
Solomon, K. S., Logsdon, J. M. and Fritz, A.
(2003b). Expression and phyogenetic analyses of three zebrafish
FoxI class genes. Dev. Dyn.
230,419
-433.
Suzuki, A., Thies, R. S., Yamaji, N., Song, J. J., Wozney, J.
M., Murakami, K. and Ueno, N. (1994). A truncated bone
morphogenetic protein receptor affects dorsal-ventral patterning in the early
Xenopus embryo. Proc. Natl. Acad. Sci. USA
91,10255
-10259.
Suzuki, A., Ueno, N. and Hemmati-Brivanlou, A.
(1997). Xenopus msx1 mediates epidermal induction and
neural inhibition by BMP4. Development
124,3037
-3044.[Abstract]
Tríbulo, C., Aybar, M. J., Nguyen, V. H., Mullins, M. C.
and Mayor, R. (2003). Regulation of Msx1 genes by BMP
gradient is essential for neural crest specification.
Development 130,6441
-6452.
Tsuda, H., Sasai, N., Matsuo-Takasaki, M., Sakuragi, M.,
Murakami, Y. and Sasai, Y. (2002). Dorsalization of the
neural tube by Xenopus tiarin, a novel patterning factor secreted by
the flanking nonneural head ectoderm. Neuron
33,515
-528.[CrossRef][Medline]
Turner, D. L. and Weintraub, H. (1994).
Expression of achaete-scute homolog 3 in Xenopus embryos converts
ectodermal cells to a neural fate. Genes Dev.
8,1434
-1447.
Wilson, P. A., Lagna, G., Suzuki, A. and Hemmati-Brivanlou,
A. (1997). Concentration-dependent patterning of the
Xenopus ectoderm by BMP4 and its signal transducer Smad1.
Development 124,3177
-3184.[Abstract]
Woda, J. M., Pastagia, J., Mercola, M. and Artinger, K. B.
(2003). Dlx proteins position the neural plate border and
determine adjacent cell fates. Development
130,331
-342.
This article has been cited by other articles:
![]() |
K. Baba, K. Okada, T. Kinoshita, and S. Imaoka Bisphenol A Disrupts Notch Signaling by Inhibiting Gamma-Secretase Activity and Causes Eye Dysplasia of Xenopus laevis Toxicol. Sci., April 1, 2009; 108(2): 344 - 355. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Mir, M. Kofron, A. M. Zorn, M. Bajzer, M. Haque, J. Heasman, and C. C. Wylie FoxI1e activates ectoderm formation and controls cell position in the Xenopus blastula Development, February 15, 2007; 134(4): 779 - 788. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Liu, Y. Tang, T. Qiu, X. Cao, and T. L. Clemens A Dishevelled-1/Smad1 Interaction Couples WNT and Bone Morphogenetic Protein Signaling Pathways in Uncommitted Bone Marrow Stromal Cells J. Biol. Chem., June 23, 2006; 281(25): 17156 - 17163. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||