|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 10 August 2005
doi: 10.1242/dev.02003
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Animal Biology, School of Veterinary Medicine, University of
Pennsylvania, Philadelphia, PA 19104, USA
2 Howard Hughes Medical Institute, Whitehead Institute, and Department of
Biology, Massachusetts Institute of Technology, 9 Cambridge Center, Cambridge,
MA 02142, USA
3 Institute for Frontier Medical Sciences, Kyoto University, Sakyo-ku, Kyoto
606-8507, Japan
* Author for correspondence (e-mail: pwang{at}vet.upenn.edu)
Accepted 18 July 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Rnf17, Nuage, Tudor, RING, Spermiogenesis, Mouse
| Introduction |
|---|
|
|
|---|
Nuage is found in germ cells of diverse organisms
(al-Mukhtar and Webb, 1971
;
Eddy, 1974
;
Mahowald, 1968
). The term
nuage refers to various forms of electron-dense cellular material that are
amorphous and are not surrounded by membranes. The most extensively
characterized nuage is the Drosophila polar granule
(Mahowald, 1968
). The polar
granule is present in the cytoplasm of oocytes and is required for germ cell
specification during embryogenesis
(Mahowald, 2001
). Components
of polar granules include Tudor and Vasa
(Bardsley et al., 1993
;
Hay et al., 1988
;
Thomson and Lasko, 2004
). The
Drosophila Tudor protein contains 10 copies of what has been termed
the tudor domain. The function of tudor domain is unknown
(Ponting, 1997
).
The mouse Vasa homolog (MVH) is a component of chromatoid bodies in
mammalian germ cells (Toyooka et al.,
2000
). MVH is required for spermatogenesis in mice
(Tanaka et al., 2000
). The
chromatoid body is a prominent multi-lobular nuage found in the cytoplasm of
spermatocytes and spermatids (Eddy,
1970
; Sud, 1961a
).
The function of chromatoid bodies is not known. Interestingly, mouse TDRD1
(also referred to as MTR-1), containing four tudor domains, is also a
component of the chromatoid body (Chuma et
al., 2003
). In addition to the chromatoid body, early
ultrastructural studies identified as many as five other types of nuage in rat
male germ cells, including chromatoid satellites, sponge bodies and spherical
particles (Fawcett et al.,
1970
; Russell and Frank,
1978
). Frequently, little distinction is made between these lesser
known nuages and chromatoid bodies, largely owing to a lack of specific
cytological markers that might distinguish among them.
Recent microarray analyses have shown that haploid germ cells express a far
greater number of germ cell-specific genes than spermatogonia and
spermatocytes (Schultz et al.,
2003
; Shima et al.,
2004
). By contrast, only five mutants generated by gene targeting
caused complete arrest in spermiogenesis, in which spermatids failed to
produce spermatozoa. These five genes [Crem, Miwi (Piwil1 -
Mouse Genome Informatics), Trf2 (Tbpl1 - Mouse Genome
Informatics), Tpap (Papolb - Mouse Genome Informatics) and
Ddx25] constitute a unique group of so-called `key regulators of
spermiogenesis' (Blendy et al.,
1996
; Deng and Lin,
2002
; Kashiwabara et al.,
2002
; Martianov et al.,
2001
; Nantel et al.,
1996
; Tsai-Morris et al.,
2004
; Zhang et al.,
2001
). CREM is a transcriptional activator
(Blendy et al., 1996
;
Nantel et al., 1996
). MIWI is
a cytoplasmic protein and is associated with mRNAs
(Deng and Lin, 2002
).
Disruption of Crem or Miwi results in arrest of round
spermatids at step 4. TRF2 is a TBP (TATA-binding protein)-related
transcription factor (Martianov et al.,
2001
; Zhang et al.,
2001
). TPAP is a testis-specific cytoplasmic poly(A) polymerase
(Kashiwabara et al., 2002
).
Spermiogenesis proceeds up to step 7 in mice that lack either TRF2 or TPAP.
DDX25 is a testicular RNA helicase. Lack of DDX25 causes round spermatid
arrest at step 8 (Tsai-Morris et al.,
2004
). These key regulators appear to define distinct regulatory
pathways of spermiogenesis, even though they may regulate some common target
genes or transcripts. They share two common features. First, the arrest of
spermiogenesis is complete and uniform in mutant mice. Second, each key
regulator affects the transcription or translation of multiple (even hundreds
of) genes or transcripts, suggesting that they function as `master switches'
of spermiogenesis.
Here, we describe studies of a novel key regulator of spermiogenesis called
Rnf17. We previously showed that Rnf17 is specifically
expressed in testis (Wang et al.,
2001
). RNF17 contains a RING finger motif and tudor domains. The
RING finger motif is present in many ubiquitin E3 ligases
(Joazeiro and Weissman, 2000
;
Lorick et al., 1999
). RNF17
interacts with all four members of the Mad family (Mad1, Mxi1, Mad3 and Mad4),
which are basic-helix-loop-helix-leucine zipper (bHLH-ZIP) transcription
factors of the Myc oncoprotein network
(Yin et al., 1999
). Mad
proteins repress transcription of Myc-responsive genes by binding to Max (a
bHLH-ZIP protein). Mad-Max heterodimers compete with Myc-Max heterodimers for
the same `myc box sequence' CAC/TGTG in the Myc-responsive genes
(Grandori et al., 2000
). RNF17
was able to activate transcription of Myc-responsive genes by recruiting Mad
proteins from the nucleus to the cytoplasm
(Yin et al., 2001
;
Yin et al., 1999
). In this
report, we identify RNF17 as an integral component of the RNF17 granule, a
novel nuage in male germ cells. RNF17 forms a complex with itself. We
disrupted Rnf17 in mice by gene targeting and found that animals
lacking Rnf17 were viable but male sterile. The
Rnf17-deficient testis displayed a complete arrest in
spermiogenesis.
| Materials and methods |
|---|
|
|
|---|
Generation of antibodies
Two polyclonal anti-RNF17 antibodies were generated. The Rnf17
cDNA fragment encoding the N-terminal 100 residues was cloned into pGEX-4T-1
(Amersham Biosciences). The GST-RNF17 (1-100) fusion protein was expressed in
BL21 bacteria, purified with glutathione-sepharose beads and used to immunize
two rabbits (Cocalico Biologicals), resulting in anti-serum 1774. The
Rnf17l cDNA fragment corresponding to the residues 1341-1540 was
cloned into pQE30 (Qiagen). The 6xHis-RNF17L (1341-1540) fusion protein
was expressed in M15 bacteria, purified with Ni-NTA agarose, eluted in 8 M
urea and used to immunize two guinea pigs (Cocalico Biologicals), resulting in
anti-serum GP8. Specific antibodies were affinity-purified with the immunoblot
method (Harlow and Lane,
1998
).
Western blotting and co-immunoprecipitation
Adult testes were homogenized using a glass homogenizer in the SDS-PAGE
sample buffer (100 mM Tris, pH 8.3, 2% SDS, 200 mM DTT, 10% glycerol, 1 mM
EDTA, 0.025% bromophenol blue). Protein lysate (30 µg) was resolved on 9%
SDS-PAGE gels and electro-blotted onto PVDF membranes. For some experiments,
cytoplasmic and nuclear fractions of testis were prepared using the NE-PER kit
according to the manufacturer's protocol (Pierce). Western blotting was
performed using the following antibodies: anti-serum 1774 (1:500), anti-serum
GP8 (1:500), anti-MVH (1:10,000), anti-SYCP3 (1:2,000) and anti-ß-actin
(1:2,500, Sigma). HRP-conjugated anti-rabbit or anti-guinea pig secondary
antibodies (Sigma) were used.
For immunoprecipitation, one adult testis (80 mg) was homogenized in NP-40 lysis buffer [150 mM NaCl, 1.0% NP-40 and 50 mM Tris (pH 8.0)] in the presence of protease inhibitors (Sigma), incubated at 4°C for 30 minutes, and spun at 10,000 g for 10 minutes. The resulting supernatant was pre-cleared by incubation with 20 µl pre-bleed serum and 20 µl protein A agarose (Invitrogen) for 1 hour at 4°C and by centrifugation at 1000 g for 10 minutes. Subsequently, the supernatant was incubated with 20 µl anti-serum GP8 (RNF17L-specific) or pre-bleed at 4°C overnight, incubated with 20 µl protein A agarose for 1 hour, and spun at 10,000 g for 10 minutes. The pellets were washed with NP-40 lysis buffer five times and proteins were dissolved in 15 µl SDS-PAGE sample buffer. Immunoprecipitated proteins were subjected to western blot analysis with anti-serum 1774.
Immunofluorescence microscopy
Adult testes were fixed in fresh 4% paraformaldehyde (PFA) at 4°C
overnight and were dehydrated in 30% (w/v) sucrose. The testes were embedded
with TBS tissue freezing medium (Fisher Scientific) and frozen at temperatures
below -20°C. Sections (8 µm) were cut using a Reichert-Jung
cryo-microtome. Sections were post-fixed in 4% PFA at room temperature for 10
minutes prior to immunostaining. Primary antibodies used were as follows:
anti-RNF17 (anti-sera 1774 and GP8), rat anti-TDRD1
(Chuma et al., 2003
), rat
anti-LAMP2 (GL2A7, Developmental Studies Hybridoma Bank)
(Granger et al., 1990
) and rat
TRA54 monoclonal antibody (Pereira et al.,
1998
). Texas Red or FITC-conjugated secondary antibodies were
used. Nuclear DNA was stained with DAPI. For immunostaining with anti-TDRD1
antibodies, the testis was fixed in 2% PFA for 30 minutes. Immunostained
sections were visualized under a Zeiss Axioskop 40 fluorescence microscope.
Images were captured with an Evolution QEi digital camera (MediaCybernetics)
and processed with the Image-Pro software (Phase 3 Imaging Systems).
Immuno-electron microscopy (EM)
Immuno-EM was performed as described previously
(Allen et al., 1996
). Briefly,
an adult testis was fixed in 2% PFA and 0.05% glutaraldehyde for 1 hour,
washed with PBS, dehydrated with ethanol at -25°C, embedded in Lowicryl
K4M medium, and polymerized with UV (365 nm) at -25°C for 5 days.
Ultra-thin sections (100 nm) were cut and collected on Formvar-coated Nickel
grid. Ultra-thin sections were immunostained with anti-RNF17 antibodies or
pre-bleed serum and 10 nm gold particle-conjugated secondary antibodies
(Electron Microscopy Sciences), counterstained with uranyl acetate and lead
citrate, and visualized with a JEOL-1010 electron microscope.
Cell culture and transfection
Rnf17 cDNAs were cloned in frame with GFP into pEGFP-C1 (BD
Biosciences). NIH 3T3 cells were grown in D-MEM media supplemented with 10%
newborn calf serum and transfected with various plasmids using Lipofectamine
reagent (Invitrogen). Twentyfour to 48 hours after transfection, cells were
washed twice with PBS, fixed in cold methanol for 15 minutes, air dried for 5
minutes, mounted with DAPI-containing Vectashield mounting medium (Vector
Labs) and visualized on a Zeiss Axioskop 40 microscope.
GST-pulldown assay
The cDNA fragment corresponding to RNF17 (amino acids 1-287) was cloned
into pGEX-4T-1. The GST-RNF17 (1-287) was expressed in BL21 bacteria and
purified. The pGBKT7-RNF17 (amino acids 1-626) construct was used in a 50
µl reaction for in vitro transcription and translation in the presence of
[35S]methionine with the TNT kit (Promega). In vitro translated
[35S]RNF17 (1-626) (5 µl) was incubated with 2 µg of
GST-RNF17 (1-287) or GST in a 100 µl reaction at RT for 30 minutes. A 50%
(v/v) slurry of glutathione beads (20 µl) was added. After incubation for
30 minutes, beads were washed extensively with TNT buffer prior to addition of
15 µl SDS-PAGE sample buffer. Protein samples were resolved on 12% SDS-PAGE
gels and were subject to autoradiography.
Generation of the Rnf17 knockout mice
To make the targeting construct, we obtained five Rnf17-positive
BAC clones by screening a 129Sv genomic DNA library
(http://bacpac.chori.org/).
One BAC clone (RPCI22-539M9) was used as the PCR template to amplify two
homologous arms of 2.6 kb and 2.7 kb by using high-fidelity HF2 Taq
DNA polymerase (BD Biosciences Clontech) and 25 cycles of PCR. The left arm
(2.6 kb) lies 1 kb upstream of exon 1 and was subcloned into the
EcoRI-digested pPGKNeo vector. The right arm consists of 2.7 kb of
sequence immediately downstream of exon 2 and was subcloned into the
SalI site of the pPGKNeo vector
(Fig. 7A). Sequencing of both
arms revealed no mutations in the final targeting construct. The targeting
construct was linearized with XhoI and electroporated into the V6.5
ES cells (Eggan et al., 2001
).
We recovered 384 clones following growth in G418 (350 µg/ml, Invitrogen).
Three ES clones were homologously targeted at both 5' and 3' ends.
We obtained chimera mice by injecting targeted ES clones into BALB/c
blastocysts. PCR primers used for genotyping were as follows
(Fig. 7A): P1,
GTGGAGAGTAAGAGTGGAGC; P2, AAACTACCCAGGAAAATCAAGT; P3, CCGATGGGCTTTATTCTTAAC;
P4, TCCTGACTAGGGGAGGAGTA. The PCR product of the wild-type allele assayed with
P1 and P2 is 457 bp, and the PCR product of the mutant allele assayed with P3
and P4 is 250 bp (Fig. 7B). For
histological analysis, testes were fixed in Bouin's solution and embedded in
paraffin. Sections (6 µm) were stained with Hematoxylin/Eosin.
Northern blot analysis
Total RNAs were prepared from mouse tissues by using Trizol reagent
(Invitrogen). Total RNAs (10 µg) from each tissue were separated on 2%
agarose gel and blotted onto nitrocellulose membrane. After prehybridization
in Rapid-hyb buffer (Amersham Biosciences), the membrane was hybridized with
32P-labeled probes, washed and subjected to autoradiography. In
Fig. 9B, the same set of
membranes were stripped of probes and hybridized with different gene probes.
The DNA probes were amplified from total testis cDNAs by RT-PCR using the
following primers: Rnf17 (bases 1-861),
TACTCGAGCTATGGCGGCAGAGGCTTCGTC and AAGAATTCGATTACATGCAGATGGCCTCACTGCA;
Ldh3, ACTGGATCCGGATCTGCAGTTATAAACTC and
GACGAATTCGTGGTGGTTGCCTTTAATAC; Miwi, CTTCACCACCTCCATCCTTC and
TCTGTTCTGTCATCCACCTC; Pabpc3, ACTGGATCCCTAGTGCAAAGGTAACGATG and
GACGAATTCCCCTAACATTTGCTTTTGAG; Tpap, CAGCATACCCACAGCAGAAC and
AGGTGGTGGTGAAATGGTAG. The primers for Act, Crem, Prm1, Prm2, Tp1,
Trf2 and ß-actin have been previously described
(Kashiwabara et al.,
2002
).
| Results |
|---|
|
|
|---|
|
RNF17 is a cytoplasmic protein in male germ cells
We raised polyclonal antibodies (anti-serum 1774) against the N-terminal
100 residues of RNF17. By western blot analysis, anti-serum 1774 recognized
two bands with Mr of 200 kDa and 160 kDa in testis
(Fig. 1C), which appeared to
correspond to RNF17L and RNF17S. Both RNF17 isoforms migrated at a slower rate
than expected, possibly owing to the high percentage of negatively charged
residues (15%). RNF17S is more abundant than RNF17L. To distinguish between
the two RNF17 isoforms, we generated polyclonal antibodies (anti-serum GP8)
against the C-terminal region of RNF17L (residues 1341-1540). As expected,
anti-serum GP8 recognized only RNF17L and not RNF17S. To determine the
subcellular compartment to which RNF17 was localized, we prepared cytoplasmic
and nuclear fractions of testicular protein extracts. Western blot analysis
with anti-serum 1774 demonstrated that both RNF17L and RNF17S were present
predominantly in the cytoplasm (Fig.
1D). They were also detected in the nucleus but in much lower
abundance.
|
The presence of RNF17 granules in germ cells is stage dependent. The mouse
seminiferous tubules are classified into 12 stages (I-XII), each of which
consists of a unique assortment of differentiating germ cells
(Russell et al., 1990
). The
development of acrosomes in spermatids is closely correlated with each stage
of spermatogenesis and therefore has been used as a major criterion for
staging of seminiferous tubules. SP10 (Gene symbol: Acrv1) is a
component of the acrosome (Reddi et al.,
1995
). To determine the appearance of RNF17 granules, we performed
double immunostaining of adult testis sections with anti-RNF17 and anti-SP10
antibodies (Fig. 2). Staining
of nuclei with DAPI further facilitated staging of seminiferous tubules. We
did not observe RNF17 granules in early spermatocytes (pre-leptotene,
leptotene and zygotene). However, small granules were present in the pachytene
spermatocytes at stages II-VII (Fig.
2C,E). RNF17 granules appeared as large prominent dots in
pachytene spermatocytes at stages VIII-X (arrows,
Fig. 2G,I) and in diplotene
spermatocytes at stage XI (arrow, Fig.
2K). We did not observe RNF17 granules in early spermatids (steps
1-9), which form the middle layers of germ cells with small round nuclei (step
1, Fig. 2A,B; step 4,
Fig. 2C,D; step 7,
Fig. 2E,F). RNF17 granules
appeared again in step 10 spermatids (arrowhead,
Fig. 2I) and became very
prominent in spermatids of steps 11-16, indicated by arrowheads (step 11,
Fig. 2K; step 13,
Fig. 2A; step 15,
Fig. 2C; step 16,
Fig. 2E). In summary, RNF17
granules were observed in pachytene and diplotene spermatocytes at stages
VIII-XI, disappeared in spermatids of steps 1-9 and were assembled again in
spermatids of steps 10-16.
To distinguish the distribution of RNF17L and RNF17S, we performed double immunostaining of testis sections with anti-sera 1774 and GP8. Staining with anti-serum GP8 revealed that RNF17L was localized to granules in the pachytene and diplotene spermatocytes but not those in the spermatids (Fig. 3B,C). However, RNF17 granules in the spermatids were stained by anti-serum 1774 but not GP8, implying that they contain RNF17S but not RNF17L (Fig. 3C).
RNF17 granules are distinct organelles in male germ cells
The chromatoid body is a well-described nuage in mammalian germ cells
(Fawcett et al., 1970
;
Sud, 1961a
). To address
whether RNF17 granules are chromatoid bodies, we performed colocalization
studies with anti-RNF17 and anti-TDRD1 antibodies. TDRD1 is a known component
of chromatoid bodies (Chuma et al.,
2003
). Precursors of chromatoid bodies appeared as numerous small
punctate structures in spermatocytes (Fig.
4A). Only one large irregularly shaped chromatoid body was
observed in each spermatid (Fig.
4B). The RNF17 granules recognized by anti-RNF17 antibodies were
prominent in both spermatocytes and spermatids
(Fig. 4A,B). Apparently, RNF17
did not colocalize with TDRD1. TDRD6 is another component of chromatoid bodies
(S.C., unpublished). RNF17 did not colocalize with TDRD6 (data not shown). In
conclusion, RNF17 granules were distinguishable from chromatoid bodies. TRA54
(a monoclonal antibody) recognizes cytoplasmic granules in round spermatids,
in addition to Golgi apparatus and acrosome
(Pereira et al., 1998
;
Ventela et al., 2003
). We did
not detect specific co-localization between RNF17 and TRA54, suggesting that
RNF17 granules are distinct from TRA54-positive granules (data not shown).
|
RNF17 granules are spherical electron-dense structures
We performed ultrastructural analysis of RNF17 granules by immuno-electron
microscopy (EM). Ultra-thin sections of the adult testis were probed with
anti-RNF17 antibodies and gold-conjugated secondary antibodies. RNF17 granules
were heavily labeled by gold particles
(Fig. 5). The immuno-EM
analysis showed that RNF17 granules are spherical electron-dense organelles
with a diameter of 0.5 µm (Fig.
5), which is consistent with their manifestation as round dots in
immunofluorescence studies (Fig.
2). Furthermore, RNF17 granules did not appear to be surrounded by
membranes, but rather contained outwardly protruding fine fibers. Under EM, we
frequently observed RNF17 granules in spermatocytes
(Fig. 5A). RNF17 granules were
also observed in spermatids (Fig.
5B). As expected, the irregularly shaped chromatoid body (cb) in
the spermatid was not labeled with gold particles
(Fig. 5B). RNF17 granules were
found to be smaller than chromatoid bodies, which are 1-2 µm in diameter
(Fawcett et al., 1970
).
Residual bodies are formed by the fusion of cytoplasmic materials shed by
elongating spermatids (Russell et al.,
1990
). The residual bodies are characterized by the presence of
vacuoles and lack of nucleus. RNF17 granules were observed in residual bodies,
implying that at least some RNF17 granules are discarded by elongating
spermatids (Fig. 5C).
|
|
To define the minimal region of RNF17 that is required for granule formation, a series of terminal truncations of RNF17 were generated and expressed in NIH 3T3 cells. Transfected cells were examined for RNF17 protein distribution by fluorescence microscopy. These experiments demonstrated that the 45-amino acid region of RNF17 (residues 243-287) is both necessary and sufficient for granule formation (Fig. 6A). Without this region, the distribution of RNF17 displayed a diffuse pattern (Fig. 6B). These data suggest that the 45-amino acid RNF17 (243-287) region, referred to as the binding domain, might be involved in dimerization or polymerization of RNF17.
RNF17 associates with itself both in vivo and in vitro
To determine whether RNF17 is associated with itself in vivo, we took
advantage of the presence of two RNF17 isoforms. RNF17L and its associated
proteins were immunoprecipitated from the total testis protein extract with
RNF17L-specific antibodies (anti-serum GP8) and were subject to western blot
analysis with anti-serum 1774. Our co-immunoprecipitation experiment showed
that RNF17L and RNF17S were associated with each other in vivo
(Fig. 6C).
We next performed GST pulldown experiments to determine whether RNF17 physically binds to itself. Our GST pulldown experiment showed that in vitro translated RNF17 (1-626) was able to bind to GST-RNF17 (residues 1-287) but not GST, suggesting that RNF17 physically interacts with itself (Fig. 6D). We further confirmed the interaction by yeast two-hybrid assay (data not shown).
Generation of mice lacking Rnf17
To investigate the function of Rnf17 in spermatogenesis, we used
homologous recombination in embryonic stem cells to create mice that lack the
Rnf17 gene. In the targeting construct, a 4.1 kb DNA fragment
containing the first two exons of Rnf17 was replaced by the neomycin
selection marker (Fig. 7A).
This Rnf17 mutant allele deletes the ATG initiation codon, the RING
finger and part of its Mad-binding domain
(Wang et al., 2001
;
Yin et al., 1999
). The RNF17
protein was not detected in Rnf17-/- testis by western
blotting, indicating that an Rnf17-null mutant was generated
(Fig. 7C).
Spermiogenesis deficiency in the Rnf17 mutant mice
Rnf17-deficient mice appear to be normal in development. No gross
defects have been observed up to 8 months of age. Interbreeding of
heterozygous (Rnf17+/-) mice yielded the Mendelian ratio
(77:164:78) of Rnf17+/+, Rnf17+/- and
Rnf17-/- offspring, suggesting that disruption of
Rnf17 causes no embryonic lethality. The Rnf17-/-
males were infertile, despite normal sexual behavior, as evidenced by
formation of copulatory plugs in females. By contrast,
Rnf17-/- females exhibited normal fertility and produced
normal litter sizes (7.0±1.1 offspring, n=7 litters).
Histological analysis of Rnf17-/- ovaries revealed no
abnormalities.
|
|
In the seminiferous tubules of Rnf17-/- testes, we frequently observed large multi-nucleated degenerating cells, which we believed to be apoptotic cells (Fig. 8D). Such large abnormal cells were rarely seen in normal testes. Interestingly, epididymal tubules from 8-week-old wild-type mice were filled with sperm (Fig. 8E), whereas those from Rnf17-/- mice contained apparently apoptotic round spermatids (Fig. 8F). No sperm were found in the epididymis of Rnf17-/- mice, which accounts for their infertility.
Downregulation of spermiogenesis genes in Rnf17-null testis
To identify potential downstream target genes of Rnf17, we
performed Northern blot analysis of known testis-specific genes in
Rnf17-/- testis. A number of genes that begin to
transcribe in meiosis, such as Ldh3 (lactate dehydrogenase 3, C
chain), Miwi and Pabpc3 (poly A-binding protein, cytoplasmic
3), did not show significantly reduced expression in
Rnf17-/- testis when compared with wild-type and
Rnf17+/- testes (Fig.
9A) (Deng and Lin,
2002
; Sakai et al.,
1987
; Wang et al.,
1992
). However, genes that initiate transcription postmeiotically,
such as Act (activator of CREM in testis), Tp1 (transition
protein 1), Prm1 (protamine 1) and Prm2 (protamine 2),
exhibited greatly reduced expression in Rnf17-/- testis
(Fig. 9A). These expression
data are consistent with the spermiogenic defects in
Rnf17-/- testes revealed by histology.
To determine whether the reduced expression of postmeiotic genes in Rnf17-deficient mice is due to transcriptional regulation by Rnf17 or to the absence of elongating spermatids, we examined gene expression in juvenile testes from different developmental stages. We observed significant reduction in the expression of Act, Tp1, Prm1 and Prm2 in Rnf17-/- testes of 24 days after birth, when the most differentiated germ cells are round spermatids (Fig. 9B). This reduction cannot be explained by a lack of elongating spermatids in Rnf17-/- testes, as such cells do not appear in normal testes until day 28. By contrast, the level of expression of Ldh3 is indistinguishable between Rnf17-/- and wild-type testes throughout development. In addition, we examined expression of four known key regulators of spermiogenesis (Crem, Trf2, Miwi and Tpap) to address whether their expression might be regulated by Rnf17. Expression of these four genes is comparable in Rnf17-/- and wild-type testes, suggesting that Rnf17 regulates spermiogenesis in a manner independent of these four known key regulators.
|
| Discussion |
|---|
|
|
|---|
|
Our data suggest that RNF17 may play a role in the assembly of RNF17
granules. Several lines of evidence support this notion. First, RNF17
physically bound to itself in the GST-pulldown assay. Second, RNF17L and
RNF17S were co-immunoprecipitated from the testis, suggesting that they may
form heterodimers. RNF17 granules in elongating spermatids contained RNF17S
but not RNF17L, suggesting the possibility of RNF17S homodimerization. Third,
RNF17 was capable of forming large aggregates when ectopically expressed in
cultured cells. RNF17 aggregates have also been observed previously
(Yin et al., 1999
). Taken
together, we hypothesize that RNF17 may form high order polymers in vivo and
play a crucial role in the assembly of RNF17 granules.
RNF17 contains multiple tudor domains
(Fig. 1). The specific
functions of tudor domains remain elusive. However, two recent studies have
shown that tudor domains are directly involved in protein-protein
interactions. The tudor domain in SMN (survival of motor neuron) binds to Sm
proteins of snRNP (small nuclear ribonucleoproteins)
(Selenko et al., 2001
). The
tudor domain in 53BP1 (p53 binding protein 1) interacts with methylated
histone 3 (Huyen et al.,
2004
). We hypothesize that the tudor domains in RNF17 may recruit
other proteins to form large macromolecular complexes. Interestingly, the
founding member of the tudor domain-containing protein, Tudor, is a component
of polar granules in Drosophila and is required for their assembly
(Bardsley et al., 1993
).
TDRD1/MTR-1 is a component of chromatoid bodies in mice
(Chuma et al., 2003
). TDRD6 is
also a component of chromatoid bodies (S.C., unpublished). The localization of
proteins with multiple tudor domains in nuages indicates a conserved role for
tudor domains in these diverse organelles.
The chromatoid body has been assumed to serve as a storage site for
proteins and RNAs during spermatid differentiation. A number of proteins and
RNAs were found in chromatoid bodies, including TDRD1, MVH, DDX25, mRNAs and
rRNAs (Chuma et al., 2003
;
Figueroa and Burzio, 1998
;
Toyooka et al., 2000
;
Tsai-Morris et al., 2004
).
However, the specific functions of chromatoid bodies remain unclear. Vasa is a
highly conserved germ-cell-specific RNA helicase. Because targeted deletion of
Mvh (mouse Vasa homolog) in mice resulted in meiotic arrest, the
functional significance of the association of MVH with chromatoid body could
not be studied (Tanaka et al.,
2000
). DDX25 is a gonadotropin-regulated testicular RNA helicase.
In Ddx25 mutant mice, spermatogenesis was blocked in the round
spermatid stage, and chromatoid bodies in spermatids were markedly reduced in
size, suggesting that chromatoid bodies may be essential for spermatid
differentiation (Tsai-Morris et al.,
2004
). Chromatoid bodies were observed to travel between
spermatids through cytoplasmic bridges and thus were proposed to be involved
in sharing of haploid gene products between spermatids
(Ventela et al., 2003
). It is
worth noting that chromatoid bodies are present in round spermatids, while
RNF17 granules are present in late pachytene spermatocytes and elongating
spermatids. The functions of these two nuages may be complementary during
spermatogenesis. Analogous to chromatoid bodies, we assume that RNF17 granules
may serve as a storage site for other proteins and RNAs, and may shuttle
between interconnected germ cells to promote synchronized differentiation.
RNF17 binds to all four members of the Mad protein family (Mad1, Mxi1, Mad3
and Mad4), which are present in many tissues
(Yin et al., 1999
). Although
Rnf17 is required for spermiogenesis, mice lacking Mad1,
Mxi1 or Mad3 are viable and fertile, suggesting functional
redundancy among Mad proteins (Foley et
al., 1998
; Queva et al.,
2001
; Schreiber-Agus et al.,
1998
). As antagonists of Myc, Mad proteins repress transcription
of Myc-responsive genes by competing with Myc for binding to the Max
transcription factor (Grandori et al.,
2000
). RNF17 was shown to activate transcription of Myc-responsive
genes by retaining Mad proteins in the cytoplasm
(Yin et al., 2001
;
Yin et al., 1999
). RNF17 is
predominantly cytoplasmic in germ cells. It is possible that RNF17 sequesters
Mad proteins in the cytoplasm and thereby prevents transcriptional repression
of spermiogenesis-specific genes.
RNF17 is evolutionarily conserved in mammals. The RNF17L ortholog was identified in silico in the rat genome. A full-length cDNA clone encoding the human RNF17L ortholog was present in the public database. We observed RNF17 granules in the rat testis using our anti-RNF17 antibodies (data not shown), suggesting that RNF17 granules may be present in other mammalian species. RNF17 is a novel key regulator of spermiogenesis in mice. Therefore, we anticipate that the essential role of RNF17 in spermiogenesis is conserved in other species, including humans.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
al-Mukhtar, K. A. and Webb, A. C. (1971). An
ultrastructural study of primordial germ cells, oogonia and early oocytes in
Xenopus laevis. J. Embryol. Exp. Morphol.
26,195
-217.[Medline]
Allen, E., Yu, Q. C. and Fuchs, E. (1996). Mice
expressing a mutant desmosomal cadherin exhibit abnormalities in desmosomes,
proliferation, and epidermal differentiation. J. Cell
Biol. 133,1367
-1382.
Bardsley, A., McDonald, K. and Boswell, R. E.
(1993). Distribution of tudor protein in the Drosophila embryo
suggests separation of functions based on site of localization.
Development 119,207
-219.[Abstract]
Blendy, J. A., Kaestner, K. H., Weinbauer, G. F., Nieschlag, E.
and Schutz, G. (1996). Severe impairment of spermatogenesis
in mice lacking the CREM gene. Nature
380,162
-165.[CrossRef][Medline]
Chen, J. W., Murphy, T. L., Willingham, M. C., Pastan, I. and
August, J. T. (1985). Identification of two lysosomal
membrane glycoproteins. J. Cell Biol.
101, 85-95.
Chuma, S. and Nakatsuji, N. (2001). Autonomous
transition into meiosis of mouse fetal germ cells in vitro and its inhibition
by gp130-mediated signaling. Dev. Biol.
229,468
-479.[CrossRef][Medline]
Chuma, S., Hiyoshi, M., Yamamoto, A., Hosokawa, M., Takamune, K.
and Nakatsuji, N. (2003). Mouse Tudor Repeat-1 (MTR-1) is a
novel component of chromatoid bodies/nuages in male germ cells and forms a
complex with snRNPs. Mech. Dev.
120,979
-990.[CrossRef][Medline]
Deng, W. and Lin, H. (2002). miwi, a murine
homolog of piwi, encodes a cytoplasmic protein essential for spermatogenesis.
Dev. Cell 2,819
-830.[CrossRef][Medline]
Eddy, E. M. (1970). Cytochemical observations
on the chromatoid body of the male germ cells. Biol.
Reprod. 2,114
-128.[Abstract]
Eddy, E. M. (1974). Fine structural
observations on the form and distribution of nuage in germ cells of the rat.
Anat. Rec. 178,731
-757.[CrossRef][Medline]
Eggan, K., Akutsu, H., Loring, J., Jackson-Grusby, L., Klemm,
M., Rideout, W. M., 3rd, Yanagimachi, R. and Jaenisch, R.
(2001). Hybrid vigor, fetal overgrowth, and viability of mice
derived by nuclear cloning and tetraploid embryo complementation.
Proc. Natl. Acad. Sci. USA
98,6209
-6214.
Fawcett, D. W., Ito, S. and Slautterback, D.
(1959). The occurrence of intercellular bridges in groups of
cells exhibiting synchronous differentiation. J. Biophys. Biochem.
Cytol. 5,453
-460.
Fawcett, D. W., Eddy, E. M. and Phillips, D. M.
(1970). Observations on the fine structure and relationships of
the chromatoid body in mammalian spermatogenesis. Biol.
Reprod. 2,129
-153.[Abstract]
Figueroa, J. and Burzio, L. O. (1998).
Polysome-like structures in the chromatoid body of rat spermatids.
Cell Tissue Res. 291,575
-579.[CrossRef][Medline]
Foley, K. P., McArthur, G. A., Queva, C., Hurlin, P. J.,
Soriano, P. and Eisenman, R. N. (1998). Targeted disruption
of the MYC antagonist MAD1 inhibits cell cycle exit during granulocyte
differentiation. EMBO J.
17,774
-785.[CrossRef][Medline]
Grandori, C., Cowley, S. M., James, L. P. and Eisenman, R.
N. (2000). The Myc/Max/Mad network and the transcriptional
control of cell behavior. Annu. Rev. Cell Dev. Biol.
16,653
-699.[CrossRef][Medline]
Granger, B. L., Green, S. A., Gabel, C. A., Howe, C. L.,
Mellman, I. and Helenius, A. (1990). Characterization and
cloning of lgp110, a lysosomal membrane glycoprotein from mouse and rat cells.
J. Biol. Chem. 265,12036
-12043.
Harlow, E. and Lane, D. (1998).
Using Antibodies: A Laboratory Manual. Cold Spring
Harbor: Cold Spring Harbor Laboratory Press.
Hay, B., Jan, L. Y. and Jan, Y. N. (1988). A
protein component of Drosophila polar granules is encoded by vasa and has
extensive sequence similarity to ATP-dependent helicases.
Cell 55,577
-587.[CrossRef][Medline]
Hofmann, M. C., Narisawa, S., Hess, R. A. and Millan, J. L.
(1992). Immortalization of germ cells and somatic testicular
cells using the SV40 large T antigen. Exp. Cell Res.
201,417
-435.[CrossRef][Medline]
Huyen, Y., Zgheib, O., Ditullio, R. A., Jr, Gorgoulis, V. G.,
Zacharatos, P., Petty, T. J., Sheston, E. A., Mellert, H. S., Stavridi, E. S.
and Halazonetis, T. D. (2004). Methylated lysine 79 of
histone H3 targets 53BP1 to DNA double-strand breaks.
Nature 432,406
-411.[CrossRef][Medline]
Joazeiro, C. A. and Weissman, A. M. (2000).
RING finger proteins: mediators of ubiquitin ligase activity.
Cell 102,549
-552.[CrossRef][Medline]
Kashiwabara, S., Noguchi, J., Zhuang, T., Ohmura, K., Honda, A.,
Sugiura, S., Miyamoto, K., Takahashi, S., Inoue, K., Ogura, A. et al.
(2002). Regulation of spermatogenesis by testis-specific,
cytoplasmic poly(A) polymerase TPAP. Science
298,1999
-2002.
Lorick, K. L., Jensen, J. P., Fang, S., Ong, A. M., Hatakeyama,
S. and Weissman, A. M. (1999). RING fingers mediate
ubiquitin-conjugating enzyme (E2)-dependent ubiquitination. Proc.
Natl. Acad. Sci. USA 96,11364
-11369.
Mahowald, A. P. (1968). Polar granules of
Drosophila. II. Ultrastructural changes during early embryogenesis.
J. Exp. Zool. 167,237
-261.[CrossRef][Medline]
Mahowald, A. P. (2001). Assembly of the
Drosophila germ plasm. Int. Rev. Cytol.
203,187
-213.[Medline]
Martianov, I., Fimia, G. M., Dierich, A., Parvinen, M.,
Sassone-Corsi, P. and Davidson, I. (2001). Late arrest of
spermiogenesis and germ cell apoptosis in mice lacking the TBP-like TLF/TRF2
gene. Mol. Cell 7,509
-515.[CrossRef][Medline]
Nantel, F., Monaco, L., Foulkes, N. S., Masquilier, D., LeMeur,
M., Henriksen, K., Dierich, A., Parvinen, M. and Sassone-Corsi, P.
(1996). Spermiogenesis deficiency and germ-cell apoptosis in
CREM-mutant mice. Nature
380,159
-162.[CrossRef][Medline]
Pereira, L. A., Tanaka, H., Nagata, Y., Sawada, K., Mori, H.,
Chimelli, L. M. and Nishimune, Y. (1998). Characterization
and expression of a stage specific antigen by monoclonal antibody TRA54 in
testicular germ cells. Int. J. Androl.
21, 34-40.[CrossRef][Medline]
Ponting, C. P. (1997). Tudor domains in
proteins that interact with RNA. Trends Biochem. Sci.
22, 51-52.[CrossRef][Medline]
Queva, C., McArthur, G. A., Iritani, B. M. and Eisenman, R.
N. (2001). Targeted deletion of the S-phase-specific Myc
antagonist Mad3 sensitizes neuronal and lymphoid cells to radiation-induced
apoptosis. Mol. Cell. Biol.
21,703
-712.
Reddi, P. P., Naaby-Hansen, S., Aguolnik, I., Tsai, J. Y.,
Silver, L. M., Flickinger, C. J. and Herr, J. C. (1995).
Complementary deoxyribonucleic acid cloning and characterization of mSP-10:
the mouse homologue of human acrosomal protein SP-10. Biol.
Reprod. 53,873
-881.[Abstract]
Russell, L. and Frank, B. (1978).
Ultrastructural characterization of nuage in spermatocytes of the rat testis.
Anat. Rec. 190,79
-97.[CrossRef][Medline]
Russell, L. D., Ettlin, R. A., Sinha Hikim, A. P. and Clegg, E.
D. (1990). Histological and Histopathological
Evaluation of the Testis. Clearwater, Florida: Cache River
Press.
Sakai, I., Sharief, F. S. and Li, S. S. (1987).
Molecular cloning and nucleotide sequence of the cDNA for sperm-specific
lactate dehydrogenase-C from mouse. Biochem. J.
242,619
-622.[Medline]
Schreiber-Agus, N., Meng, Y., Hoang, T., Hou, H., Jr, Chen, K.,
Greenberg, R., Cordon-Cardo, C., Lee, H. W. and DePinho, R. A.
(1998). Role of Mxi1 in ageing organ systems and the regulation
of normal and neoplastic growth. Nature
393,483
-487.[CrossRef][Medline]
Schultz, N., Hamra, F. K. and Garbers, D. L.
(2003). A multitude of genes expressed solely in meiotic or
postmeiotic spermatogenic cells offers a myriad of contraceptive targets.
Proc. Natl. Acad. Sci. USA
100,12201
-12206.
Selenko, P., Sprangers, R., Stier, G., Buhler, D., Fischer, U.
and Sattler, M. (2001). SMN tudor domain structure and its
interaction with the Sm proteins. Nat. Struct. Biol.
8, 27-31.[CrossRef][Medline]
Sharpe, R. M. (1993). Regulation of
Spermatogenesis. In The Physiology of Reproduction, Vol.1
(ed. E. Knobil and J. D. Neill), pp.1363
-1434. New York: Raven Press.
Shima, J. E., McLean, D. J., McCarrey, J. R. and Griswold, M.
D. (2004). The murine testicular transcriptome:
characterizing gene expression in the testis during the progression of
spermatogenesis. Biol. Reprod.
71,319
-330.
Sud, B. N. (1961a). The chromatoid body in
spermatogenesis. Quart. J. Microscop. Sci.
102,273
-292.
Sud, B. N. (1961b). Morphological and
histochemical studies of the chromatoid body and related elements in the
spermatogenesis of the rat. Quart. J. Microscop. Sci.
102,495
-505.
Tanaka, S. S., Toyooka, Y., Akasu, R., Katoh-Fukui, Y.,
Nakahara, Y., Suzuki, R., Yokoyama, M. and Noce, T. (2000).
The mouse homolog of Drosophila Vasa is required for the development of male
germ cells. Genes Dev.
14,841
-853.
Thomson, T. and Lasko, P. (2004). Drosophila
tudor is essential for polar granule assembly and pole cell specification, but
not for posterior patterning. Genesis
40,164
-170.[CrossRef][Medline]
Toyooka, Y., Tsunekawa, N., Takahashi, Y., Matsui, Y., Satoh, M.
and Noce, T. (2000). Expression and intracellular
localization of mouse Vasa-homologue protein during germ cell development.
Mech. Dev. 93,139
-149.[CrossRef][Medline]
Tsai-Morris, C. H., Sheng, Y., Lee, E., Lei, K. J. and Dufau, M.
L. (2004). Gonadotropin-regulated testicular RNA helicase
(GRTH/Ddx25) is essential for spermatid development and completion of
spermatogenesis. Proc. Natl. Acad. Sci. USA
101,6373
-6378.
Ventela, S., Toppari, J. and Parvinen, M.
(2003). Intercellular organelle traffic through cytoplasmic
bridges in early spermatids of the rat: mechanisms of haploid gene product
sharing. Mol. Biol. Cell
14,2768
-2780.
Wang, M. Y., Cutler, M., Karimpour, I. and Kleene, K. C.
(1992). Nucleotide sequence of a mouse testis poly(A) binding
protein cDNA. Nucleic Acids Res.
20, 3519.
Wang, P. J., McCarrey, J. R., Yang, F. and Page, D. C.
(2001). An abundance of X-linked genes expressed in
spermatogonia. Nat. Genet.
27,422
-426.[CrossRef][Medline]
Yin, X. Y., Gupta, K., Han, W. P., Levitan, E. S. and
Prochownik, E. V. (1999). Mmip-2, a novel RING finger protein
that interacts with mad members of the Myc oncoprotein network.
Oncogene 18,6621
-6634.[CrossRef][Medline]
Yin, X. Y., Grove, L. E. and Prochownik, E. V.
(2001). Mmip-2/Rnf-17 enhances c-Myc function and regulates some
target genes in common with glucocorticoid hormones.
Oncogene 20,2908
-2917.[CrossRef][Medline]
Zhang, D., Penttila, T. L., Morris, P. L., Teichmann, M. and
Roeder, R. G. (2001). Spermiogenesis deficiency in mice
lacking the Trf2 gene. Science
292,1153
-1155.
This article has been cited by other articles:
![]() |
V. V. Vagin, J. Wohlschlegel, J. Qu, Z. Jonsson, X. Huang, S. Chuma, A. Girard, R. Sachidanandam, G. J. Hannon, and A. A. Aravin Proteomic analysis of murine Piwi proteins reveals a role for arginine methylation in specifying interaction with Tudor family members Genes & Dev., August 1, 2009; 23(15): 1749 - 1762. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Lim and T. Kai Unique germ-line organelle, nuage, functions to repress selfish genetic elements in Drosophila melanogaster PNAS, April 17, 2007; 104(16): 6714 - 6719. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Kress, C. Gautier-Courteille, H. B. Osborne, C. Babinet, and L. Paillard Inactivation of CUG-BP1/CELF1 Causes Growth, Viability, and Spermatogenesis Defects in Mice Mol. Cell. Biol., February 1, 2007; 27(3): 1146 - 1157. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Pepling, J. E. Wilhelm, A. L. O'Hara, G. W. Gephardt, and A. C. Spradling Mouse oocytes within germ cell cysts and primordial follicles contain a Balbiani body PNAS, January 2, 2007; 104(1): 187 - 192. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chuma, M. Hosokawa, K. Kitamura, S. Kasai, M. Fujioka, M. Hiyoshi, K. Takamune, T. Noce, and N. Nakatsuji Tdrd1/Mtr-1, a tudor-related gene, is essential for male germ-cell differentiation and nuage/germinal granule formation in mice PNAS, October 24, 2006; 103(43): 15894 - 15899. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||