|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 17 August 2005
doi: 10.1242/dev.01971
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Biomedical Sciences Graduate Program, University of California San Francisco,
San Francisco, CA 94143, USA
2 Department of Cell and Tissue Biology, University of California San Francisco,
San Francisco, CA 94143, USA
3 Department of Physiology, Universiti Sains Malaysia, Kelantan, Malaysia
4 Department of Pharmaceutical Chemistry, University of California San
Francisco, San Francisco, CA 94143, USA
5 Department of Anatomy, University of California San Francisco, San Francisco,
CA 94143, USA
* Author for correspondence (e-mail: sfisher{at}cgl.ucsf.edu)
Accepted 7 July 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Placenta, Cytotrophoblast, Vascular remodeling, Chemokines, EPHB4, Ephrin B2, Human, Pregnancy
| Introduction |
|---|
|
|
|---|
Shunting of maternal blood flow to the chorionic villi, which occurs as a
result of trophoblast endovascular invasion, is an integral component of
placentation. This process involves remodeling the uterine vasculature and is
present in all species with hemochorial placentation, classified as such
because the trophoblast cells are in direct contact with maternal blood.
However, the pattern of trophoblast interactions with maternal blood vessels
spans a wide spectrum. In mice, the endovascular component of trophoblast
invasion is limited to the termini of arteries and veins
(Adamson et al., 2002
). In
humans the process is dramatic, with mononuclear trophoblasts, termed
cytotrophoblasts, interacting very differently with the two sides of the
uterine circulation (Fig. 1).
Endovascular invasion of spiral arterioles encompasses the decidua and the
first third of their myometrial segments. As a result, nearly the entire
intrauterine course of these vessels is lined by cytotrophoblasts, which also
intercalate within and destroy the integrity of their muscular walls. This
process redirects the maternal arterial circulation to the intervillous space
and expands the luminal diameter of the vessels by as much as 1,000-fold,
increasing uterine blood flow to more than 30 liters per hour
(Dickey and Hower, 1995
;
Metcalfe et al., 1955
). By
contrast, remodeling of veins, which establishes venous return, is limited to
their termini.
|
6ß4 and E-cadherin) and the upregulation of adhesion receptors
characteristic of endothelium (e.g. VE-cadherin, Ig family members VCAM-1 and
PECAM-1, and integrins
Vß3 and
1ß1)
(Damsky et al., 1992
However, owing to their pleiotropic expression, the molecules involved in
vascular mimicry cannot explain cytotrophoblast tropism for arteries rather
than veins. This phenomenon implies that different vessel types possess
specific molecular determinants that placental cells decode in terms of
adhesion and/or migration. In this regard, members of the EPH/ephrin family
could have interesting roles. This family of molecules consists of multiple
members that are classified into two subgroups: A and B. In general, EPHB
receptors bind ephrin B ligands and EPHA receptors bind ephrin A ligands. With
regard to specific functions, EPHB4, a receptor tyrosine kinase, and its
ligand, ephrin B2, are expressed at high levels in veins and arteries,
respectively (Wang et al.,
1998
), and interactions between the two are indispensable for
angiogenesis in the developing embryo
(Gerety and Anderson, 2002
;
Gerety et al., 1999
;
Wang et al., 1998
). In
addition, both the receptors and the ligands are transmembrane molecules. Upon
cell-cell contact, their ligation generates bi-directional intracellular
signals that can influence cell migration and tissue morphogenesis. In other
locations, such as the developing nervous system, these molecules play
important roles in boundary formation (reviewed by
Wilkinson, 2001
).
Although integral to these processes, members of the EPH/ephrin family are
not known to be direct participants in migration. Instead, the signals they
generate are upstream of other molecular families that govern cell movement.
For example, EPH-ephrin ligation can influence chemokine-induced migration
(Lu et al., 2001
). This
observation may be especially relevant to placentation, as our previous work
and that of other investigators shows that, during pregnancy, cells within the
uterine wall, including cytotrophoblasts, express a wide array of chemokines
(Drake et al., 2001
;
Drake et al., 2004
;
Hanna et al., 2003
;
Red-Horse et al., 2001
).
Additionally, cytotrophoblasts express a chemokine receptor repertoire that
suggests that they are able to respond to both the autocrine and paracrine
chemokine signals they encounter (Drake et
al., 2004
; Jaleel et al.,
2004
).
Together, these data suggested the hypothesis that, in humans, EPH and ephrin interactions pattern cytotrophoblast invasion. In accordance with this theory, we found that, during pregnancy, maternal endothelial cells of uterine veins and arteries express EPHB4 and ephrin B2, respectively. Cytotrophoblast invasion was associated with acquisition of an arterial phenotype downregulation of EPHB4 and sequential upregulation of ephrin B1 and B2. In vitro, cytotrophoblasts avoided substrates formed from EPHB4 and exhibited dramatically decreased migration in response to EPHB4-expressing 3T3 cells. As to the mechanisms involved, interactions with EPHB4 specifically downregulated chemokine-induced responses with little effect on growth factor-stimulated migration. These data support a model in which EPH and ephrin-mediated interactions play crucial roles in human placentation at two important junctures, first by generating repulsive signals that initiate cytotrophoblast invasion and later by patterning the interactions of cells with the uterine vasculature.
| Materials and methods |
|---|
|
|
|---|
In situ hybridization
In situ hybridization was carried out using published methods
(Red-Horse et al., 2001
) and
formalin-fixed, paraffin-embedded tissue sections of the maternal-fetal
interface (n=4, 14-21 wks; n=3, term). Antisense
[35S]sulfur-labeled probes were produced using linearized plasmids
encoding cDNAs for ephrin B1 (Beckmann et
al., 1994
) and ephrin B2
(Cerretti et al., 1995
), or
gene fragments for EPHB4 (nucleotides 412-1253) and EPHB2 (nucleotides
997-1599). Pseudocolor hybridization signals were generated in Photoshop.
Tissue sections of heart served as positive controls.
Cytotrophoblast isolation and aggregation
Cells were isolated from pools of first- or second-trimester human
placentas by published methods (Fisher et
al., 1989
; Kliman et al.,
1986
). Briefly, placentas were subjected to a series of enzymatic
digests, which detached cytotrophoblast progenitors from the stromal cores of
the chorionic villi. Then the cells were purified over a Percoll gradient and
cultured on substrates coated with laminin (Invitrogen) or Matrigel (BD
Biosciences) in serum-free medium: Dulbecco's modified Eagle's medium, 4.5 g/l
glucose (Sigma Chemical) with 2% Nutridoma (Boehringer Mannheim Biochemicals),
1% penicillin/streptomycin, 1% sodium pyruvate, 1% HEPES and 1% gentamicin
(UCSF Cell Culture Facility).
For aggregation studies, isolated cytotrophoblasts were cultured on Matrigel with or without agents that block chemokine receptor function, including pertussis toxin (100 ng/ml; List Biological Laboratories) or a CXCR4-specific antibody (10 µg/ml; BD Pharmingen). After overnight incubation, aggregates were photographed under bright-field illumination using a Leica inverted CTRMIC microscope fitted with a Hamamatsu camera.
Northern blot hybridization and RT-PCR
Total RNA was extracted from cytotrophoblasts using Trizol reagent
(Invitrogen). Samples were obtained immediately after isolation or after 12 or
24 hours in culture on Matrigel-coated tissue culture plates. Two micrograms
of poly(A) mRNA, enriched using an Oligotex mRNA midi kit (Qiagen), was
separated by formaldehyde-agarose gel electrophoresis, transferred to a
Hybond-N+ membrane (Amersham Pharmacia Biotech) and analyzed using a QuickHyb
northern hybridization kit (Stratagene). [32P]-labeled probes were
prepared using gene fragments cut from the plasmids described above as
templates and High Prime DNA labeling mix (Roche). Experiments were performed
at least three times. In total, seven first-trimester, eight second-trimester
and six term samples were analyzed.
For RT-PCR, AMV reverse transcriptase (Invitrogen) was used to produce cDNA from the RNA samples described above. PCR for PDZ-RGS3 was performed using two primer sets: (1) GGATACCATCCCCGAAGAAT/AGGCACCAGCACACTCTCTT and (2) GGGAGGTGAGAGGTGATTT/GGGTGACGTAGGTGCCATAG. Similar results were obtained with each primer set.
Immunohistochemistry
For in situ hybridization experiments, tissues were fixed at room
temperature for 12-24 hours. The distribution of cytotrophoblasts was
determined by staining adjacent sections with a cytokeratin 7-specific
antibody (DAKO). Antibody binding was detected by using Vectastain ABC and DAB
peroxidase substrate kits (Vector Laboratories).
For immunofluorescence, tissues were fixed for 4 hours on ice in 3%
paraformaldehyde before they were snap-frozen in liquid nitrogen and
sectioned. Nonspecific binding was blocked by incubating the sections in 3%
bovine serum albumin/PBS for 1 hour before addition of a polyclonal (goat)
antibody specific for CXCL16 (R&D Systems) dissolved in the blocking
solution (1:20; vol/vol) and incubation overnight at 4°C. Staining was
detected using an Alexa-488-conjugated donkey anti-goat secondary antibody
(Molecular Probes) and observed using a Leica CTR5000 upright microscope. As a
positive control, lung tissue was processed in parallel. As a negative
control, sections were incubated in nonimmune goat serum rather than the
primary antibody. Similar staining patterns were observed in all the samples
(n=2, 5-6 week; n=3, 14-19 week; n=6, term). 3T3
cell lines, produced as previously described
(Gao et al., 1999
), were fixed
with ice-cold methanol for 5 minutes and stained as described above. Primary
polyclonal antibodies included goat anti-EPHB4 (R&D Systems) and rabbit
anti-ephrin B2 (Santa Cruz P-20).
Substratum choice assay
The preference of cytotrophoblasts for substrates containing either EPHB4
or ephrin B2 was assessed by using published methods
(Birgbauer et al., 2001
).
Briefly, laminin was mixed with either ephrin B2-Fc, EPHB4-Fc or (control)
human IgG (10 µg/ml) and fluorescein-conjugated goat-anti human Fc
(10 µg/ml), and then spotted in 1 µl aliquots on the bottom of 12-well
culture dishes. The spots were allowed to gel for 1 hour by incubation at
37°C, before the entire substrate was coated with laminin (10 µg/ml).
Then 1x106 cytotrophoblasts per well were plated as a
monolayer. After 12 hours, the cells were fixed and stained with anti-human
cytokeratin 7. The distribution of cells and protein spots was observed by
fluorescence microscopy. The experiment was repeated 10 times, each time
showing similar results.
Cytotrophoblast migration in 3T3 co-culture experiments
NIH 3T3 cells were fluorescently labeled for 30 minutes in medium (DME
H-21, 4.5 g/l glucose) containing 2 µM Cell Tracker Red CMPTX (Molecular
Probes). Freshly isolated cytotrophoblasts and labeled NIH 3T3 cells
(1x106/ml) were mixed (1:10; vol/vol) and plated in 12-well
tissue culture wells coated overnight at 4°C with 10 µg/ml (murine)
laminin (Invitrogen) or 100 µl undiluted Matrigel. Cells were allowed to
attach for 1 hour, then washed with PBS before being placed in an
environmental chamber mounted on a motorized microscope stage (Carl Zeiss
MicroImaging). Cultures were maintained at 37°C for 15 hours. Time-lapse
images were collected every 10 minutes in both the bright light and
fluorescence channels using a SPOT-RT CCD camera (Molecular Dynamics).
Cytotrophoblast migration was traced by recording the position of 10 randomly
chosen unlabeled cells in each successive frame using the Openlab software
point counter (Improvision). Positional data were transferred to Excel for
calculation of the linear distance traveled by each cell. To normalize the
data, the control value from each experiment was set at 100% and migration was
expressed as a percentage of control values. The experiment was repeated four
times on laminin and twice on Matrigel. Similar results were obtained for both
first- and second-trimester cytotrophoblasts.
Chemotaxis assays
Modified Boyden-chamber assays were used to assess the effects of
chemokines and EPHB4 on cytotrophoblast migration. The undersides of Transwell
inserts (8 µm pore size, Corning Costar) were incubated overnight at
4°C with 10 µg/ml human plasma fibronectin (Roche) and then washed with
PBS. Cytotrophoblasts (2.5x105 cells in 250 µl serum-free
medium) were added to the upper compartments, and the inserts were placed in
24-well plates that contained 500 µl medium with either vehicle alone (0.1%
bovine serum albumin/PBS) or chemokines (10 and 1000 ng/ml). In some cases,
the medium also contained EPHB4-Fc (10 µg/ml). Growth factor-induced
migration was stimulated by adding to the lower chamber 125 µl endothelial
cell growth medium (Clonetics, EGM-2) containing FCS, hEGF, VEGF, hFGF-B and
IGF1 at the concentrations provided by the manufacturer to a final volume of
500 µl. The cells were incubated overnight under standard tissue culture
conditions, washed in PBS and fixed in 3% paraformaldehyde. Migration was
quantified by one of two methods.
(1) Cells in the upper chamber were removed with a cotton swab, and those
remaining on the underside of the filter were stained for 5 minutes with
crystal Violet (0.5% in 20% methanol), and then washed with water. Membranes
were destained in 1 ml 10% acidic acid. Migration was quantified by
determining the A600 of the latter solution
(Sieg et al., 2000
).
(2) Cytotrophoblasts that migrated to the underside of the filter were labeled with anti-cytokeratin 7. The membrane area covered by cells was quantified in three randomly chosen fields by using the Openlab software region-of-interest tool. To normalize the data, the control value from each experiment was set at 100% and migration was expressed as a percentage of control values.
Both methods produced the same results. Each experiment was repeated four to seven times, with two to three different chambers per condition.
| Results |
|---|
|
|
|---|
|
|
Cytotrophoblasts modulate EPH and ephrin expression during aggregation, migration, and invasion
Next, we investigated mechanisms that could convert random cytotrophoblast
migration into specific interactions with uterine arterioles rather than
veins. Specifically, we examined the expression patterns of EPHs and ephrins,
which are present in the placenta
(Goldman-Wohl et al., 2004
),
using in situ hybridization on tissue sections encompassing the maternal-fetal
interface. In accordance with other systems, EPHB4
(Fig. 3A) and ephrin B2
(Fig. 3B) were expressed by
endothelial cells of uterine veins and arteries, respectively.
Cytotrophoblasts switched from a venous to an arterial pattern of EPH and
ephrin expression as they differentiated along the pathway that leads to
uterine invasion. In placental chorionic villi, cytotrophoblast progenitors
and syncytiotrophoblasts that line the intervillous space expressed EPHB4
(Fig. 3C). At the boundary
where progenitors commit to differentiation, they abruptly downregulated EPHB4
expression and began to express ephrin B1
(Fig. 3D), which binds EPHB4
(Sakano et al., 1996
), and
EPHB2 (Fig. 3E), a receptor for
the ephrin B ligands. These molecules continued to be expressed as the cells
infiltrated the uterine stroma and occupied maternal arterioles
(Fig. 3D,E). Finally, within
the uterine wall, many of the interstitial and endovascular cytotrophoblasts
upregulated ephrin B2 (Fig.
3F). Based on these expression patterns, we concluded that
invasive cytotrophoblasts are equipped to interact with EPHB4, which is
expressed by cytotrophoblast progenitors and maternal veins, via the ligands
ephrin B1 and B2. Additionally, invasive cytotrophoblasts express the EPHB2
receptor, a binding partner for ephrin B2 expressed on maternal arteries
(Fig. 3G).
Next, we used northern blot hybridization to determine if our culture model (described above) mimicked the regulated expression of cytotrophoblast EPHs and ephrins that we observed at the maternal-fetal interface in situ. In these experiments, RNA samples were isolated from cytotrophoblast progenitors before they were plated on Matrigel (0 hour) and after they were allowed to differentiate for 12 or 24 hours in culture (Fig. 3H). The progenitors expressed high levels of EPHB4 mRNA that were lost as the cells differentiated, i.e. acquired an invasive phenotype. Conversely, signals corresponding to ephrin B1, B2 and EPHB2 mRNAs were dramatically upregulated during this same time period. Finally, cytotrophoblasts isolated from first-trimester, second-trimester or term placentas executed the same general pattern of EPH and ephrin modulation in vitro.
Cytotrophoblasts avoid substrates formed from EPHB4, but not ephrin B2
To gain mechanistic insights into EPH and ephrin functions in
cytotrophoblasts, we used a substratum choice technique that was developed to
understand the role of these counter-receptors in the nervous system
(Birgbauer et al., 2001
). In
these experiments, cytotrophoblast progenitors were cultured on laminin
substrates that were spotted with either ephrin B2-Fc or EPHB4-Fc. The results
showed that cytotrophoblasts differentially interpreted signals garnered from
ligating ephrin B2 or EPHB4. On ephrin B2-spotted substrates
(Fig. 4A,C) and control
substrates spotted with human IgG (data not shown), the cells formed
aggregates that were equally distributed over the entire surface of the
culture dish. By contrast, regions that contained EPHB4 had significantly
fewer cytotrophoblasts, with the outer edge of the spot appearing to form a
boundary (Fig. 4B,D). Video
microscopy revealed that the cells were not able to adhere to EPHB4 (data not
shown). These results suggest that cytotrophoblasts specifically avoid
substrates containing EPHB4.
|
|
To further characterize this effect, we used time-lapse videomicroscopy to track, during the first 15 hours of culture, cytotrophoblast migration under control or experimental conditions. In each experiment, cytotrophoblasts co-cultured on a laminin substrate with control 3T3 cells (Fig. 5F) migrated on average twice as far as those that were cultured with the 3T3-EPHB4 line (Fig. 5G; quantification shown in Fig. 5H). Co-cultures on Matrigel gave very similar results (Fig. 5H). In summary, these data support the hypothesis that the interactions of cytotrophoblasts with EPHB4-expressing cells, such as those that line uterine veins, restrict their migration, whereas interactions with ephrin B2-expressing cells, such as those that line maternal arteries, do not.
EPHB4 specifically regulates chemokine-induced migration
As invasive cytotrophoblasts respond to both chemokine and EPH/ephrin
signals, we investigated the possibility of crosstalk between these two
pathways. In the developing nervous system, PDZ-RGS3, a regulator of
G-protein-coupled receptors, constitutively associates with the cytoplasmic
domain of ephrin B molecules. Upon interactions with EPH receptors, the RGS
domain inhibits chemokine receptor signaling by initiating ATPase activity
(Lu et al., 2001
). Therefore,
we used RT-PCR to determine if cytotrophoblasts express this molecule, which
links EPH/ephrin and chemokine responses. The results are shown in
Fig. 6A. A band of the expected
size was observed when RNA samples isolated from either first- or
second-trimester cytotrophoblasts were analyzed. A band of the same size was
observed when RNA extracted from brain was processed in parallel. By contrast,
samples from control cells (peripheral blood mononuclear cells or NIH 3T3 cell
lines) lacked PDZ-RGS3 expression.
Accordingly, we looked for evidence of specific effects of ephrin signaling
in terms of chemokine-induced cytotrophoblast migration. In these experiments,
we tested the effects of EPHB4-Fc in the aforementioned transwell migration
assay. Under control conditions, the addition of either chemokines (CXCL12,
CXCL16 and CCL21) or a growth factor cocktail with serum to the medium
significantly increased cytotrophoblast migration
(Fig. 6B). By contrast,
addition of EPHB4-Fc had differential effects on chemokine and growth factor
actions (Fig. 6B).
Specifically, chemokine-induced migration was inhibited by
60%, whereas
growth factor effects were not significantly different from those of the
controls (Fig. 6C).
| Discussion |
|---|
|
|
|---|
The first indication that interplay between these pathways could play an
important role in human placentation came from studies in which we surveyed
the expression of both chemokines and EPH/ephrin family members at the
maternal-fetal interface. Significantly, cytotrophoblast invasion was
associated with modulated expression of molecules from both families, and in
some cases overlapping expression suggested the possibility of molecular
crosstalk. As to chemokines, invasive cytotrophoblasts express CXCL12 and
CXCL16, and their receptors, CXCR4 and CXCR6. In addition, they express CCR7,
a receptor for CCL21 expressed by maternal cells. These chemokines were
powerful stimulators of cytotrophoblast migration in vitro, suggesting a
similar role during formation of the maternal-fetal interface. Furthermore,
recent evidence suggests that other cell types contribute to the uterine
chemokine milieu. For example, cytotrophoblast invasion stimulates platelet
deposition within uterine vessels and the latter cells produce a chemokine
that attracts cytotrophoblasts in vitro
(Sato et al., 2005
).
Cytotrophoblast invasion is also associated with downregulation of EPHB4 and sequential upregulation of ephrin B1 and B2. Data from our microarray analyses validated by RNase protection assays suggest that these ligand-receptor pairs dominate cytotrophoblast EPH and ephrin expression. With regard to functional analyses, isolated cytotrophoblasts avoided substrates containing EPHB4 and decreased migration when they encountered EPHB4-expressing cells, suggesting that these interactions influence pathways that involve adhesion molecules. Interestingly, subsequent experiments showed that cytotrophoblast interactions with EPHB4 specifically downregulated chemokine-induced migration without affecting growth factor-induced movement. These data support a model in which autocrine and paracrine chemokine signals stimulate cytotrophoblast migration within the uterine wall where they encounter blood vessels. This phenomenon is blunted when the cells interact with EPHB4 expressed on the endothelial cells that line maternal veins. As a result, the cells preferentially remodel spiral arterioles.
|
-smooth muscle actin. By contrast, plating precursors on
EPHB4-expressing OP9 cells inhibited all these processes
(Zhang et al., 2001
We suggest that these receptor-ligand pairs have similar roles at the
maternal-fetal interface. Cytotrophoblast commitment to invasion is associated
not only with upregulation of endothelial markers
(Zhou et al., 1997
) but, more
specifically, with adoption of an arterial fate. It is likely that this
transition has several important consequences with regard to patterning
cytotrophoblast invasion. For example, cytotrophoblast progenitors that are
attached to the trophoblast basement membrane of chorionic villi express
EPHB4. Cells at the base of columns (see
Fig. 1) execute a dramatic
downregulation of this transmembrane receptor and a concomitant upregulation
of ephrin B1. Our data suggest that interactions between this receptor-ligand
pair could form a boundary that orients cytotrophoblast invasion away from the
placenta and towards the uterus (Fig.
7A). Our findings also suggest that acquisition of an arterial
phenotype restricts cytotrophoblast migration into EPHB4-expressing uterine
veins, resulting in asymmetrical vascular remodeling
(Fig. 7B). Despite species
differences in vascular invasion, it would be interesting to assess the
relationship between cytotrophoblasts and uterine blood vessels in mice
deficient in the above molecules. However, ephrin B2 and EPHB4-null mice die
around the time period when the mature placenta begins to function, and ephrin
B1 is not expressed in analogous placental cell types
(Sapin et al., 2000
).
|
Given the endothelial characteristics displayed by cytotrophoblasts, a
similar interplay between ephrin Bs and chemokine receptors may occur during
vasculogenesis and/or angiogenesis. Like EPHB4 and ephrin B2, CXCR4 is
expressed on endothelial cells and plays important roles in vascular
development (Salcedo and Oppenheim,
2003
; Tachibana et al.,
1998
). CXCR4 expression is pro-angiogenic, suggesting that
EPHB4-ephrin B2 interactions may function by limiting CXCL12-induced migration
of arterial endothelial cells into veins and vice versa. Currently, there is a
great deal of interest in how the ephrin B2 cytoplasmic domain functions in
endothelial cells during angiogenesis
(Adams et al., 2001
;
Cowan et al., 2004
;
Makinen et al., 2005
).
Finally, our findings have interesting implications for other aspects of
reproduction. For example, the human blastocyst expresses EPHA1, and its
ligand, ephrin A1, is present on the uterine epithelium during the
implantation window (Fujiwara et al.,
2002
) (K.R.-H. and S.J.F., unpublished). Furthermore, the human
blastocyst expresses chemokine receptors
(Dominguez et al., 2003
), and
uterine expression of several chemokines is hormonally regulated
(Caballero-Campo et al., 2002
).
Therefore, it is possible that the pathways described in this report function
from the earliest stages of pregnancy onwards. With regard to perfusion of the
placenta, trophoblast invasion of uterine vessels initiates blood flow to the
maternal-fetal interface at
10-12 weeks of gestation. We speculate that a
failure of invasive cytotrophoblasts to upregulate an arterial phenotype would
lead to the loss of pregnancy during the late first or early second trimester.
By contrast, partial defects in this process could lead to reduced arterial
invasion, the hallmark of pre-eclampsia and of a subset of pregnancies
complicated by intrauterine growth restriction. Thus, EPH and ephrin actions
mediated by chemokines and their receptors could play crucial master
regulatory roles in the initiation and continuation of human pregnancy.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Adams, R. H., Wilkinson, G. A., Weiss, C., Diella, F., Gale, N.
W., Deutsch, U., Risau, W. and Klein, R. (1999). Roles of
ephrinB ligands and EphB receptors in cardiovascular development: demarcation
of arterial/venous domains, vascular morphogenesis, and sprouting
angiogenesis. Genes Dev.
13,295
-306.
Adams, R. H., Diella, F., Hennig, S., Helmbacher, F., Deutsch, U. and Klein, R. (2001). The cytoplasmic domain of the ligand ephrinB2 is required for vascular morphogenesis but not cranial neural crest migration. Cell 104,57 -69.[CrossRef][Medline]
Adamson, S. L., Lu, Y., Whiteley, K. J., Holmyard, D., Hemberger, M., Pfarrer, C. and Cross, J. C. (2002). Interactions between trophoblast cells and the maternal and fetal circulation in the mouse placenta. Dev. Biol. 250,358 -373.[CrossRef][Medline]
Beckmann, M. P., Cerretti, D. P., Baum, P., Vanden Bos, T., James, L., Farrah, T., Kozlosky, C., Hollingsworth, T., Shilling, H., Maraskovsky, E. et al. (1994). Molecular characterization of a family of ligands for eph-related tyrosine kinase receptors. EMBO J. 13,3757 -3762.[Medline]
Birgbauer, E., Oster, S. F., Severin, C. G. and Sretavan, D.
W. (2001). Retinal axon growth cones respond to EphB
extracellular domains as inhibitory axon guidance cues.
Development 128,3041
-3048.
Caballero-Campo, P., Dominguez, F., Coloma, J., Meseguer, M.,
Remohi, J., Pellicer, A. and Simon, C. (2002). Hormonal and
embryonic regulation of chemokines IL-8, MCP-1 and RANTES in the human
endometrium during the window of implantation. Mol. Hum.
Reprod. 8,375
-384.
Cerretti, D. P., Vanden Bos, T., Nelson, N., Kozlosky, C. J., Reddy, P., Maraskovsky, E., Park, L. S., Lyman, S. D., Copeland, N. G., Gilbert, D. J. et al. (1995). Isolation of LERK-5: a ligand of the eph-related receptor tyrosine kinases. Mol. Immunol. 32,1197 -1205.[CrossRef][Medline]
Cowan, C. A., Yokoyama, N., Saxena, A., Chumley, M. J., Silvany, R. E., Baker, L. A., Srivastava, D. and Henkemeyer, M. (2004). Ephrin-B2 reverse signaling is required for axon pathfinding and cardiac valve formation but not early vascular development. Dev. Biol. 271,263 -271.[CrossRef][Medline]
Damsky, C. H., Fitzgerald, M. L. and Fisher, S. J. (1992). Distribution patterns of extracellular matrix components and adhesion receptors are intricately modulated during first trimester cytotrophoblast differentiation along the invasive pathway, in vivo. J. Clin. Invest. 89,210 -222.
Dickey, R. P. and Hower, J. F. (1995).
Ultrasonographic features of uterine blood flow during the first 16 weeks of
pregnancy. Hum. Reprod.
10,2448
-2452.
Dominguez, F., Galan, A., Martin, J. J., Remohi, J., Pellicer,
A. and Simon, C. (2003). Hormonal and embryonic regulation of
chemokine receptors CXCR1, CXCR4, CCR5 and CCR2B in the human endometrium and
the human blastocyst. Mol. Hum. Reprod.
9, 189-198.
Drake, P. M., Gunn, M. D., Charo, I. F., Tsou, C. L., Zhou, Y.,
Huang, L. and Fisher, S. J. (2001). Human placental
cytotrophoblasts attract monocytes and CD56bright natural killer cells via the
actions of monocyte inflammatory protein 1 alpha. J. Exp.
Med. 193,1199
-1212.
Drake, P. M., Red-Horse, K. and Fisher, S. J. (2004). Reciprocal chemokine receptor and ligand expression in the human placenta: implications for cytotrophoblast differentiation. Dev. Dyn. 229,877 -885.[CrossRef][Medline]
Fischer, A., Schumacher, N., Maier, M., Sendtner, M. and
Gessler, M. (2004). The Notch target genes Hey1 and Hey2 are
required for embryonic vascular development. Genes
Dev. 18,901
-911.
Fisher, S. J., Cui, T. Y., Zhang, L., Hartman, L., Grahl, K.,
Zhang, G. Y., Tarpey, J. and Damsky, C. H. (1989). Adhesive
and degradative properties of human placental cytotrophoblast cells in vitro.
J. Cell Biol. 109,891
-902.
Fujiwara, H., Yoshioka, S., Tatsumi, K., Kosaka, K., Satoh, Y.,
Nishioka, Y., Egawa, M., Higuchi, T. and Fujii, S. (2002).
Human endometrial epithelial cells express ephrin A1: possible interaction
between human blastocysts and endometrium via Eph-ephrin system. J.
Clin. Endocrinol. Metab. 87,5801
-5807.
Fuller, T., Korff, T., Kilian, A., Dandekar, G. and Augustin, H.
G. (2003). Forward EphB4 signaling in endothelial cells
controls cellular repulsion and segregation from ephrinB2 positive cells.
J. Cell Sci. 116,2461
-2470.
Gao, P. P., Yue, Y., Cerretti, D. P., Dreyfus, C. and Zhou,
R. (1999). Ephrin-dependent growth and pruning of hippocampal
axons. Proc. Natl. Acad. Sci. USA
96,4073
-4077.
Gerety, S. S. and Anderson, D. J. (2002). Cardiovascular ephrinB2 function is essential for embryonic angiogenesis. Development 129,1397 -1410.
Gerety, S. S., Wang, H. U., Chen, Z. F. and Anderson, D. J. (1999). Symmetrical mutant phenotypes of the receptor EphB4 and its specific transmembrane ligand ephrin-B2 in cardiovascular development. Mol. Cell 4,403 -414.[CrossRef][Medline]
Goldman-Wohl, D., Greenfield, C., Haimov-Kochman, R., Ariel, I., Anteby, E. Y., Hochner-Celnikier, D., Farhat, M. and Yagel, S. (2004). Eph and ephrin expression in normal placental development and preeclampsia. Placenta 25,623 -630.[CrossRef][Medline]
Hanna, J., Wald, O., Goldman-Wohl, D., Prus, D., Markel, G.,
Gazit, R., Katz, G., Haimov-Kochman, R., Fujii, N., Yagel, S. et al.
(2003). CXCL12 expression by invasive trophoblasts induces the
specific migration of CD16-human natural killer cells.
Blood 102,1569
-1577.
Helbling, P. M., Saulnier, D. M. and Brandli, A. W. (2000). The receptor tyrosine kinase EphB4 and ephrin-B ligands restrict angiogenic growth of embryonic veins in Xenopus laevis. Development 127,269 -278.[Abstract]
Jaleel, M. A., Tsai, A. C., Sarkar, S., Freedman, P. V. and
Rubin, L. P. (2004). Stromal cell-derived factor-1 (SDF-1)
signalling regulates human placental trophoblast cell survival.
Mol. Hum. Reprod. 10,901
-909.
Kliman, H. J., Nestler, J. E., Sermasi, E., Sanger, J. M. and
Strauss, J. F., 3rd (1986). Purification, characterization,
and in vitro differentiation of cytotrophoblasts from human term placentae.
Endocrinology 118,1567
-1582.
Lawson, N. D., Scheer, N., Pham, V. N., Kim, C. H., Chitnis, A.
B., Campos-Ortega, J. A. and Weinstein, B. M. (2001). Notch
signaling is required for arterial-venous differentiation during embryonic
vascular development. Development
128,3675
-3683.
Librach, C. L., Werb, Z., Fitzgerald, M. L., Chiu, K., Corwin,
N. M., Esteves, R. A., Grobelny, D., Galardy, R., Damsky, C. H. and Fisher, S.
J. (1991). 92-kD type IV collagenase mediates invasion of
human cytotrophoblasts. J. Cell Biol.
113,437
-449.
Lu, Q., Sun, E. E., Klein, R. S. and Flanagan, J. G. (2001). Ephrin-B reverse signaling is mediated by a novel PDZ-RGS protein and selectively inhibits G protein-coupled chemoattraction. Cell 105,69 -79.[CrossRef][Medline]
Makinen, T., Adams, R. H., Bailey, J., Lu, Q., Ziemiecki, A.,
Alitalo, K., Klein, R. and Wilkinson, G. A. (2005). PDZ
interaction site in ephrinB2 is required for the remodeling of lymphatic
vasculature. Genes Dev.
19,397
-410.
Metcalfe, J., Romney, S. L., Ramsey, L. H., Reid, D. E. and Burwell, C. S. (1955). Estimation of uterine blood flow in normal human pregnancy at term. J. Clin. Invest. 34,1632 -1638.
Red-Horse, K., Drake, P. M., Gunn, M. D. and Fisher, S. J.
(2001). Chemokine ligand and receptor expression in the pregnant
uterus: reciprocal patterns in complementary cell subsets suggest functional
roles. Am. J. Pathol.
159,2199
-2213.
Red-Horse, K., Zhou, Y., Genbacev, O., Prakobphol, A., Foulk, R., McMaster, M. and Fisher, S. J. (2004). Trophoblast differentiation during embryo implantation and formation of the maternal-fetal interface. J. Clin. Invest. 114,744 -754.[CrossRef][Medline]
Sato, Y., Fujiwara, H., Zeng, B., Higuchi, T., Yoshioka, S. and
Fujii, S. (2005). Platelet-derived soluble factors induce
human extravillous trophoblast migration and differentiation: platelets are a
possible regulator of trophoblast infiltration of spiral arteries.
Blood 106,428
-435.
Sakano, S., Serizawa, R., Inada, T., Iwama, A., Itoh, A., Kato, C., Shimizu, Y., Shinkai, F., Shimizu, R., Kondo, S. et al. (1996). Characterization of a ligand for receptor protein-tyrosine kinase HTK expressed in immature hematopoietic cells. Oncogene 13,813 -822.[Medline]
Salcedo, R. and Oppenheim, J. J. (2003). Role of chemokines in angiogenesis: CXCL12/SDF-1 and CXCR4 interaction, a key regulator of endothelial cell responses. Microcirculation 10,359 -370.[CrossRef][Medline]
Sapin, V., Bouillet, P., Oulad-Abdelghani, M., Dastugue, B., Chambon, P. and Dolle, P. (2000). Differential expression of retinoic acid-inducible (Stra) genes during mouse placentation. Mech. Dev. 92,295 -299.[CrossRef][Medline]
Sieg, D. J., Hauck, C. R., Ilic, D., Klingbeil, C. K., Schaefer, E., Damsky, C. H. and Schlaepfer, D. D. (2000). FAK integrates growth-factor and integrin signals to promote cell migration. Nat. Cell Biol. 2,249 -256.[CrossRef][Medline]
Tachibana, K., Hirota, S., Iizasa, H., Yoshida, H., Kawabata, K., Kataoka, Y., Kitamura, Y., Matsushima, K., Yoshida, N., Nishikawa, S. et al. (1998). The chemokine receptor CXCR4 is essential for vascularization of the gastrointestinal tract. Nature 393,591 -594.[CrossRef][Medline]
Wang, H. U., Chen, Z. F. and Anderson, D. J. (1998). Molecular distinction and angiogenic interaction between embryonic arteries and veins revealed by ephrin-B2 and its receptor Eph-B4. Cell 93,741 -753.[CrossRef][Medline]
Wilkinson, D. G. (2001). Multiple roles of EPH receptors and ephrins in neural development. Nat. Rev. Neurosci. 2,155 -164.[Medline]
Zhang, X. Q., Takakura, N., Oike, Y., Inada, T., Gale, N. W.,
Yancopoulos, G. D. and Suda, T. (2001). Stromal cells
expressing ephrin-B2 promote the growth and sprouting of ephrin-B2(+)
endothelial cells. Blood
98,1028
-1037.
Zhou, Y., Fisher, S. J., Janatpour, M., Genbacev, O., Dejana, E., Wheelock, M. and Damsky, C. H. (1997). Human cytotrophoblasts adopt a vascular phenotype as they differentiate. A strategy for successful endovascular invasion? J. Clin. Invest. 99,2139 -2151.[Medline]
Zhou, Y., McMaster, M., Woo, K., Janatpour, M., Perry, J.,
Karpanen, T., Alitalo, K., Damsky, C. and Fisher, S. J.
(2002). Vascular endothelial growth factor ligands and receptors
that regulate human cytotrophoblast survival are dysregulated in severe
preeclampsia and hemolysis, elevated liver enzymes, and low platelets
syndrome. Am. J. Pathol.
160,1405
-1423.
Related articles in Development:
This article has been cited by other articles:
![]() |
H. Fujiwara Do circulating blood cells contribute to maternal tissue remodeling and embryo-maternal cross-talk around the implantation period? Mol. Hum. Reprod., June 1, 2009; 15(6): 335 - 343. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhang, H. Dong, B. Wang, S. Zhu, and B. A. Croy Dynamic Changes Occur in Patterns of Endometrial EFNB2/EPHB4 Expression During the Period of Spiral Arterial Modification in Mice Biol Reprod, September 1, 2008; 79(3): 450 - 458. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J Hannan and L. A Salamonsen CX3CL1 and CCL14 Regulate Extracellular Matrix and Adhesion Molecules in the Trophoblast: Potential Roles in Human Embryo Implantation Biol Reprod, July 1, 2008; 79(1): 58 - 65. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Arvanitis and A. Davy Eph/ephrin signaling: networks Genes & Dev., February 15, 2008; 22(4): 416 - 429. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Natanson-Yaron, E. Y. Anteby, C. Greenfield, D. Goldman-Wohl, Y. Hamani, D. Hochner-Celnikier, and S. Yagel FGF 10 and Sprouty 2 modulate trophoblast invasion and branching morphogenesis Mol. Hum. Reprod., July 1, 2007; 13(7): 511 - 519. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||